L-glutamine permease, mutants thereof and uses thereof

Abstract

The present application relates to the technical field of microbial engineering, and particularly relates to L-glutamine export protein, mutants thereof and application thereof. The present application enhances the expression of the E. coli-derived rarD gene in corynebacterium bacteria, so that the ability of corynebacterium bacteria to produce L-glutamine is significantly improved. The present application also provides a mutant of RarD protein, which can significantly improve the activity of RarD protein in exporting L-glutamine, and can be used to improve the yield and conversion rate of L-glutamine or derivatives taking L-glutamine as a precursor in microorganisms such as corynebacterium glutamicum, E. coli and bacillus subtilis.

Description

Technical Field

[0001] This invention relates to the field of microbial engineering technology, specifically to L-glutamine efflux protein, its mutants, and their applications. Background Technology

[0002] L-Glutamine is a non-essential amino acid, chemically known as 2-amino-4-carbamoylbutyric acid. It encodes proteins, promotes protein synthesis, inhibits protein breakdown, and is used to treat gastric and duodenal ulcers, playing an important role in the pharmaceutical industry.

[0003] Currently, the most common method for producing L-glutamine is fermentation, which offers advantages such as a wide availability of raw materials, low production costs, controllable product quality, and a single product. The primary production strain is *Corynebacterium glutamicum*. *Corynebacterium glutamicum* is a heterotrophic aerobic, Gram-positive bacterium characterized by rapid growth, non-pathogenicity, and weak degradation of its own metabolites. However, the fermentation performance of current L-glutamine-producing strains remains poor, resulting in unsatisfactory yields and conversion rates. Industrial demand for L-glutamine is high, and existing strains cannot meet the needs of large-scale industrial production. Summary of the Invention

[0004] The first objective of this invention is to provide the application of Escherichia coli RarD protein and Corynebacterium microorganisms that express Escherichia coli RarD protein.

[0005] A second objective of this invention is to provide a RarD protein mutant and its applications.

[0006] A third objective of this invention is to provide a recombinant microorganism expressing a RarD protein mutant and a method for producing L-glutamine or a derivative thereof by fermentation using the microorganism.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides the application of Escherichia coli RarD protein or its encoding gene in improving the ability of microorganisms to transport L-glutamine, increasing the yield or conversion rate of L-glutamine or its derivatives in microorganisms, or constructing microorganisms for producing L-glutamine or its derivatives.

[0009] RarD is a putative transporter protein of Escherichia coli. This invention has found that the Escherichia coli RarD protein has the activity of transporting L-glutamine from inside the microbial cell to outside the cell, which can be used to improve the L-glutamine transport capacity of microorganisms, thereby increasing the yield and conversion rate of L-glutamine.

[0010] The sequence of the Escherichia coli RarD protein or its encoding gene can be obtained by those skilled in the art through publicly available databases, for example: the gene number of one Escherichia coli RarD protein is b3819, and its amino acid sequence is shown in SEQ ID NO. 5.

[0011] Specifically, the above applications are to enhance the L-glutamine transport capacity of microorganisms or increase the yield or conversion rate of L-glutamine or its derivatives by enhancing the activity and / or expression of RarD protein.

[0012] The enhancement of RarD protein activity and expression described above can be achieved through any of the following methods 1)-6) or any combination thereof:

[0013] 1) Enhancement was achieved by introducing a plasmid containing the RarD protein-coding gene;

[0014] 2) Enhanced by increasing the copy number of the RarD protein-encoding gene on the chromosome;

[0015] 3) Enhanced by altering the promoter sequence of the RarD protein-encoding gene on chromosomes;

[0016] 4) Enhancement is achieved by operatively linking a strong promoter to the RarD protein-coding gene;

[0017] 5) Enhancement is achieved by altering the amino acid sequence of the RarD protein;

[0018] 6) Enhancement is achieved by altering the sequence of the RarD protein-coding gene.

[0019] The microorganisms mentioned above are preferably Corynebacterium, Escherichia, or Bacillus.

[0020] In this invention, the L-glutamine derivatives are substances biosynthesized using L-glutamine as a precursor, including but not limited to nucleoside compounds, arginine, etc.

[0021] Secondly, the present invention provides a modified Corynebacterium microorganism that expresses the Escherichia coli RarD protein.

[0022] The expression of E. coli RarD protein described above can be achieved through any of the following methods 1)-2) or any combination thereof:

[0023] 1) Import a plasmid containing the RarD protein-coding gene;

[0024] 2) Insert the RarD protein-encoding gene into the chromosome.

[0025] Preferably, the Corynebacterium species is Corynebacterium glutamicum.

[0026] Thirdly, the present invention provides a RarD protein mutant, using the RarD protein of wild-type Escherichia coli as a reference sequence, wherein the RarD protein mutant has a mutation at amino acid position 188, which is a mutation of amino acids other than proline and serine.

[0027] Preferably, the RarD protein mutant has a mutation at amino acid position 188, which is either threonine or leucine.

[0028] This invention discovers that mutating the 188th amino acid of the RarD protein to threonine or leucine can significantly improve its L-glutamine transport activity, which can be used to improve the L-glutamine efflux capacity of microorganisms, thereby increasing the yield and conversion rate of L-glutamine.

[0029] More preferably, the amino acid sequence of the RarD protein mutant is as shown in SEQ ID NO.1 or 2.

[0030] In the RarD protein mutant shown in SEQ ID NO.1, the 188th amino acid is mutated to threonine, and in the RarD protein mutant shown in SEQ ID NO.2, the 188th amino acid is mutated to leucine.

[0031] Fourthly, the present invention provides a nucleic acid molecule encoding the RarD protein mutant.

[0032] Based on the amino acid sequence and codon rules of the RarD protein mutant described above, those skilled in the art can determine the nucleotide sequence of the nucleic acid molecule encoding the RarD protein mutant.

[0033] Fifthly, the present invention provides biological materials containing the nucleic acid molecules, wherein the biological material is an expression cassette, a vector, or a host cell.

[0034] The expression cassette is a recombinant nucleic acid molecule obtained by operatively linking the nucleic acid molecule with a transcriptional or translational regulatory element.

[0035] The vectors include, but are not limited to, plasmid vectors.

[0036] The host cell includes, but is not limited to, microbial cells, preferably Corynebacterium, Escherichia, or Bacillus.

[0037] In a sixth aspect, the present invention provides the application of the RarD protein mutant or the nucleic acid molecule in improving the L-glutamine transport capacity of microorganisms, increasing the yield or conversion rate of L-glutamine or its derivatives in microorganisms, or constructing microorganisms for producing L-glutamine or its derivatives.

[0038] Preferably, the microorganism is a Corynebacterium, Escherichia, or Bacillus.

[0039] In a seventh aspect, the present invention provides a recombinant microorganism expressing the RarD protein mutant.

[0040] Preferably, the recombinant microorganism is a Corynebacterium, Escherichia, or Bacillus.

[0041] The RarD protein mutants described above can be achieved through any of the following methods 1)-2) or any combination thereof:

[0042] 1) Import a plasmid containing the gene encoding the RarD protein mutant;

[0043] 2) Insert the gene encoding the RarD protein mutant into the chromosome.

[0044] More preferably, the recombinant microorganism is a glutamate rod-shaped bacterium with a nucleic acid molecule encoding the RarD protein mutant inserted into its chromosome.

[0045] As a preferred embodiment of the present invention, the nucleic acid molecule encoding the RarD protein mutant is further connected to a Psod promoter upstream.

[0046] The optional chromosome insertion site is CEY17_12610.

[0047] The recombinant microorganism is obtained by inserting a nucleic acid molecule encoding the RarD protein mutant into the chromosome of the starting strain.

[0048] The starting strain of the recombinant microorganisms described above is preferably a microorganism capable of synthesizing and accumulating L-glutamine.

[0049] Microorganisms capable of synthesizing and accumulating L-glutamine can be obtained through genetic engineering or mutagenesis.

[0050] Preferably, the activity of any one or more of the following enzymes (1)-(3) in the starting strain is reduced or inactivated:

[0051] (1) Adenosyltransferase;

[0052] (2) L-glutaminease;

[0053] (3) α-ketoglutarate dehydrogenase;

[0054] Preferably, the α-ketoglutarate dehydrogenase is α-ketoglutarate dehydrogenase E1.

[0055] And / or, the activity of pyruvate carboxylase is enhanced in the starting strain.

[0056] The aforementioned reduction or inactivation of activity can be achieved by reducing the expression of the gene encoding the enzyme or by knocking out the endogenous gene encoding the enzyme.

[0057] The above-mentioned activity enhancement can be achieved by any one of the following 1) to 6) or any combination thereof:

[0058] 1) Enhancement is achieved by introducing a plasmid containing the gene encoding the enzyme;

[0059] 2) Enhanced by increasing the copy number of the gene encoding the enzyme on the chromosome;

[0060] 3) Enhancement is achieved by altering the promoter sequence of the gene encoding the enzyme on the chromosome;

[0061] 4) Enhancement is achieved by operatively linking a strong promoter to the gene encoding the enzyme;

[0062] 5) Enhancement is achieved by altering the amino acid sequence of the enzyme;

[0063] 6) Enhancement is achieved by altering the nucleotide sequence encoding the enzyme.

[0064] Preferably, the starting strain is obtained by the above-described modification of Corynebacterium glutamicum ATCC 14067.

[0065] As a preferred embodiment of the present invention, the starting strain is Corynebacterium glutamicum MHZ-0513-3, with accession number CGMCC No. 13405. Corynebacterium glutamicum MHZ-0513-3 has been disclosed in patent application CN106701649A, and its classification name is Corynebacterium glutamicum. It was deposited on November 30, 2016, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 13405.

[0066] Eighthly, the present invention provides the use of the modified Corynebacterium spp. microorganism or the recombinant microorganism in the production of L-glutamine or its derivatives or in increasing the yield or conversion rate of L-glutamine or its derivatives.

[0067] In a ninth aspect, the present invention provides a method for fermenting to produce L-glutamine or a derivative thereof, the method comprising: culturing the modified Corynebacterium spp. or the recombinant microorganism to obtain a culture; and collecting L-glutamine or a derivative thereof from the culture.

[0068] The beneficial effects of this invention are as follows:

[0069] 1. This invention significantly enhances the L-glutamine production capacity of Corynebacterium spp. by strengthening the expression of the rarD gene derived from Escherichia coli. Verification has shown that Corynebacterium glutamicum with the E. coli-derived rarD gene inserted into its chromosome exhibits a significantly increased L-glutamine production.

[0070] 2. The RarD protein mutant provided by this invention can significantly improve the activity of RarD protein in excreting L-glutamine, and can be used to improve the L-glutamine yield and conversion rate of microorganisms such as Corynebacterium glutamicum, Escherichia coli, and Bacillus subtilis. It has been verified that the L-glutamine yield of Corynebacterium glutamicum with the RarD protein mutant encoding gene inserted into its chromosome is further improved. This mutant can be applied to the fermentation production of L-glutamine or derivatives with L-glutamine as a precursor (arginine and nucleoside products, etc.). Detailed Implementation

[0071] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0072] The primer names and sequences involved in the following examples are shown in Table 1.

[0073] Table 1 Primer sequences

[0074]

[0075]

[0076] Unless otherwise specified, the techniques or conditions described in the following examples shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0077] Example 1: Construction of plasmid pK18-Psod-rarD and construction of recombinant strain MHZ-0513-3-Psod-rarD

[0078] The rarD gene derived from Escherichia coli was inserted into the genome of Corynebacterium glutamicum MHZ-0513-3 at position CEY17_12610. The specific construction process is as follows:

[0079] Using Phusion superfidelity polymerase (New England BioLabs), the recombinant fragment UP was amplified using the genome of Corynebacterium glutamicum MHZ-0513-3 as a template and primers PQ01-UP-F / PQ02-UP-R. The recombinant fragment DN was amplified using primers PQ07-DN-F / PQ08-DN-R, and the promoter fragment Psod was amplified using primers PQ03-Psod-F / PQ04-Psod-R. The gene fragment rarD was amplified using Escherichia coli K-12MG1655 as a template and primers PQ05-rarD-F / PQ06-rarD-R. The resulting fragments were purified using an agarose gel extraction kit (Tiangen). Subsequently, using UP and Psod as templates and primers PQ01-UP-F / PQ04-Psod-R, the overlap fragment was amplified. The resulting overlap fragment was also purified using an agarose gel extraction kit (Tiangen). Simultaneously, pK18-mobsacB (Wuhan Miaoling Biotechnology Co., Ltd.) was digested using XbaI / SalI. The overlap, rarD, and DN fragments were then assembled with the pK18-mobsacB vector using a seamless cloning kit (Novizan). The resulting assembly was transformed into Trans1T1 competent cells (TransGen Biotech). Kanamycin-resistant clones were selected, and XbaI / SalI digestion confirmed the presence of the pK18mobsacB insert. Further sequencing using P82 / P85 primers (Genewiz) confirmed the correct insertion (sequencing results are shown in SEQ ID NO.3). The resulting plasmid was named pK18-Psod-rarD.

[0080] pK18-Psod-rarD was transformed into Corynebacterium glutamicum MHZ-0513-3, and recombinants were selected on selective medium containing 15 mg / L kanamycin. The culture temperature was 33°C, and the culture was inverted. The selected transformants were cultured overnight in ordinary liquid brain heart extract medium at 30°C with shaking at 220 rpm. During this culture, the transformants underwent a second recombination, removing the vector sequence from the genome through gene exchange. The culture was serially diluted (10⁻⁶ oz / mL). -2 Continuous dilution to 10 -4 The diluted solution was spread onto ordinary solid brain and heart extract medium containing 10% sucrose and incubated at 33°C for 48 hours. The selected strains were then subjected to further phenotypic verification, and Kan was selected. SThe recombinants were verified using PQ09-ID-F / PQ10-ID-R. The obtained positive recombinants were amplified and sequenced using PQ09-ID-F / PQ10-ID-R to verify that the obtained mutant strain was the target mutant strain and named MHZ-0513-3-Psod-rarD. This strain has a sequentially linked Psod promoter and E. coli-derived rarD gene inserted at CEY17_12610 in the genome of MHZ-0513-3. The nucleotide sequence of the rarD gene is shown in SEQ ID NO.4, the amino acid sequence of the encoded protein is shown in SEQ ID NO.5, and the nucleotide sequence of the Psod promoter is shown in SEQ ID NO.6.

[0081] Example 2 Construction of the rarD point mutant plasmid of the L-glutamine efflux protein gene and genome modification

[0082] 1. Plasmid pK18-rarD P188T and recombinant strain MHZ-0513-3-rarD P188T The specific construction process is as follows:

[0083] Using Phusion superfidelity polymerase (New England BioLabs), the recombinant fragment UP was prepared using the genome of Corynebacterium glutamicum MHZ-0513-3 as a template and PQ11-UP-F / PQ12-UP-R as primers. The recombinant fragment DN was prepared using PQ13-DN-F / PQ14-DN-R as primers. The obtained fragments were purified using an agarose gel extraction kit (Tiangen Biotech). Simultaneously, pK18-mobsacB (Wuhan Miaoling Biotechnology Co., Ltd.) was digested using XbaI / SalI. The UP and DN fragments and the pK18-mobsacB vector were assembled using a seamless cloning kit (Novizan). The resulting fragments were transformed into Trans1T1 competent cells (TransGen Biotech). Kanamycin-resistant clones were selected, and positive clones with pK18mobsacB insertion were identified by XbaI / SalI digestion. The insertion of the fragment was further confirmed by sequencing using P82 / P85 primers (Giwiz). The obtained plasmid was named pK18-rarD P188T . pK18-rarD P188TTransformants were transferred into Corynebacterium glutamicum MHZ-0513-3-Psod-rarD and recombinants were selected on selective medium containing 15 mg / L kanamycin. The culture temperature was 33°C, and the culture was inverted. The selected transformants were cultured overnight in ordinary liquid brain heart extract medium at 30°C with shaking at 220 rpm. During this culture, the transformants underwent a second recombination, removing the vector sequence from the genome through gene exchange. The culture was then serially diluted (10⁻⁶ oz). -2 Continuous dilution to 10 -4 The diluted solution was spread onto ordinary solid brain and heart extract medium containing 10% sucrose and incubated at 33°C for 48 hours. The selected strains were then subjected to further phenotypic verification, and Kan was selected. S The recombinants were validated using PQ15-F / PQ14-DN-R to identify point mutation recombinants. By adjusting the annealing temperature, recombinants containing point mutations were obtained. The positive recombinants were then amplified and sequenced using PQ16-ID-F / PQ17-ID-R to verify that the obtained strain was the target mutant strain, and named MHZ-0513-3-rarD. P188T Based on MHZ-0513-3-Psod-rarD, this strain mutated the rarD gene, resulting in a P188T mutation in its encoded protein (the 188th amino acid changed from proline to threonine).

[0084] 2. Plasmid pK18-rarD P188L and recombinant strain MHZ-0513-3-rarD P188L Construction

[0085] plasmid pK18-rarD P188L The construction method is the same as described in section 1 above, using primers PQ11-UP-F, PQ14-DN-R, PQ16-ID-F, PQ17-ID-R, PQ18-UP-R, PQ19-DN-F, and PQ20-F. The plasmid pK18-rarD... P188L Transfected into Corynebacterium glutamicum MHZ-0513-3-Psod-rarD, MHZ-0513-3-rarD was obtained according to the strain construction method in section 1 above. P188L Based on MHZ-0513-3-Psod-rarD, this strain mutated the rarD gene, resulting in a P188L mutation in its encoded protein (the 188th amino acid was changed from proline to leucine).

[0086] Example 3 Performance of MHZ-0513-3-Psod-rarD strain in producing L-glutamine

[0087] Fermentation experiments were conducted on the MHZ-0513-3-Psod-rarD strain constructed in Example 1. The method for verifying L-glutamine production through fermentation was as follows: The strain, frozen in glycerol tubes at -80℃, was inoculated into an agar slant for activation. After culturing at 33℃ for 24 hours, bacterial growth occurred. Bacterial growth was picked from the freshly activated slant and inoculated into seed culture medium. The culture was then incubated at 33℃ with shaking at 100 rpm until the mid-to-late logarithmic growth stage, for 5 hours, to obtain seed culture. 10% of the seed culture was inoculated into a 500 ml shake flask containing 20 ml of fermentation medium and incubated at 33℃ with shaking at 150 rpm for 48 hours. The turbidity of the culture broth was measured at 562 nm, and the L-glutamine content in the culture broth was determined by high-performance liquid chromatography (HPLC). The results are shown in Table 2 (OD). 562 The turbidity of the culture medium at 562 nm indicates the cell mass; Gln (g / L) represents the amount of accumulated L-glutamine, and Gln conversion rate (%) represents the conversion rate of L-glutamine relative to glucose.

[0088] The culture medium formulations mentioned above are as follows:

[0089] Slant culture medium: brain heart extract 37 g / L, agar 1.8%, sterilized at 121℃ and 0.1 MPa for 20 min;

[0090] The seed culture medium consisted of: glucose 50 g / L, urea 5 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 30 g / L, and pH 7.0.

[0091] The fermentation medium was: glucose 90 g / L, (NH4)2SO4 40 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 10 g / L, CaCO3 50 g / L, pH 7.0.

[0092] Table 2. Detection of L-glutamine production by recombinant strains.

[0093]

[0094]

[0095] The results showed that after expressing the L-glutamine efflux protein gene rarD from E. coli in MHZ-0513-3, the L-glutamine yield increased from 28.5 g / L to 31.9 g / L, and acid production increased by 11.9%. This indicates that rarD enhancement is beneficial to the accumulation of L-glutamine.

[0096] Example 4: Performance of L-glutamine production by a point mutant strain of the L-glutamine efflux protein gene rarD

[0097] The two mutant strains MHZ-0513-3-rarD constructed in Example 2 P188T and MHZ-0513-3-rarD P188L Fermentation experiments were conducted using the same methods as in Example 3. The fermentation results are shown in Table 3. The results indicate that, compared to the starting strain MHZ-0513-3, the L-glutamine production of the mutant strains was significantly increased, with MHZ-0513-3-rarD showing the most significant increase. P188T The L-glutamine yield was increased to 38.6 g / L, acid production increased by 35.4%, and the conversion rate reached 43.0%. Therefore, the RarD mutant can be used in other host bacteria such as Corynebacterium glutamicum, Escherichia coli, and Bacillus subtilis for the production of L-glutamine or derivatives using L-glutamine as a precursor, such as nucleoside products and arginine.

[0098] Table 3. Detection of L-glutamine production in mutant strains.

[0099] MHZ-0513-3 43.3 28.5 -- 31.7 MHZ-0513-3-Psod-rarD 43.5 31.9 11.9 35.5 <![CDATA[MHZ-0513-3-Psod-rarD P188T ]]> 43.6 38.6 35.4 43.0 <![CDATA[MHZ-0513-3-Psod-rarD P188L ]]> 43.1 37.1 30.2 41.3

[0100] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> L-glutamine efflux protein, its mutants and their applications <130> KHP221110899.3 <160> 28 <170> SIPOSequenceListing 1.0 <210> 1 <211> 296 <212> PRT <213> Artificial Sequence <400> 1 Met Asp Ala Lys Gln Thr Arg Gln Gly Val Leu Leu Ala Leu Ala Ala 1 5 10 15 Tyr Phe Ile Trp Gly Ile Ala Pro Ala Tyr Phe Lys Leu Ile Tyr Tyr 20 25 30 Val Pro Ala Asp Glu Ile Leu Thr His Arg Val Ile Trp Ser Phe Phe 35 40 45 Phe Met Val Val Leu Met Ser Ile Cys Arg Gln Trp Ser Tyr Leu Lys 50 55 60 Thr Leu Ile Gln Thr Pro Gln Lys Ile Phe Met Leu Ala Val Ser Ala 65 70 75 80 Val Leu Ile Gly Gly Asn Trp Leu Leu Phe Ile Trp Ala Val Asn Asn 85 90 95 His His Met Leu Glu Ala Ser Leu Gly Tyr Phe Ile Asn Pro Leu Val 100 105 110 Asn Ile Val Leu Gly Met Ile Phe Leu Gly Glu Arg Phe Arg Arg Met 115 120 125 Gln Trp Leu Ala Val Ile Leu Ala Ile Cys Gly Val Leu Val Gln Leu 130 135 140 Trp Thr Phe Gly Ser Leu Pro Ile Ile Ala Leu Gly Leu Ala Phe Ser 145 150 155 160 Phe Ala Phe Tyr Gly Leu Val Arg Lys Lys Ile Ala Val Glu Ala Gln 165 170 175 Thr Gly Met Leu Ile Glu Thr Met Trp Leu Leu Thr Val Ala Ala Ile 180 185 190 Tyr Leu Phe Ala Ile Ala Asp Ser Ser Thr Ser His Met Gly Gln Asn 195 200 205 Pro Met Ser Leu Asn Leu Leu Leu Ile Ala Ala Gly Ile Val Thr Thr 210 215 220 Val Pro Leu Leu Cys Phe Thr Ala Ala Ala Thr Arg Leu Arg Leu Ser 225 230 235 240 Thr Leu Gly Phe Phe Gln Tyr Ile Gly Pro Thr Leu Met Phe Leu Leu 245 250 255 Ala Val Thr Phe Tyr Gly Glu Lys Pro Gly Ala Asp Lys Met Val Thr 260 265 270 Phe Ala Phe Ile Trp Val Ala Leu Ala Ile Phe Val Met Asp Ala Ile 275 280 285 Tyr Thr Gln Arg Arg Thr Ser Lys 290 295 <210> 2 <211> 296 <212> PRT <213> Artificial Sequence <400> 2 Met Asp Ala Lys Gln Thr Arg Gln Gly Val Leu Leu Ala Leu Ala Ala 1 5 10 15 Tyr Phe Ile Trp Gly Ile Ala Pro Ala Tyr Phe Lys Leu Ile Tyr Tyr 20 25 30 Val Pro Ala Asp Glu Ile Leu Thr His Arg Val Ile Trp Ser Phe Phe 35 40 45 Phe Met Val Val Leu Met Ser Ile Cys Arg Gln Trp Ser Tyr Leu Lys 50 55 60 Thr Leu Ile Gln Thr Pro Gln Lys Ile Phe Met Leu Ala Val Ser Ala 65 70 75 80 Val Leu Ile Gly Gly Asn Trp Leu Leu Phe Ile Trp Ala Val Asn Asn 85 90 95 His His Met Leu Glu Ala Ser Leu Gly Tyr Phe Ile Asn Pro Leu Val 100 105 110 Asn Ile Val Leu Gly Met Ile Phe Leu Gly Glu Arg Phe Arg Arg Met 115 120 125 Gln Trp Leu Ala Val Ile Leu Ala Ile Cys Gly Val Leu Val Gln Leu 130 135 140 Trp Thr Phe Gly Ser Leu Pro Ile Ile Ala Leu Gly Leu Ala Phe Ser 145 150 155 160 Phe Ala Phe Tyr Gly Leu Val Arg Lys Lys Ile Ala Val Glu Ala Gln 165 170 175 Thr Gly Met Leu Ile Glu Thr Met Trp Leu Leu Leu Val Ala Ala Ile 180 185 190 Tyr Leu Phe Ala Ile Ala Asp Ser Ser Thr Ser His Met Gly Gln Asn 195 200 205 Pro Met Ser Leu Asn Leu Leu Leu Ile Ala Ala Gly Ile Val Thr Thr 210 215 220 Val Pro Leu Leu Cys Phe Thr Ala Ala Ala Thr Arg Leu Arg Leu Ser 225 230 235 240 Thr Leu Gly Phe Phe Gln Tyr Ile Gly Pro Thr Leu Met Phe Leu Leu 245 250 255 Ala Val Thr Phe Tyr Gly Glu Lys Pro Gly Ala Asp Lys Met Val Thr 260 265 270 Phe Ala Phe Ile Trp Val Ala Leu Ala Ile Phe Val Met Asp Ala Ile 275 280 285 Tyr Thr Gln Arg Arg Thr Ser Lys 290 295 <210> 3 <211> 2429 <212> DNA <213> Artificial Sequence <400> 3 ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaaac agctatgaca 60 tgattacgaa ttcgagctcg gtacccgggg atcctctaga agctgcaaca atcaaaggca 120 acataagctt cttttcacc gattaatctc cttcgaattg ttcagaccat aaagctaccg 180 gtcacactcg ttctttgcag atggtgccgt cggaaaacat gaaatcgggc agtacgtcat 240 ctgggtcgag gatgaacacc tcaaagcctg cgtcgcggat gcgtttgagg cttctttga 300 tcatgcggat ggctacgggg tggaagctaa gtactcgggt gagatcaaga acaacttcgg 360 tgccttcaaa gttgtgttcc acgatggcgt ggaggaagct ttcgctggct gagaagttca 420 tggcgccctg catttggatg aaggtggtgt cgccgtcccg cgtaatggat cgtactgcgt 480 ggccggatac ctgctcggtg gacataaggt ggaggcccat gtcgtcggaa agctgtttga 540 atattttac gccgcgcacg ctgttgcctt tggggttcag gcgtggggaa aatgtggcga 600 tgcccagctg atagctgcca attattccgg gcttgtgacc cgctacccga taataggtc 660 ggctgaaaaa ttcgttgca atatcaacaa aaaggcctat cattgggagg tgtcgcacca 720 agtactttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa 780 acctacgaaa ggatttttta cccatggatg caaaacaaac gcggcagggc gtattactcg 840 ctcttgccgc ttattttat tggggtatag cgccagcgta cttcaagttg atttactacg 900 tgcccgccga tgaaatcctg acgcatcgcg tgatctggtc gtttttcttt atggtggtgc 960 tgatgagcat ttgccgccag tggtcctatt taaaaacgct gattcagacg ccacagaaaa 1020 tttttatgct ggcagtctct gccgtgctga ttggtggcaa ctggctactg tttatctggg 1080 cggtgaacaa tcacdatag ctggaagcga gccttggtta ctttattaac ccgctggtga 1140 acattgtgct ggggatgatt ttcctcggcg agcgattccg ccggatgcaa tggctggcgg 1200 tgattctggc gatatgtggc gtgttagtcc agctgtggac ttttggttcg ctacctatta 1260 tcgcgctggg actggcattt agttttgcct tctacggtct ggtacgcaag aagattgccg 1320 ttgaagcgca aaccggcatg ttaatcgaaa ccatgtggct gctgcccgtg gcggcaattt 1380 acctgtttgc tattgccgac agctcaacca gcdataggg gcaaaacccg atgtcgctga 1440 atttactgct gatcgccgcc ggtattgtca ctaccgtacc gctgttgtgt tttaccgccg 1500 ctgccacgcg cttgcgtctc tcaacgttag gctttttcca gtacattggc ccgacgctga 1560 tgttcctgct ggctgtgacg ttttatggtg aaaaaccggg tgccgataag atggtgactt 1620 tcgcctttat ttgggtggcg ctggcaattt ttgtgatgga tgcgatttat acgcagcgta 1680 gaacgtccaa ataacctggc agaatgccga tgagtccgcc ggcgactcct gatttcgcgg 1740 ggatgcctac ggtggagagc cactgccctg cctcgtcgta catgcctgct gaagccatga 1800 cggagagggt gaggcggcag acgcgggcgt cgagaagctt cttgccggta attgggtgcg 1860 tgccgccggc ggcgagcgtg gcggtcatga ctgcgaggtc gcgcgtggtt actttgatgg 1920 cacattgcag cgtgtagctg aggacggcgt cgtgggcttc gtcttcgatg acgccatagt 1980 tgcgcagcat gtgggcgatg gagaggttgc ggtcggcgcc ggcgagttcg gattcaaagc 2040 cgcattcttg gagtgcgagt gcgtaggcaa agggcttgga aatactttgc atggtgaatt 2100 cgatgtcgtc atcgcctgcg ctgtagatgt gtccgttaac ggtgcacagg gctactgcca 2160 gcgggtttgg gtcggcagat tttagttccg ggatgtaatc ggccaagtcg acctgcaggc 2220 atgcaagctt ggcactggcc gtcgttttac aacgtcgtga ctgggaaac cctggcgtta 2280 cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg 2340 cccgcaccga tcgcccttcc caacagttgc gcagcctga tggcgaatgg cgataagcta gcttcacgct gccgcaagca ctcagggcg <210> 4 <211> 891 <212> DNA <213> Artificial Sequence <400> 4 atggatgcaa aacaaacgcg gcagggcgta ttactcgctc ttgccgctta ttttatttgg ggtatagcgc cagcgtactt caagttgatt tactacgtgc ccgccgatga aatcctgacg catcgcgtga tctggtcgtt tttctttatg gtggtgctga tgagcatttg ccgccagtgg tcctatttaa aaacgctgat tcagacgcca cagaaaattt ttatgctggc agtctctgcc gtgctgattg gtggcaactg gctactgttt atctgggcgg tgaacaatca ccatatgctg gaagcgagcc ttggttactt tattaacccg ctggtgaaca ttgtgctggg gatgattttc 360 ctcggcgagc gattccgccg gatgcaatgg ctggcggtga ttctggcgat atgtggcgtg 420 ttagtccagc tgtggacttt tggttcgcta cctattatcg cgctgggact ggcatttagt 480 tttgccttct acggtctggt acgcaagaag attgccgttg aagcgcaaac cggcatgtta 540 atcgaaacca tgtggctgct gcccgtggcg gcaatttacc tgtttgctat tgccgacagc 600 tcaaccagcc atatggggca aaacccgatg tcgctgaatt tactgctgat cgccgccggt 660 attgtcacta ccgtaccgct gttgtgtttt accgccgctg ccacgcgctt gcgtctctca 720 acgttaggct ttttccagta cattggcccg acgctgatgt tcctgctggc tgtgacgttt 780 tatggtgaaa aaccgggtgc cgataagatg gtgactttcg cctttatttg ggtggcgctg 840 gcaatttttg tgatggatgc gatttatacg cagcgtagaa cgtccaaata a 891 <210> 5 <211> 296 <212> PRT <213> Artificial Sequence <400> 5 Met Asp Ala Lys Gln Thr Arg Gln Gly Val Leu Leu Ala Leu Ala Ala 1 5 10 15 Tyr Phe Ile Trp Gly Ile Ala Pro Ala Tyr Phe Lys Leu Ile Tyr Tyr 20 25 30 Val Pro Ala Asp Glu Ile Leu Thr His Arg Val Ile Trp Ser Phe Phe 35 40 45 Phe Met Val Val Leu Met Ser Ile Cys Arg Gln Trp Ser Tyr Leu Lys 50 55 60 Thr Leu Ile Gln Thr Pro Gln Lys Ile Phe Met Leu Ala Val Ser Ala 65 70 75 80 Val Leu Ile Gly Gly Asn Trp Leu Leu Phe Ile Trp Ala Val Asn Asn 85 90 95 His His Met Leu Glu Ala Ser Leu Gly Tyr Phe Ile Asn Pro Leu Val 100 105 110 Asn Ile Val Leu Gly Met Ile Phe Leu Gly Glu Arg Phe Arg Arg Met 115 120 125 Gln Trp Leu Ala Val Ile Leu Ala Ile Cys Gly Val Leu Val Gln Leu 130 135 140 Trp Thr Phe Gly Ser Leu Pro Ile Ile Ala Leu Gly Leu Ala Phe Ser 145 150 155 160 Phe Ala Phe Tyr Gly Leu Val Arg Lys Lys Ile Ala Val Glu Ala Gln 165 170 175 Thr Gly Met Leu Ile Glu Thr Met Trp Leu Leu Pro Val Ala Ala Ile 180 185 190 Tyr Leu Phe Ala Ile Ala Asp Ser Ser Thr Ser His Met Gly Gln Asn 195 200 205 Pro Met Ser Leu Asn Leu Leu Leu Ile Ala Ala Gly Ile Val Thr Thr 210 215 220 Val Pro Leu Leu Cys Phe Thr Ala Ala Ala Thr Arg Leu Arg Leu Ser 225 230 235 240 Thr Leu Gly Phe Phe Gln Tyr Ile Gly Pro Thr Leu Met Phe Leu Leu 245 250 255 Ala Val Thr Phe Tyr Gly Glu Lys Pro Gly Ala Asp Lys Met Val Thr 260 265 270 Phe Ala Phe Ile Trp Val Ala Leu Ala Ile Phe Val Met Asp Ala Ile 275 280 285 Tyr Thr Gln Arg Arg Thr Ser Lys 290 295 <210> 6 <211> 192 <212> DNA <213> Artificial Sequence <400> 6 tagctgccaa ttattccggg cttgtgaccc gctacccgat aaataggtcg gctgaaaaat 60 ttcgttgcaa tatcaacaaa aaggcctatc attgggaggt gtcgcaccaa gtacttttgc 120 gaagcgccat ctgacggatt ttcaaaagat gtatatgctc ggtgcggaaa cctacgaaag 180 gattttttac cc 192 <210> 7 <211> 43 <212> DNA <213> Artificial Sequence <400> 7 ggtacccggg gatcctctag aagctgcaac aatcaaaggc aac 43 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <400> 8 gcccggaata attggcagct atcagctggg catcgccaca t 41 <210> 9 <211> twenty one <212> DNA <213> Artificial Sequence <400> 9 tagctgccaa ttattccggg c 21 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <400> 10 cgtttgtttt gcatccatgg gtaaaaaatc ctttcgtag 39 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 atggatgcaa aacaaacg 18 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <400> 12 ttatttggac gttctacgct g 21 <210> 13 <211> 41 <212> DNA <213> Artificial Sequence <400> 13 cagcgtagaa cgtccaaata acctggcaga atgccgatga g 41 <210> 14 <211> 43 <212> DNA <213> Artificial Sequence <400> 14 tgccaagctt gcatgcctgc aggtcgactt ggccgattac atc 43 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <400> 15 atgggttggc cacttaatga ggt 23 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 ttgcggattt tctccgcagt 20 <210> 17 <211> 41 <212> DNA <213> Artificial Sequence <400> 17 ggtacccggg gatcctctag acaagttgatttactacgtg c 41 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <400> 18 ccacgagcag cagccacatg gtttcg 26 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <400> 19 ggctgctgct cgtggcggca atttac 26 <210> 20 <211> 44 <212> DNA <213> Artificial Sequence <400> 20 ttgcatgcct gcaggtcgac cgccgccggc ggcacgcacc caat 44 <210> twenty one <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty one cgaaaccatg tggctgctga t 21 <210> twenty two <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty two aaacgcggca gggcgtatta c 21 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three cgaccgcaac ctctccatcg 20 <210> twenty four <211> 26 <212> DNA <213> Artificial Sequence <400> twenty four ccactggcag cagccacatg gtttcg 26 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <400> 25 ggctgctgac cgtggcggca atttac 26 <210> 26 <211> twenty two <212> DNA <213> Artificial Sequence <400> 26 atcgaaacca tgtggctgct ca 22 <210> 27 <211> twenty three <212> DNA <213> Artificial Sequence <400> 27 ctcgtatgtt gtgtggaatt gtg 23 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 cgccctgagt gcttgcggca 20

Claims

1. A RarD protein mutant, characterized in that, The amino acid sequence of the RarD protein mutant is shown in SEQ ID NO.1 or 2.

2. A nucleic acid molecule encoding the RarD protein mutant of claim 1.

3. A biomaterial containing the nucleic acid molecule of claim 2, characterized in that, The biomaterial is an expression cassette, vector, or host cell.

4. The application of the RarD protein mutant of claim 1 or the nucleic acid molecule of claim 2 in enhancing the L-glutamine transport capacity of microorganisms.

5. The application according to claim 4, characterized in that, The microorganisms are Corynebacterium, Escherichia, or Bacillus.

6. The use of the RarD protein mutant of claim 1 or the nucleic acid molecule of claim 2 in increasing the yield or conversion rate of L-glutamine in microorganisms or in constructing microorganisms for producing L-glutamine.

7. The application according to claim 6, characterized in that, The microorganisms are Corynebacterium, Escherichia, or Bacillus.

8. A recombinant microorganism, characterized in that, The recombinant microorganism expresses the RarD protein mutant of claim 1.

9. The recombinant microorganism according to claim 8, characterized in that, The recombinant microorganisms are Corynebacterium, Escherichia, or Bacillus.

10. The recombinant microorganism according to claim 8 or 9, characterized in that, The recombinant microorganism is a glutamate rod-shaped bacterium that has inserted a nucleic acid molecule encoding the RarD protein mutant into its chromosome.

11. The use of the recombinant microorganism according to any one of claims 8 to 10 in the production of L-glutamine or in increasing the yield or conversion rate of L-glutamine.

12. A method for producing L-glutamine by fermentation, characterized in that, The method includes: culturing the recombinant microorganism according to any one of claims 8 to 10 to obtain a culture; and collecting L-glutamine from the culture.

Images