Inhibitors of the plpro protein and methods of making and using the same

Abstract

The application discloses a PLPro protease inhibitor and a preparation method and application thereof, which can be used as a PLpro inhibitor in combination with one or more pharmaceutically acceptable adjuvants or with one or more other active ingredients for treating diseases or conditions caused by or associated with viral infection. The adjuvant can be a carrier, a diluent, a binder, a lubricant, a wetting agent, etc. The protease inhibitor has high inhibitory activity and can be used for broad-spectrum antiviral, especially for coronaviruses, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, etc., especially for SARS-CoV, MERS-CoV and SARS-CoV-2.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, and in particular to a PLPro protein inhibitor, its preparation method, and its application. Background Technology

[0002] PLpro is one of the two key proteases that cleave the polyproteins pp1a and pp1ab expressed through host cell translation (PLpro is responsible for cleaving nsp1, nsp2, and nsp3). It can highly actively cleave Lys48-linked polyubiquitin and the modification of the interferon-stimulated gene 15 (ISG15) linked to ubiquitin to achieve immune evasion. Inhibition of PLpro can reduce viral load and restore the host's innate immune system. Due to its multiple roles in viral replication and host cell control, PLpro is considered a potential antiviral target. Summary of the Invention

[0003] This invention provides a compound or a pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate, or deuterated compound thereof, said compound having the following structure:

[0004]

[0005] in,

[0006] Ar 1 For substituted naphthyl groups or substituted or unsubstituted non-naphthalene aromatic groups;

[0007] Ar 2 It is aryl or heteroaryl;

[0008] B is selected from: heterocyclic groups, -S(O) t NR 15 Halogens, -NH2;

[0009] W1 is selected from:

[0010] W2 is selected from: C, N, O. When W2 is N, R1' does not exist. When W2 is O, R1 and R1' do not exist.

[0011] W4 does not exist or is selected from: C or S; when W4 does not exist, R1 and R2 do not exist.

[0012] R1, R1', R2, and R2' are independently selected from: H, D, (=O), -C1-C6 alkyl, -X, -CH2X, -CHX2, -CX3, -OH, -NH2, -COOH, and -OC1-C6 alkyl;

[0013] R2 is selected from: H, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR21 -(C1-C6 alkylene)-OR 21 -(C1-C6 alkylene)-CONR 21 R 22 ;

[0014] R3 is selected from: H or C1-C6 alkyl groups;

[0015] L1 is absent or selected from: C1-C6 alkylene groups, -CO-, -SO2-, Or -N(R3)-;

[0016] L3 and L5 are absent or independently selected from: alkylene, heteroalkylene, cycloalkylene, heterocyclic, carbonyl, which may be optionally substituted;

[0017] L4 is selected from: -NR 15 C(O)-、-NR 15 S(O) t -、-C(O)-、-C(O)O-、-NR 15 -、-C(O)NR 15 -、-S(O) t NR 15 -、

[0018]

[0019] L6 is absent or selected from: C1-C6 alkylene groups, -SO2-, -NR 15 C(O)-、-NR 15 S(O) t -、-C(O)-、-C(O)O-、-NR 15 -、-C(O)NR 15 -、-S(O) t NR 15 -、

[0020] R 15 Selected from: H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, hydroxyl, alkoxy; or, R 15 The nitrogen atom to which it is attached forms a heterocyclic group together with L3 or L5, which may be optionally substituted;

[0021] t is 1 or 2;

[0022] R 21 It is H or C1-C6 alkyl;

[0023] R 22 It is H or C1-C6 alkyl;

[0024] R23 Or R 23’ Selected from H or C1-C6 alkyl groups;

[0025] X is selected from F, Cl, Br, and I.

[0026] In an embodiment of the present invention, L6 can be...

[0027] In an embodiment of the present invention, L6 can be...

[0028] Preferably, the substituted naphthyl group is selected from:

[0029] Among them, R 41 R 42 R 43 R 44 R 45 R 46 R 47 Represents a ring substituent, which is independently selected from: H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si (C1-C6 alkyl), -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced, and R 41 R 42 R 43 R 44 R 45 R 46 R 47 Not both H;

[0030] t is 1 or 2;

[0031] R L Not present or selected from: C1-C6 alkylene, C3-C6 heteroalkylene, C3-C6 cycloalkylene, C3-C6 heterocyclic, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t NR4-, which may be optionally replaced;

[0032] R' and R" are independently selected from: H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, which may optionally be substituted;

[0033] R4 is selected from: H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, hydroxyl, alkoxy;

[0034] More preferably, R L It does not exist or is selected from -CH2-, -CH2CH2-, -CH(CH3)CH2-;

[0035] More preferably, R' and R” are selected from H, -CH3, -CH2CH3, and -CH(CH3)CH3;

[0036] More preferably, R4 is selected from H, -CH3, -CH2CH3, and -CH(CH3)CH3;

[0037] More preferably, R 41 R 42 R 43 R 44 R 45 R 46 R 47 Independently selected from: H, D, -CH3, -X, -CH2F, -CHF2, -CF3, -OH, -CN, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl), and R 41 R 42 R43 R 44 R 45 R 46 R 47 They are not both H.

[0038] More preferably, the substituted naphthyl group is selected from:

[0039] More preferably, the R 42 R 43 R 45 R 46 The independent selections are: H, -F, -D, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -N(CH3)2, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0040] Preferably, the non-naphthalene aromatic group is selected from: phenyl, substituted phenyl, ...

[0041] Wherein, L2 is absent or selected from: -O-, C1-C6 alkyl (including methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), -CO-, -CONR 53 -、-NR 53 -、-NR 53 CO-, -(C1-C6 alkylene)-O-, -(C1-C6 alkylene)-CO-, -(C1-C6 alkylene)-CONR 53 -、-(C1-C6 alkylene)-NR 53 -、-(C1-C6 alkylene)-NR 53 CO-;

[0042] R 53 Selected from H, D, or C1-C6 alkyl groups;

[0043] R 51 Selected from: H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si(C1-C6 alkyl), -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L-OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0044] t is 1 or 2;

[0045] R L Not present or selected from: C1-C6 alkylene, C3-C6 heteroalkylene, C3-C6 cycloalkylene, C3-C6 heterocyclic, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t NR4-, which may be optionally replaced;

[0046] R' and R" are independently selected from: H, D, amino, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, which may optionally be substituted;

[0047] Preferred, R 51 Selected from: H, -D, -CH3, -X, -CF3, -OH, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl);

[0048] Ar 3 Selected from substituted or unsubstituted phenyl groups, substituted or unsubstituted oxygen-containing five- or six-membered heterocyclic groups, substituted or unsubstituted nitrogen-containing five- or six-membered heterocyclic groups, and substituted or unsubstituted sulfur-containing five- or six-membered heterocyclic groups;

[0049] Preferred, Ar 3 Selected from phenyl, C1-C6 alkyl-substituted phenyl, furanyl, pyrrolyl, thiophenyl, pyridyl, pyrimidinyl, thiazolyl, imidazoleyl, and oxazolyl, which may optionally be substituted; more preferably, Ar 3 Selected from phenyl, tert-butylphenyl, thiophene, and pyridinyl, which may optionally be substituted;

[0050] W3 is selected from N or CH;

[0051] R6 is selected from H, D, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61 -(C1-C6 alkylene)-OR 61 -(C1-C6 alkylene)-CONR 61 ;

[0052] R 61 It is H, D or C1-C6 alkyl;

[0053] Preferably, W3 is N; R6 is H, D, CH3, -CH2COOH, -CH2COOCH3;

[0054] R 62 Selected from: H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si(C1-C6 alkyl), -N3, -B(OH)2, -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0055] T1, T2, T3, T4, T5, T6, and T7 are independently selected from O, C-R7. Or N;

[0056] X' represents N, O, or S;

[0057] In some embodiments of the present invention, when there is a single bond between T4 and T5, T4 and T5 together form -CONR8-;

[0058] T6 and T7 are independently selected from C-R7 or N;

[0059] In some embodiments of the present invention, when there is a single bond between T6 and T7, T6 and T7 together form -CONR8-;

[0060] When T1-T7 are selected from C-R7, each R7 can be independently selected from: H, O, -D, -CH3, -X, -CF3, -OH, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl), -O(C1-C6 alkyl)NH(C1-C6 alkyl).

[0061] R8 is selected from: H, D, C1-C6 alkyl, -(C1-C6 alkylene)-COOR 61 -(C1-C6 alkylene)-OR 61 -(C1-C6 alkylene)-CONR 61 ;

[0062] S3 is selected from: O, S, NR 91 CR 92 R 93 ;

[0063] S1, S2, S4, S5, S6, and S7 are independently selected from: N and CR 94 ;

[0064] Where R 92 R 93 R 94 Independently selected from: linking bonds, H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si (C1-C6 alkyl), -NO2-R L -COR'、-RL -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N=CR'R”、 It can be arbitrarily replaced;

[0065] Preferred, R 92 R 93 R 94 Independently selected from linking bonds, H, D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl).

[0066] R 91 Selected from linking bonds, H, -D, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61 -(C1-C6 alkylene)-OR 61 -(C1-C6 alkylene)-CONR 61 ,

[0067] Y1, Y2, Y3, Y4, Y5, Y6, and Y7 are independently selected from N or CR. 11 ;

[0068] R 11Selected from linking bonds, H, D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si (C1-C6 alkyl), -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0069] Preferred, R 11 Independently selected from the following: linking bond, H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl)(C1-C6 alkyl);

[0070] R 72 R 73Independently selected from: H, -D, -CH3, -X, -CF3, -OH, -OCH3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -N3, -B(OH)2, -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl);

[0071] R 31 For N or CR 36 ;R 32 For NR 37 Or -N = CR 38 -

[0072] R 35 Or R 37 Independently selected from H, -D, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61 -(C1-C6 alkylene)-OR 61 -(C1-C6 alkylene)-CONR 61 ;

[0073] R 33 R 34 R 36 R 38 Independently selected from: H, -D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si(C1-C6 alkyl)3, -N3, -B(OH)2, -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-RL -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0074] Preferred, R 33 R 34 R 36 R 38 Independently selected from: H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl)(C1-C6 alkyl);

[0075] R 24 Not found or selected from: CR 23 NR 27 ;

[0076] R 25 Selected from: CR 28 NR 29 ;

[0077] R 23 R 26 R 28 Independently selected from: H, -D, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -Si(C1-C6 alkyl)3, -N3, -B(OH)2, -NO2-R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O)t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0078] Preferred, R 23 R 26 R 28 Independently selected from H, -D, -CH3, -F, -CF3, -OH, -OCH3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NO2, -COO(C1-C6 alkyl), -COOH, -CN, -Si(CH3)3, -NHSO2(C1-C6 alkyl), -SO2NH2, -SO2(C1-C6 alkyl), -N(C1-C6 alkyl)SO2(C1-C6 alkyl), -SO2NH(C1-C6 alkyl), -SO2N(C1-C6 alkyl)(C1-C6 alkyl);

[0079] R 27 R 29 Independently selected from H, C1-C6 alkyl, -OH, -(C1-C6 alkylene)-COOR 61 -(C1-C6 alkylene)-OR 61 -(C1-C6 alkylene)-CONR 61 .

[0080] More preferably, the non-naphthalene aromatic group is

[0081] More preferably, the non-naphthalene aromatic group is

[0082] More preferably, R 51 R 52 The independent selections are H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0083] More preferably, the non-naphthalene aromatic group is More preferably, the non-naphthalene aromatic group is

[0084] More preferably, R 61 R 62The independent selections are H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, and -SO2NH2.

[0085] More preferably, the non-naphthalene aromatic group is...

[0086]

[0087]

[0088] More preferably, R7, R7', R7”, R7”', R 7α R 7β The morpholine ring is independently selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2, substituted or unsubstituted morpholine rings, with unsubstituted morpholine rings being particularly preferred.

[0089] More preferably, R8' is selected from H or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0090] More preferably, the non-naphthalene aromatic group is

[0091]

[0092] More preferably, S1, S2, S4, S5, and S6 are CR 94 .

[0093] More preferably, the R 94 Selected from H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0094] Preferably, the non-naphthalene aromatic group is

[0095] In an embodiment of the present invention, the non-naphthalene aromatic group is

[0096] Preferably, the non-naphthalene aromatic group is

[0097] More preferably, Y1, Y2, Y3, Y4, Y5, and Y6 are CR 11 .

[0098] More preferably, the R 11 Selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0099] More preferably, the non-naphthalene aromatic group is

[0100] More preferably, the R 72 R 73 Selected from H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0101] More preferably, the non-naphthalene aromatic group is

[0102] More preferably, the R 33 Selected from: H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0103] More preferably, the R 34 R 35 R 37 Selected from: H, D or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0104] Preferably, the non-naphthalene aromatic group is

[0105] More preferably, the R 27 R 29 Independently selected from: H, D or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.

[0106] More preferably, the R 26 R 28 The independent selections are: H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -COOH, -CN, -COOCH3, -NH2, -NHCH3, -NO2, -OCH3, -OH, -TMS, -SO2CH3, -NHSO2CH3, -SO2NH2.

[0107] Preferably, W1 is C and W2 is C; or, W1 is C and W2 is N; or, W1 is C and W2 is O.

[0108] Preferably, R1 and R2 are independently selected from: H, (=O), C1-3 alkyl, -COOH, -CF3, hydroxyl; preferably, both R1 and R2 are H.

[0109] Preferred, for

[0110] Preferred, for

[0111] Preferred, Ar 2 It has the following structure:

[0112]

[0113] in,

[0114] n is 0 or 1;

[0115] T 11 -T 16 Independently selected from: C, N, O, S;

[0116] T 17 Represents one or more independent substituents on the ring, selected from: H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、-R L -CH=NR', -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L-NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0117] t is 1 or 2;

[0118] R L Selected from: single bond, alkylene, heteroalkylene, cycloalkylene, heterocyclic, -NR4C(O)-, -NR4S(O) t -, -C(O)-, -C(O)O-, -NR4-, -C(O)NR4-, -S(O) t NR4-, which may be optionally replaced;

[0119] R4 is selected from: H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, hydroxyl, alkoxy;

[0120] R' and R" are independently selected from: H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, which may optionally be substituted.

[0121] In some embodiments of the present invention, Ar 2 for

[0122] In a specific embodiment of the present invention, the compound has the following structure:

[0123]

[0124] In a specific embodiment of the present invention, the compound has the following structure:

[0125]

[0126] L6 is absent or selected from: single bond, -NH-, -N(CH3)-, -N(CH3)C(O)-, -NHC(O)-. Preferably, B has the following structures: -F, -Cl, -Br, -I, -NH2, -S(O). t NR 15 ,

[0127]

[0128]

[0129] t is 1 or 2;

[0130] Among them, Z2-Z6 are independently selected from: C, N, O, and S;

[0131] Z1 is selected from: C, N;

[0132] Z7 is absent or selected from: linking bonds, C, N, O, S, C1-C6 alkylene groups;

[0133] m1-m4 are independently selected from integers from 0 to 5;

[0134] R 12 Represents one or more independent substituents on the ring, selected from: H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、 -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0135] R”' is selected from: H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen.

[0136] R 13 and R 13 Each element is independently selected from: H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -N3, -B(OH)2, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、 -R L -CN、-R L -OR'、-RL -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”, ​​-R L -N(S(O) t R')(S(O) t R”), -NR'-R L -NR”R”'、-R L -NO2, -R L -N=CR'R”, -R L -R'R" can be arbitrarily replaced;

[0137] R 14 and R 14 Each 'represents one or more independent substituents on the ring, selected from: H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、 -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”、-NR'-R L -NR'R”, -R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0138] More preferably, B has the following structures: -F, -Cl, -Br, -I, -NH2, -S(O) t NR 15 ,

[0139] Among them, Z1 and Z4 are independently selected from: C, N, O, S, and R9 does not exist when Z4 is O or S;

[0140] t is 1 or 2;

[0141] Z7 is absent or selected from: single bond, C, N, O, S, C1-C3 alkylene groups;

[0142] m1 and m2 are independently selected from integers from 0 to 5;

[0143] When Z4 is S, R 13 Does not exist or R 13 For carbonyl, R 14 It is a carbonyl group;

[0144] R”' is selected from: H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen.

[0145] R 83 R 84 Selected from: H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、 -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”, ​​-R L -N(S(O) t R')(S(O) t R”), -NR'-R L -NR”R”'、-R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced;

[0146] Or, R 83 R 84 Together with the N atoms, they form

[0147] Z9 is selected from S and NR. 85 O;

[0148] m5 is selected from 1, 2, or 3;

[0149] R 85 Selected from H, (=O), D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclic, heterocyclic alkyl, halogen, -R L -COR'、-R L -C(O)OR'、-R L -C(O)NR'R”、 -R L -CN、-R L -OR'、-R L -OC(O)R'、-R L -S(O) t -NR'R”, -R L -S(O) t -R'、-R L -NR'R”, -R L -NR'C(O)R”、-R L -NR'S(O) t R”, ​​-R L -N(S(O) t R')(S(O) t R”), -NR'-R L -NR”R”'、-R L -NO2, -R L -N = CR'R", which can be arbitrarily replaced.

[0150] Preferably, B has the following structures: -F, -Cl, -Br, -I, -NH2, -S(O) t NR 15 ,

[0151]

[0152]

[0153] t is 1 or 2;

[0154] In some embodiments of the present invention, B is

[0155] In some embodiments of the present invention, the B is selected from: -F, -Cl, -Br, -I, -NH2.

[0156] In some embodiments of the present invention, B is

[0157] More preferably, R 14 and R 14 Each is independently H or C1-C6 alkyl, D, amino,

[0158] More preferably, R 13 and R 13 Each of the following is independently selected from the following structures: -H, -D, (=O), F, Cl, Br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF3, -CH2D, -OH, -N3, -B(OH)2.

[0159]

[0160] The present invention also provides the following specific compounds:

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175] The present invention also provides a pharmaceutical composition comprising the above-mentioned compound or a pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, and one or more pharmaceutically acceptable excipients.

[0176] The pharmaceutical composition may also include one or more other active ingredients used in combination.

[0177] For example, the excipients may be carriers, diluents, adhesives, lubricants, wetting agents, etc.

[0178] The compounds of the present invention can be formulated into pharmaceutical compositions in the following forms: syrups, elixirs, suspensions, powders, granules, tablets, capsules, lozenges, solutions, creams, ointments, lotions, gels, emulsions, etc.

[0179] Pharmaceutical formulations are preferably unit dosage forms. In this form, the formulation is further divided into unit doses containing appropriate amounts of the active ingredient. Unit dosage forms can be packaged formulations containing discrete amounts of the formulation, such as tablets, capsules, and powders packaged in vials or ampoules. The amount of active ingredient in a unit dose formulation can be varied or adjusted from 0.001 mg to 1000 mg, depending on the specific application and potency of the active ingredient.

[0180] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates and deuterated compounds, and the above-mentioned pharmaceutical compositions as PLpro inhibitors, for example as antiviral drugs.

[0181] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates and deuterated compounds, and the above-mentioned pharmaceutical compositions in medicaments for reducing and / or inhibiting coronavirus replication.

[0182] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates and deuterated compounds, and the above-mentioned pharmaceutical compositions in the preparation of medicaments for reducing and / or inhibiting coronavirus replication.

[0183] The present invention also provides the use of the above-mentioned compounds and their pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates and deuterated compounds, and the above-mentioned pharmaceutical compositions in the preparation of medicaments for the prevention and / or treatment of diseases or conditions caused by or related to viral infections.

[0184] Specifically, in the above applications, the compounds and pharmaceutical compositions have the corresponding definitions of the present invention.

[0185] In one embodiment of the present invention, the virus is a coronavirus, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, etc., especially SARS-CoV, MERS-CoV, and SARS-CoV-2.

[0186] Specifically, the aforementioned diseases or conditions are those caused by or related to coronavirus infection, such as COVID-19, SARS, MERS, etc.

[0187] The present invention also provides a method for preventing and / or treating diseases or conditions caused by or related to viral infection, comprising the step of administering to a subject an effective amount of the above-described compound of the present invention or a pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate, or deuterated compound of the present invention, or the above-described pharmaceutical composition of the present invention.

[0188] Specifically, in the above methods, the compounds, pharmaceutical compositions, diseases, or symptoms have the corresponding definitions of the present invention.

[0189] In particular, the aforementioned diseases or conditions are caused by or related to coronavirus infection, such as COVID-19, SARS, MERS, etc.

[0190] Specifically, the subjects mentioned above are animals; in one embodiment of the present invention, the subjects are mammals, such as humans, monkeys, cats, dogs, rats, bats, etc.; in another embodiment of the present invention, the subjects are birds. Attached Figure Description

[0191] Figure 1 The figure shows the inhibition rate curve of compound C21.

[0192] Figure 2 The figure shows the inhibition rate curve of compound C14.

[0193] Figure 3 The figure shows the inhibition rate curve of compound C24.

[0194] Figure 4 The figure shows the inhibition rate curve of compound C16.

[0195] Figure 5 The figure shows the inhibition rate curve of compound C17.

[0196] Figure 6 The figure shows the inhibition rate curve of compound C18.

[0197] Figure 7 The figure shows the inhibition rate curve of compound C26.

[0198] Figure 8 The figure shows the inhibition rate curve of compound C75.

[0199] Figure 9 The figure shows the inhibition rate curve of compound C76. Detailed Implementation

[0200] Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.

[0201] The term "alkyl" refers to a straight-chain or branched hydrocarbon radical that does not contain unsaturated bonds and is connected to the rest of the molecule by single bonds. Typical alkyl groups contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, etc. If the alkyl group is replaced by a cycloalkyl group, the corresponding radical is a "cycloalkylalkyl" radical, such as cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, etc. If the alkyl group is replaced by an aryl group, the corresponding radical is an "aralkyl" radical, such as benzyl, diphenylmethyl, or phenethyl. If the alkyl group is replaced by a heterocyclic group, the corresponding radical is a "heterocyclicalkyl" radical. "Alkylene" usually refers to an alkyl group with two free valence bonds. Typical alkylene groups contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as methylene, ethylene, propylene, butylene, etc.

[0202] The term "alkoxy" refers to a substituent formed when a hydrogen atom in a hydroxyl group is replaced by an alkyl group. Typical alkoxy groups contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as methoxy, ethoxy, propoxy, butoxy, etc.

[0203] The term "cycloalkyl" refers to a saturated or partially saturated (especially saturated) monocyclic or polycyclic group that may contain 1 to 4 monocyclic and / or fused rings and 3 to 18 carbon atoms, preferably 3 to 10 (e.g., 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or adamantyl.

[0204] The term "aryl" refers to a monocyclic or polycyclic free radical, including polycyclic free radicals containing a monoaryl group and / or a fused aryl group, such as those containing 1-3 monocyclic or fused rings and 6-18 (e.g., 6, 8, 10, 12, 14, 16, 18) carbon ring atoms. Typical aryl groups are those containing 6-12 carbon ring atoms, such as phenyl, naphthyl, biphenyl, and indenyl. "Arylidene" refers to a divalent group derived from aromatic hydrocarbons by removing two hydrogen atoms.

[0205] The term "heterocyclic group" includes heteroaromatic and heterocyclic groups containing 1 to 3 monocyclic and / or fused rings and 3 to 18 ring atoms. Preferred heteroaromatic and heterocyclic groups contain 5 to 10 ring atoms. Suitable heteroaryl groups in the compounds of the present invention contain 1, 2, or 3 heteroatoms selected from N, O, or S atoms. Examples of heteroaryl groups, such as, but not limited to, coumarins, including 8-coumarins; quinolinyl groups, including 8-quinolinyl, isoquinolinyl, pyridyl, pyrazinyl, pyrazolyl, pyrimidinyl, furanyl, pyrroloyl, thiopheneyl, thiazolyl, isothiazolyl, triazolyl, tetrazolyl, isoxazolyl, oxazolyl, imidazoleyl, indoleyl, isoindoleyl, indazoleyl, inazinyl, phthalazinyl, pteridinyl, purineyl, oxadiazolyl, thiadiazolyl, furazolidyl, pyridazinyl, triazinyl, cenolinyl, benzimidazolyl, benzofuranyl, benzofuranyl, benzothiopheneyl, benzothiazolyl, benzoxazolyl, quinazolinyl, naphridinyl, and furanopyridinyl, etc. Suitable heterocyclic groups in the compounds of the present invention contain one, two, or three heteroatoms selected from N, O, or S atoms. Examples of heterocyclic groups, such as, but not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuran, tetrahydrothiophenyl, tetrahydrothiophenyl, piperidinyl, morpholinyl, thiomorpholinyl, oxothiocyclohexyl, piperazine, aziridine, oxocyclobutyl, thiocyclobutyl, high-piperidinyl, oxocyclopropane, thiocyclopropane, acrylonitrile, oxoaziridine, diacylonitrile, triacylonitrile, 1,2,3,6-tetracyclyl Hydropyridyl, 2-pyrrolinyl, 3-pyrrolinyl, dihydroindolyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1,3-dioxapentyl, pyrazolinyl, dithiaalkyl, dithiopentyl, dihydropyranyl, dihydrothiophenyl, pyrazolinyl, imidazolinyl, imidazolinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, 3H-indolyl and quinazinyl, etc.

[0206] The above-mentioned groups can be replaced by one or more suitable groups at one or more available positions, such as: OR', =O, SR', SOR', SO2R', OSO2R', OSO3R', NO2, NHR', N(R')2, =N-R', N(R')COR', N(COR')2, N(R')SO2R', N(R')C(=NR')N(R')R', N3, CN, halogen, COR', COOR', OCOR', OCOOR', OCONHR', OCON(R')2, CONHR', CON(R')2, CON(R')OR', CON(R')SO2R', PO(OR')2, PO(OR')R', PO(OR')(N(R')R'), Cl-C 12 Alkyl, C3-C 10cycloalkyl, C2-C 12 alkenyl, C2-C 12 Alkynyl, aryl, and heterocyclic groups, wherein each R' group is independently selected from: hydrogen, OH, NO2, NH2, SH, CN, halogen, COH, COalkyl, COOH, C1-C 12 Alkyl, C3-C 10 cycloalkyl, C2-C 12 alkenyl, C2-C 12 Alkynyl, aryl, and heterocyclic groups. These groups are themselves substituted, and the substituents can be selected from the aforementioned list.

[0207] "Halogen" refers to bromine, chlorine, iodine, or fluorine. Haloalkyl refers to a group in which the hydrogen atom on the alkyl group is replaced by a halogen atom (F, Cl, Br, I), such as -CH2Rh, -CHRh2, -CRh3, where Rh is F, Cl, Br, or I; such as -CF3.

[0208] The term "pharmaceutically acceptable salt" refers to an acidic or basic salt that is theoretically non-toxic, non-irritating, and non-allergenic, and that can achieve or provide clinically acceptable pharmacokinetic, absorption, distribution, and metabolic properties of a drug molecule to achieve its intended purpose. The salts described in this invention include pharmaceutically acceptable acidic or basic salts of compounds with acidic, basic, or amphoteric groups. A list of suitable salts can be found in SM Birge, et al., J. Pharm. Sci., 66, 1-19 (1977).

[0209] The pharmaceutically acceptable salts described in this invention include acid addition salts and base addition salts.

[0210] The acid addition salts include, but are not limited to, salts from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, and phosphonic acid, as well as salts from organic acids such as aliphatic monocarboxylic acids and dicarboxylic acids, phenyl-substituted alkanic acids, hydroxyalkanic acids, alkanedioic acids, aromatic acids, and aliphatic and aromatic sulfonic acids. Therefore, these salts include, but are not limited to, sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, hydrochlorides, hydrobromates, iodates, acetates, propionates, octanoates, isobutyrates, oxalates, malonates, succinates, octanoates, sebacic acid salts, fumarates, maleates, amygdalinates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, maleates, tartrates, and methanesulfonates, as well as salts of amino acids such as arginine salts, gluconates, and galacturonic acids. Acid addition salts can be prepared by contacting a sufficient amount of the desired acid in a conventional manner to form a salt. The free base can be regenerated by contacting the salt with a base, and the free base can be separated in a conventional manner.

[0211] The base addition salts described in this invention refer to salts formed with metals or amines, such as hydroxides of alkali metals and alkaline earth metals, or with organic amines. Examples of metals used as cations include, but are not limited to, sodium, potassium, magnesium, and calcium. Suitable amines include, but are not limited to, N,N′-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine (ethane-1,2-diamine), N-methylglucosamine, and procaine. Base addition salts can be prepared by contacting a sufficient amount of the desired base in a conventional manner to form a salt. The free acid form can be regenerated by contacting the salt form with an acid, and the free acid can be separated in a conventional manner.

[0212] The term "solvent" should be understood to refer to any form of the compounds of the present invention, wherein the compounds are linked to another molecule (usually a polar solvent) by a non-covalent bond, particularly including hydrates and alcohols, such as methanols. Hydrates are preferred solvates.

[0213] The term "prodrug" is used in its broadest sense and encompasses derivatives that are convertible in vivo to the compounds of the present invention. Examples of prodrugs include, but are not limited to, derivatives and metabolites of the compounds, including biolyzable moieties such as biolyzable amides, biolyzable esters, biolyzable carbamates, biolyzable carbonates, biolyzable ureas, and biolyzable phosphate analogs. Preferably, prodrugs having a carboxyl functional group are lower alkyl esters of carboxylic acids. Such carboxylic acid esters are readily obtained by esterifying any carboxylic acid moiety present in the molecule. Prodrugs can generally be prepared by known methods, such as those described in Burger's "Medicinal Chemistry and Drug Discovery" 6th Edition (Donald J. Abraham ed., 2001, Wiley) and "Design and Applications of Prodrugs" (H. Bundgaard ed., 1985, Harwood Academic Publishers).

[0214] The term "absent" means that the linking group is a linking bond, such as In the structure, the absence of L6 represents Ar 2 Directly connected to B, and again, -R L R in -CH=NR' L Absent means that the group is only -CH=NR'.

[0215] Any compound referred to herein is intended to represent such a specific compound and certain of its variations or certain forms thereof. In particular, the compounds referred to herein may have asymmetric centers and thus exist in different enantiomeric or diastereomeric forms. Thus, any given compound referred to herein represents any one of the racemate, one or more enantiomeric forms, one or more diastereomeric forms, and mixtures thereof. Similarly, there may be stereoisomers or geometric isomers of double bonds, and thus in some cases, the molecule may exist as the (E)-isomer or the (Z)-isomer (trans and cis isomers). If the molecule contains multiple double bonds, then each double bond will have its own stereoisomerism, which may be the same as or different from the stereoisomerism of the other double bonds in the molecule. In addition, atropisomers may exist for the compounds referred to herein. All stereoisomers of the compounds referred to herein, including enantiomers, diastereoisomers, geometric isomers, and atropisomers, and mixtures thereof, are within the scope of the present invention.

[0216] Example 1:

[0217]

[0218] C1:1 1H NMR (600 MHz, DMSO-d6) δ 9.23 (s, 1H), 9.07 (s, 1H), 8.74 (dd, J = 9.4, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.78 (d, J = 7.0 Hz, 1H), 7.73 (dd, J = 10.3, 2.7 Hz, 1H), 7.54–7.46 (m, 2H), 6.99 (d, J = 8.4 Hz, 1H), 6.81 (dd, J = 8.4, 2.8 Hz, 1H), 6.56 (d, J = 2.7 Hz, 1H), 4.08 (s, 2H), 3.50 (d, J = 12.2 Hz, 2H), 2.99 (t, J = 10.3 Hz, 2H), 1.95 (dd, J = 8.8, 4.3 Hz, 2H), 1.89 (d, J = 10.1 Hz, 5H), 1.36 (d, J = 5.0 Hz, 2H), 1.19 (d, J = 5.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.03, 160.14 (d, J = 243.6 Hz), 147.99, 138.34 (d, J = 18.6 Hz), 134.86, 131.30, 129.40, 128.68 (d, J = 8.6 Hz), 128.34, 127.64 (d, J = 5.2 Hz), 126.84, 125.53, 116.17, 116.00, 115.80, 113.51, 111.77 (d, J = 20.0 Hz), 54.19, 51.08, 34.58, 25.82, 18.27, 14.59. MS (ESI, m / z): C27H28FN3O, [M+H]+ 430.229.

[0219] Example 2:

[0220]

[0221] C2: 11H NMR (600 MHz, DMSO-d6) δ 9.09–9.06 (m, 1H), 8.73 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.6 Hz, 1H), 7.67 (dt, J = 26.1, 7.3 Hz, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.4, 2.7 Hz, 1H), 6.65 (d, J = 3.0 Hz, 1H), 3.25 (dt, J = 8.6, 4.3 Hz, 4H), 3.16 (dd, J = 8.8, 4.6 Hz, 4H), 1.92 (s, 3H), 1.37 (d, J = 5.8 Hz, 2H), 1.19 (d, J = 5.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 169.93, 157.71 (d, J = 249.7 Hz), 148.11, 138.27, 134.47, 133.49, 131.44, 129.12 (d, J = 8.3 Hz), 127.36, 126.68 (d, J = 5.3 Hz), 125.84, 123.42 (d, J = 16.2 Hz), 120.85 (d, J = 5.4 Hz), 117.54, 115.14, 109.02 (d, J = 19.2 Hz), 46.17, 43.01, 34.14, 18.40, 14.58. MS (ESI, m / z): C25H26FN3O, [M+H]+ 404.212.

[0222] Example 3:

[0223]

[0224] C3: 11H NMR (600 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.79 (dd, J = 8.0, 5.6 Hz, 1H), 7.72–7.62 (m, 2H), 7.29 (dd, J = 10.6, 7.8 Hz, 1H), 6.96 (dd, J = 8.7, 2.7 Hz, 1H), 6.79–6.74 (m, 1H), 6.51 (d, J = 3.2 Hz, 1H), 3.84 (s, 2H), 3.40 (t, J = 10.2 Hz, 2H), 2.80 (d, J = 11.6 Hz, 2H), 1.89 (s, 3H), 1.79 (d, J = 14.5 Hz, 4H), 1.35 (t, J = 3.3 Hz, 2H), 1.17 (d, J = 5.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.17, 157.70 (d, J = 249.4 Hz), 148.49, 138.16, 134.49, 133.48, 131.22, 129.07 (d, J = 8.3 Hz), 127.33, 126.67, 125.84, 123.43 (d, J = 15.6 Hz), 120.85, 115.36, 113.12, 109.01 (d, J = 19.1 Hz), 54.13, 52.57, 34.14, 27.18, 18.26, 14.52. MS (ESI, m / z): C27H28FN3O, [M+H]+ 430.229.

[0225] Example 4:

[0226]

[0227] C4: 1 1H NMR (600 MHz, DMSO-d6) δ 9.46 (s, 1H), 9.01 (d, J = 2.7 Hz, 1H), 7.56 (dd, J = 12.5, 3.4 Hz, 2H), 7.52–7.47 (m, 2H), 7.35 (t, J = 7.7 Hz, 1H), 7.18–7.14 (m, 1H), 7.11 (dd, J = 8.6, 5.5 Hz, 2H), 6.90 (d, J = 6.0 Hz, 2H), 4.14 (s, 2H), 3.62 (d, J = 12.2 Hz, 2H), 3.15 (t, J = 10.6 Hz, 2H), 2.24 (s, 3H), 2.05–1.90 (m, 4H), 1.32 (s, 2H), 1.31–1.29 (m, 2H). 13C NMR(151MHz,DMSO-d6)δ170.34,148.14,144.99,137.92,133.87,131.56,129.50,128.96,126.09,125.89,124.06,123.9 2,123.19,122.63,115.99,113.68,54.17,51.10,34.59,25.90,18.84,18.79.MS(ESI,m / z):C27H29N3OS,[M+H]+444.209.

[0228] Example 5:

[0229]

[0230] C5: 1 H NMR(600MHz,DMSO-d6)δ11.09(d,J=15.0Hz,1H),9.02(s,1H),7.60–7.54(m,2H),7.52–7.47(m,2 H),7.35(t,J=7.7Hz,1H),7.16(t,J=4.4Hz,1H),7.11(t,J=8.7Hz,2H),6.91(d,J=6.3Hz,2H),4. 06(t,J=3.4Hz,2H),3.69(dd,J=12.7,2.7Hz,2H),3.32(dd,J=26.5,12.7Hz,2H),2.74(d,J=5.0H z,3H),2.24(s,3H),2.21(dd,J=8.9,4.4Hz,2H),1.98(t,J=6.7Hz,2H),1.32(s,2H),1.30(s,2H). 13 C NMR(151MHz,DMSO-d6)δ170.32,147.80,144.99,144.08,137.97,133.86,131.55,129.50,128.96,126.12,125.89,124.06,123.9 0,123.17,122.63,116.02,113.73,62.39,51.63,38.65,34.58,23.97,18.83,18.80.MS(ESI,m / z):C28H31N3OS,[M+H]+458.224.

[0231] Example 6:

[0232]

[0233] C6: 11H NMR (600 MHz, DMSO-d6) δ 9.41 (s, 1H), 9.03 (s, 1H), 7.57 (d, J = 5.1 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.52–7.48 (m, 2H), 7.36 (t, J = 7.7 Hz, 1H), 7.18–7.13 (m, 2H), 7.11 (d, J = 7.9 Hz, 1H), 7.00 (d, J = 7.5 Hz, 2H), 3.44–3.37 (m, 4H), 3.22 (p, J = 4.6 Hz, 4H), 2.26 (s, 3H), 1.36–1.30 (m, 4H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.20, 148.22, 144.98, 144.07, 137.94, 133.89, 131.71, 129.50, 128.96, 127.12, 126.12, 124.07, 123.94, 123.20, 122.59, 117.87, 115.37, 46.27, 42.97, 34.60, 18.95, 18.80. MS (ESI, m / z): C25H27N3OS, [M+H]+ 418.193.

[0234] Example 7:

[0235]

[0236] C7: 1 1H NMR (600 MHz, DMSO-d6) δ 9.34 (s, 1H), 8.92 (s, 1H), 7.34 (d, J = 2.3 Hz, 1H), 7.25–7.18 (m, 2H), 7.11 (d, J = 8.4 Hz, 1H), 6.96 (dd, J = 7.0, 2.2 Hz, 1H), 6.92–6.85 (m, 2H), 4.14 (s, 2H), 3.61 (dd, J = 12.7, 2.8 Hz, 2H), 3.10 (d, J = 12.0 Hz, 2H), 2.23 (s, 3H), 1.99 (dt, J = 12.5, 5.3 Hz, 2H), 1.97–1.90 (m, 2H), 1.28 (d, J = 1.9 Hz, 9H), 1.24 (dd, J = 5.8, 3.8 Hz, 4H). 13C NMR (151MHz, DMSO-d6) δ170.16,150.54,148.08,143.49,138.03,131.54,128.30,125.92,122.88,122.10,121. 67,115.97,113.71,54.22,51.13,34.72,31.67,25.88,18.78,18.72.MS(ESI,m / z):C27H25N3O,[M+H]+418.284.

[0237] Example 8:

[0238]

[0239] C8: 1 H NMR(600MHz,DMSO-d6)δ8.94–8.90(m,1H),7.34(d,J=1.8Hz,1H),7.23–7.20(m,2H),7 .11(d,J=8.2Hz,1H),6.96(dt,J=6.9,1.8Hz,1H),6.92–6.89(m,1H),6.87(d,J=2.7Hz, 1H),4.07(s,2H),3.68(d,J=12.2Hz,2H),3.34–3.24(m,2H),2.75(dt,J=8.1,3.6Hz,3 H),2.26–2.18(m,5H),1.97(t,J=6.9Hz,2H),1.28(d,J=1.2Hz,9H),1.22–1.29(m,4H). 13 C NMR(151MHz,DMSO-d6)δ170.14,150.53,147.71,143.48,138.08,131.53,128.30,125.93,122.89,122.11,121.68, 116.00,113.78,62.44,51.74,38.66,34.73,31.68,23.91,18.77,18.72.MS(ESI,m / z):C28H37N3O,[M+H]+432.299.

[0240] Example 9:

[0241]

[0242] C9: 11H NMR (600 MHz, DMSO-d6) δ 9.07 (s, 1H), 8.74 (dd, J = 9.3, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.79 (d, J = 7.1 Hz, 1H), 7.73 (dd, J = 10.2, 2.7 Hz, 1H), 7.54–7.46 (m, 2H), 6.98 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 Hz, 1H), 4.13 (s, 1H), 4.00 (t, J = 7.9 Hz, 2H), 3.83 (dd, J = 8.8, 5.4 Hz, 2H), 2.75 (s, 6H), 1.91 (s, 3H), 1.35 (q, J = 4.3 Hz, 2H), 1.19 (q, J = 4.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 169.93, 160.15 (d, J = 243.5 Hz), 148.98, 138.35 (d, J = 11.8 Hz), 134.85, 131.23, 129.41, 128.67 (d, J = 8.6 Hz), 128.40, 127.65 (d, J = 5.1 Hz), 126.85, 124.40, 116.12 (d, J = 24.7 Hz), 113.16, 111.77 (d, J = 19.7 Hz), 110.79, 55.57, 54.46, 34.52, 18.41, 14.65. MS (ESI, m / z): C26H28FN3O, [M+H]+ 418.228.

[0243] Example 10:

[0244]

[0245] C10: 11H NMR (600 MHz, DMSO-d6) δ 9.06 (s, 1H), 8.64 (dd, J = 13.2, 8.2 Hz, 1H), 8.02 (dd, J = 11.7, 8.5 Hz, 1H), 7.86 (d, J = 8.3 Hz, 1H), 7.82 (d, J = 7.1 Hz, 1H), 7.51 (t, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 3.82 (t, J = 7.0 Hz, 2H), 3.42 (d, J = 13.2 Hz, 2H), 3.13 (s, 1H), 2.08 (s, 6H), 1.91 (s, 3H), 1.36–1.30 (m, 2H), 1.18 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.15, 150.03, 138.63–136.56 (m), 131.18, 129.44 (d, J = 26.9 Hz), 127.62 (d, J = 4.6 Hz), 126.27, 123.19, 114.92 (d, J = 15.9 Hz), 112.77, 112.21 (d, J = 17.4 Hz), 110.39, 56.29, 41.94, 34.50, 18.33. MS (ESI, m / z): C26H27F2N3O, [M+H]+ 436.219.

[0246] Example 11:

[0247]

[0248] C11: 1 1H NMR (600 MHz, DMSO-d6) δ 9.08 (s, 1H), 8.77–8.72 (m, 1H), 8.26–8.20 (m, 1H), 7.80 (d, J = 7.6 Hz, 1H), 7.75–7.69 (m, 2H), 7.68 (d, J = 7.7 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 Hz, 1H), 4.15–4.09 (m, 1H), 4.00 (t, J = 8.0 Hz, 2H), 3.79 (td, J = 11.7, 10.3, 5.7 Hz, 3H), 2.76 (s, 6H), 1.91 (s, 3H), 1.40–1.33 (m, 2H), 1.21 (d, J = 5.4 Hz, 2H). 13C NMR(151MHz,DMSO-d6)δ170.01,148.98,138.22,137.85,133.46,131.25,130.50,129.38,127.57,127.26,126.34,125.98 ,124.72,124.43,113.22,110.82,55.73,54.52,34.27,25.97,18.43,14.67.MS(ESI,m / z):C26H28ClN3O,[M+H]+434.199.

[0249] Example 12:

[0250]

[0251] C12: 1 H NMR (600MHz, DMSO-d6) δ8.94(s,1H),8.63(d,J=8.5Hz,1H),8.18(d,J=8.3Hz,1H),7.73(d,J=7.9 Hz,1H),7.58(ddd,J=8.3,6.7,1.4Hz,1H),7.50(dd,J=8.3,6.8Hz,1H),6.91(d,J=8.1Hz,2H),6. 33(dd,J=8.2,2.5Hz,1H),6.11(d,J=2.6Hz,1H),3.97(s,3H),3.80(t,J=7.0Hz,2H),3.41(t,J=6 .5Hz,2H),3.18–3.10(m,1H),2.08(s,6H),1.91(s,3H),1.35–1.26(m,2H),1.12(d,J=5.4Hz,2H). 13 C NMR (151MHz, DMSO-d6) δ170.00,154.62,149.98,138.22,133.06,131.08,129.32,125.53,125.22,123.26,122.35,112. 63,110.47,103.71,56.68,56.27,56.00,46.02,41.92,34.12,18.44,14.62.MS(ESI,m / z):C27H31N3O2,[M+H]+430.249.

[0252] Example 13:

[0253]

[0254] C13: 11H NMR (600 MHz, DMSO-d6) δ 9.06 (s, 1H), 8.77–8.71 (m, 1H), 8.22–8.16 (m, 1H), 7.86 (d, J = 7.7 Hz, 1H), 7.73 (d, J = 7.7 Hz, 1H), 7.72–7.67 (m, 2H), 6.92 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.6 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (s, 2H), 3.15 (s, 1H), 2.25–2.02 (m, 6H), 1.89 (s, 3H), 1.38–1.34 (m, 2H), 1.19 (d, J = 5.7 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d6) δ 170.22, 149.98, 138.57, 137.94, 133.60, 131.72, 131.13, 129.80, 129.71, 127.80, 127.43, 127.21, 126.41, 123.24, 121.77, 112.75, 110.43, 56.65, 56.27, 41.91, 34.33, 18.41, 14.59. MS (ESI, m / z): C26H28BrN3O, [M+H]+ 478.149.

[0255] Example 14:

[0256]

[0257] C14:1H NMR(600MHz,DMSO-d6)δ8.98(s,1H),8.72–8.66(m,1H),8.06–8.00(m,1H),7.69(d,J=7.2H z,1H),7.61–7.53(m,2H),7.31(dd,J=7.2,1.1Hz,1H),6.91(d,J=8.2Hz,1H),6.34(dd,J=8. 2,2.6Hz,1H),6.11(d,J=2.6Hz,1H),3.80(t,J=7.0Hz,2H),3.42(t,J=6.6Hz,2H),3.15(s,1 H),2.64(s,3H),2.10(s,6H),1.91(s,3H),1.33(q,J=3.1Hz,2H),1.14(q,J=4.5Hz,2H).13C NMR (151MHz, DMSO-d6) δ170.03,149.96,138.14,136.33,133.91,132.87,132.33,131.09,128.56,126.16,125.79,125. 09,123.31,112.67,110.51,56.65,56.26,41.90,34.48,19.58,18.47,14.63.MS(ESI,m / z):C27H31N3O,[M+H]+414.254.

[0258] Figure 2 The figure shows the inhibition rate curve of compound C14.

[0259] Example 15:

[0260]

[0261] C15: 1H NMR(600 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.12 (d, J = 8.4 Hz, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.71–7.62 (m, 2H), 7.55–7.29 (m, 1H), 7.27 (d, J = 7.9 Hz, 1H), 6.92 (d, J = 8.1 Hz, 1H), 6.34 (dd, J = 8.4, 2.5 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.6 Hz, 2H), 3.11 (p, J = 6.3 Hz, 1H), 2.07 (s, 6H), 1.91 (s, 3H), 1.35 (s, 2H), 1.18–1.15 (m, 2H). 13C NMR(151 MHz, DMSO-d6) δ 170.18, 150.02, 146.55, 131.13, 128.76, 127.21, 126.73, 125.87, 121.98, 117.32 (t, J = 257.8 Hz), 112.65, 110.44, 56.75, 56.30, 41.98, 14.58. MS(ESI, m / z): C27H29F2N3O, [M + H]+ 466.230.

[0262] Example 16:

[0263]

[0264] C16: 1 1H NMR(400 MHz, DMSO-d6) δ 9.02 (s, 1H), 8.72 (d, J = 6.5 Hz, 1H), 8.07 (d, J = 6.5 Hz, 1H), 7.78 (s, 1H), 7.67 (t, J = 8.7 Hz, 2H), 7.28 (t, J = 8.5 Hz, 1H), 6.90 (d, J = 7.6 Hz, 1H), 6.34 (d, J = 7.2 Hz, 1H), 6.11 (s, 1H), 3.79 (s, 2H), 3.10 (s, 1H), 2.06 (s, 6H), 1.87 (s, 3H), 1.33 (s, 2H), 1.23 (s, 2H), 1.16 (s, 2H). 13 13C NMR(101 MHz, DMSO-d6) δ 169.69, 153.27 (d, J H-F = 245.2 Hz), 149.57, 137.55, 132.64 (d, J H-F=23.8Hz),130.65,129.11,128.66,128.57,125.41,126.87,126.21,125.40(d,J H-F =15.2Hz),122.73,112.24,109.94,56.30,55.84,41.53,33.64,17.93,14.08.MS(ESI,m / z):C 26 H 28 FN3O,[M+H]+418.221.

[0265] Figure 4 The figure shows the inhibition rate curve of compound C16.

[0266] Example 17:

[0267]

[0268] C17: 1 H NMR (400MHz, Methanol-d4) δ8.61(d,J=8.4Hz,1H),8.26(d,J=8.6Hz,1H),8.02(d,J=7.2Hz,1H),7.84–7.37(m,3H),7.01(d,J=7.9H z,1H),6.48(d,J=7.9Hz,1H),6.26(s,1H),4.07(d,J=8.4Hz,2H),3.81(s,2H),3.33(s,6H),2.82(s,3H),1.98(s,2H),1.48(s,2H). 13 C NMR(100MHz,Methanol-d4)δ168.39,147.15,134.48,133.47,133.09,132.97,132.49,132.11,130.49,127.97,126.87,125.47, 125.09,125.04,123.29,116.05,112.55,61.03,49.74,42.05,35.70,20.80,18.80.MS(ESI,m / z):C26H28ClN3O,[M+H]+434.191.

[0269] Figure 5 The figure shows the inhibition rate curve of compound C17.

[0270] Example 18:

[0271]

[0272] C18: 1H NMR (400MHz, Methanol-d4) δ8.42(d,J=8.5Hz,1H),8.02(dd,J=28.6,7.7Hz,2H),7.65–7.44(m,2H),7.23(t,J=9.1Hz,1H),6.97(d,J=8.1 Hz,1H),6.44(d,J=8.2Hz,1H),6.24(s,1H),3.96(t,J=7.3Hz,2H),3.70–3.41(m,3H),3.33(s,3H),2.45(s,6H),1.96(s,2H),1.46(s,2H). 13 C NMR(100MHz,Methanol-d4)δ168.39,161.79,159.27,147.15,134.48,134.38,13 4.35,132.97,132.11,132.03,130.49,126.98,126.90,125.47,125.44,123.77, 123.57,123.53,123.45,121.61,121.58,116.05,112.69,112.55,112.49,61.03 ,49.74,42.05,35.98,20.80,18.80.MS(ESI,m / z):C26H28FN3O,[M+H]+418.223.

[0273] Figure 6 The figure shows the inhibition rate curve of compound C18.

[0274] Example 19:

[0275]

[0276] C19: 1 H NMR(600MHz,DMSO-d6)δ8.88(s,1H),7.30(t,J=7.6Hz,2H),7.26–7.20(m,2H),7.18(t,J=7.5Hz,1H),7.06 (d,J=8.3Hz,1H),6.47(d,J=6.8Hz,2H),4.03(s,2H),3.79(s,2H),3.47(s,1H),2.20(s,3H),1.24(s,4H). 13C NMR(151MHz,DMSO-d6)δ170.20,143.96,137.91,131.41,128.85,128.50,126.83,126.01,125.11,124.57,1 13.17,110.89,55.97,54.13,52.84,34.63,19.58,18.92,18.67.MS(ESI,m / z):C22H27N3O,[M+H]+350.222.

[0277] Example 20:

[0278]

[0279] C20: 1 H NMR(600MHz,DMSO-d6)δ9.11(s,1H),8.32(d,J=8.0Hz,1H),7.96(d,J=8.0Hz,1H),7.67(s,1H), 7.43(t,J=7.5Hz,1H),7.38(d,J=7.7Hz,1H),7.00(d,J=8.2Hz,1H),6.43(dd,J=8.1,2.6Hz,1H) ,6.27(d,J=2.6Hz,1H),4.18(d,J=8.0Hz,1H),4.01(t,J=7.8Hz,2H),3.91(dd,J=8.6,5.6Hz,2H ),2.71(s,6H),2.51(d,J=4.5Hz,3H),1.98(s,3H),1.21(d,J=4.2Hz,2H),1.18(d,J=4.3Hz,2H). 13 C NMR(151MHz,DMSO-d6)δ169.94,148.98,140.23,138.79,138.20,137.75,131.24,125.73,124.69,124.48,124.31,123.5 0,123.41,113.14,110.90,55.19,54.27,40.52,40.08,30.79,18.55,14.13.MS(ESI,m / z):C24H27N3OS,[M+H]+406.194.

[0280] Example 21:

[0281]

[0282] C21: 1H NMR (600MHz, DMSO-d6) δ8.68(s,1H),7.40(dd,J=7.6,1.4Hz,1H),7.01(t,J=7.5Hz,1H),6.95(dd ,J=14.7,7.9Hz,2H),6.37(dd,J=8.2,2.5Hz,1H),6.20(d,J=2.5Hz,1H),3.87(t,J=7.1Hz,2H),3 .49(t,J=6.5Hz,2H),3.23(s,1H),2.97(t,J=6.2Hz,2H),2.74(t,J=6.2Hz,2H),2.15(s,6H),2.0 3(s,3H),1.75(ddt,J=18.6,11.3,3.7Hz,4H),1.12(q,J=4.7,4.2Hz,2H),1.01(t,J=3.5Hz,2H). 13 C NMR(151MHz,DMSO-d6)δ169.95,149.94,139.85,138.19,137.24,136.73,131.11,129.08,128.34,124.73,123.43,112.65 ,110.58,56.56,56.28,41.85,34.82,29.84,26.33,23.28,23.08,18.50,14.59.MS(ESI,m / z):C26H33N3O,[M+H]+404.269.

[0283] Figure 1 The figure shows the inhibition rate curve of compound C21.

[0284] Example 22:

[0285]

[0286] C22: 1 H NMR(600MHz,DMSO-d6)δ8.92(s,1H),7.70–7.64(m,2H),7.63–7.59(m,2H),7.50 –7.40(m,2H),7.35(td,J=7.3,1.3Hz,1H),7.34–7.30(m,2H),7.04(d,J=8.1Hz, 1H),6.47(d,J=2.5Hz,1H),6.43(dd,J=8.1,2.5Hz,1H),3.93(t,J=7.0Hz,2H),3 .54(t,J=6.4Hz,2H),3.20(s,1H),2.21(s,3H),2.13(s,6H),1.31–1.26(m,4H). 13C NMR(151MHz,DMSO-d6)δ170.41,150.16,143.40,140.42,137.88,137.74,131.37,129.44,129.38,127.66,126.93,126.8 1,125.70,123.65,112.91,110.64,56.79,56.36,41.99,34.50,18.95,18.77.MS(ESI,m / z):C28H31N3O,[M+H]+426.254.

[0287] Example 23:

[0288]

[0289] C23: 1 H NMR(400MHz,Chloroform-d)δ7.61–7.51(m,4H),7.47–7.29(m,6H),7.03(d,J=8.2Hz,1H),6.55–6.40(m,3H),3.96(t,J=6.9Hz,2H),3.70–3 .62(m,2H),3.28(q,J=6.3Hz,1H),3.10(q,J=7.4Hz,22H),2.32(s,3H),2.23(s,6H),1.39(s,4H).MS(ESI,m / z):C28H31N3O,[M+H]+426.254.

[0290] Example 24:

[0291]

[0292] C24: 1H NMR(600MHz,DMSO-d6)δ9.04(s,1H),8.00(d,J=2.2Hz,1H),7.46(d,J=8.1Hz,1H),7 .34(d,J=2.2Hz,1H),7.30(d,J=7.5Hz,1H),7.24(t,J=7.8Hz,1H),6.97(d,J=8.2Hz ,1H),6.39(dd,J=8.2,2.6Hz,1H),6.26(d,J=2.6Hz,1H),3.88(t,J=7.1Hz,2H),3.5 2(t,J=6.3Hz,2H),2.88(s,1H),2.17(s,6H),2.02(s,3H),1.23(q,J=2.5Hz,4H).13C NMR(151MHz,DMSO-d6)δ170.05,154.97,149.94,145.67,137.98,136.48,131.20,126.61,124.13,123.48,122.29,11 2.78,110.52,110.26,106.70,56.27,41.83,34.48,18.55,16.96,15.04.MS(ESI,m / z):C24H27N3O2,[M+H]+390.217.

[0293] Figure 3 The figure shows the inhibition rate curve of compound C24.

[0294] Example 25:

[0295]

[0296] C25: 11H NMR (600 MHz, DMSO-d6) δ 8.56 (s, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.19 (td, J = 7.2, 2.2 Hz, 1H), 7.15 - 7.09 (m, 2H), 6.91 (d, J = 8.2 Hz, 1H), 6.33 (dd, J = 8.2, 2.6 Hz, 1H), 6.26 (t, J = 4.6 Hz, 1H), 6.10 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.5 Hz, 2H), 3.17 (s, 1H), 2.65 (t, J = 8.0 Hz, 2H), 2.22 (td, J = 8.0, 4.6 Hz, 2H), 2.11 (s, 6H), 1.92 (s, 3H), 1.08 (q, J = 4.6 Hz, 2H), 0.95 (q, J = 4.7 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ 169.96, 149.94, 138.36, 136.76, 136.45, 134.00, 131.02, 128.08, 127.76, 126.86, 126.37, 124.66, 123.36, 112.55, 110.51, 56.70, 56.29, 43.52, 41.92, 34.25, 27.87, 22.96, 19.04, 18.28, 13.49. MS (ESI, m / z): C26H31N3O, [M+H]+ 402.254..

[0297] Example 26:

[0298]

[0299] C26:

[0300] 1H NMR (400MHz, DMSO) δ9.13(dt,J=8.7,1.7Hz,1H),9.05(s,1H),8.98(dd,J=4.2,1.6Hz,1H),7.85(d d,J=8.1,5.1Hz,1H),7.71(dd,J=8.7,4.1Hz,1H),7.54(dd,J=10.8,8.0Hz,1H),6.91(d,J=8.2Hz,1 H),6.34(dd,J=8.1,2.6Hz,1H),6.12(d,J=2.5Hz,1H),3.81(t,J=7.0Hz,2H),3.40(dd,J=7.4,5.7 Hz,2H),3.11(p,J=6.1Hz,1H),2.06(s,6H),1.86(s,3H),1.35(q,J=4.7Hz,2H),1.27–1.16(m,2H). 19 F NMR (376MHz, DMSO) δ-126.10.

[0301] MS(ESI,m / z)C25H27F4O[M+H]+419.217

[0302] Figure 7 The figure shows the inhibition rate curve of compound C26.

[0303] Example 27:

[0304]

[0305] C27: 1 H NMR (600MHz, DMSO) δ9.20(d,J=5.1Hz,1H),8.88(d,J=4.4Hz,1H),8.67(d,J=8.4Hz,1H),8.05(d, J=8.4Hz,1H),7.77(ddd,J=8.4,6.8,1.5Hz,1H),7.70(d,J=4.4Hz,1H),7.69–7.64(m,1H),6.95(d ,J=8.2Hz,1H),6.39(dd,J=8.2,2.6Hz,1H),6.18(d,J=2.6Hz,1H),3.91(d,J=7.0Hz,2H),3.66(s, 2H),3.07(dp,J=7.7,4.0Hz,1H),2.42(s,6H),1.88(s,3H),1.42–1.32(m,2H),1.28–1.23(m,2H). 13C NMR (151MHz, DMSO) δ170.31,150.66,149.45,148.73,146.85,137.83,131.20,130.11,129.37,127.44,126.63,125.90,123.87,1 23.01,113.04,110.63,55.72,55.39,45.95,40.96,40.53,33.94,18.38,14.07,8.98.MS(ESI,m / z):C25H28N4O,[M+H]+401.234.

[0306] Example 28:

[0307]

[0308] C28: 1 H NMR (600MHz, DMSO) δ9.20(d,J=7.8Hz,1H),8.88(d,J=4.4Hz,1H),8.66(d,J=8.4Hz,1H),8. 06(d,J=8.4Hz,1H),7.80–7.74(m,1H),7.74–7.64(m,2H),6.98(dd,J=8.3,2.1Hz,1H),6.42 (dd,J=7.9,2.5Hz,1H),6.20(d,J=2.5Hz,1H),4.11(s,1H),3.98(t,J=7.5Hz,2H),3.89–3. 78(m,2H),2.69(s,6H),1.90(d,J=2.5Hz,3H),1.37(q,J=5.0Hz,2H),1.26(q,J=5.1Hz,2H). 13 C NMR (151MHz, DMSO) δ170.24,150.67,149.08,148.72,146.83,137.94,131.25,130.11,129.40,127.44,126. 67,125.88,123.06,113.24,110.78,54.54,33.94,18.39,14.11.MS(ESI,m / z):C25H28N4O,[M+H]+401.233.

[0309] Example 29:

[0310]

[0311] C29: 11H NMR (600 MHz, DMSO) δ 9.16 (dd, J = 8.6, 1.6 Hz, 1H), 9.11 (d, J = 2.8 Hz, 1H), 9.05 (dd, J = 4.1, 1.6 Hz, 1H), 7.93 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 7.7 Hz, 1H), 7.73 (dd, J = 8.6, 4.1 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.91 (t, J = 7.2 Hz, 2H), 3.64 (s, 2H), 2.51–2.38 (m, 6H), 1.88 (s, 3H), 1.39–1.33 (m, 2H), 1.22 (q, J = 4.7 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.15, 151.15, 149.49, 144.22, 138.42, 138.01, 134.61, 132.39, 131.20, 129.45, 129.12, 128.76, 123.74, 122.43, 113.03, 110.52, 55.90, 55.48, 33.72, 18.36, 14.46, 9.09. MS (ESI, m / z): C25H27ClN4O, [M+H]+ 435.195.

[0312] Example 30:

[0313]

[0314] C30: 1 1H NMR (600 MHz, DMSO) δ 9.11 (s, 1H), 8.80 (d, J = 4.3 Hz, 1H), 8.17 (d, J = 8.5 Hz, 1H), 7.71 (d, J = 4.3 Hz, 1H), 7.56 (t, J = 8.1 Hz, 1H), 7.18 (d, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 3.96 (s, 3H), 3.84 (t, J = 7.2 Hz, 2H), 3.48 (s, 2H), 3.24 (s, 1H), 2.18 (s, 6H), 1.88 (s, 3H), 1.34 (t, J = 3.4 Hz, 2H), 1.22 (q, J = 5.0 Hz, 2H). 1313C NMR (151 MHz, DMSO) δ 170.34, 156.19, 149.86, 148.87, 146.49, 140.70, 137.77, 131.15, 128.58, 123.53, 123.43, 117.33, 112.86, 110.49, 108.25, 56.18, 56.11, 41.49, 34.24, 18.38, 14.11. MS (ESI, m / z): C26H30N4O2, [M+H]+ 431.244.

[0315] Example 31:

[0316]

[0317] C31: 1 1H NMR (600 MHz, DMSO) δ 9.07 (s, 1H), 8.74 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.5 Hz, 1H), 7.72–7.62 (m, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.00 (d, J = 8.5 Hz, 1H), 6.90 (dd, J = 8.3, 2.6 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.82–3.76 (m, 1H), 3.46–3.41 (m, 1H), 3.22 (s, 1H), 2.82 (d, J = 11.2 Hz, 1H), 2.73 (s, 6H), 2.60 (t, J = 10.5 Hz, 1H), 2.06 (s, 1H), 1.93 (s, 3H), 1.83–1.77 (m, 1H), 1.55 (h, J = 6.9 Hz, 2H), 1.37 (q, J = 3.1 Hz, 2H), 1.18 (d, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.01, 158.54, 156.88, 148.56, 138.21, 134.51 (d, J = 4.0 Hz), 133.52 (d, J = 4.6 Hz), 131.40, 129.12 (d, J = 8.3 Hz), 127.36, 126.69, 126.11, 125.85, 123.42 (d, J = 16.0 Hz), 120.85 (d, J = 5.3 Hz), 117.95, 115.71, 109.08, 108.96, 60.98, 49.72, 49.55, 34.14, 24.55, 23.25, 18.42, 14.59. MS (ESI, m / z): C28H32FN3O, [M+H]+ 446.260.

[0318] Example 32:

[0319]

[0320] C32: 1 H NMR (600MHz, DMSO) δ9.19(s,1H),8.88(d,J=4.4Hz,1H),8.68(d,J=8.4Hz,1H),8.06(d,J=8.4Hz,1H),7.77(ddd,J=8.4,6.7,1.4H z,1H),7.71(d,J=4.4Hz,1H),7.66(ddd,J=8.3,6.7,1.3Hz,1H),7.01(d,J=8.4Hz,1H),6.92(dd,J=8.4,2.6Hz,1H),6.67(d,J=2. 8Hz,1H),3.75(d,J=11.8Hz,1H),3.44(d,J=12.3Hz,1H),3.24(s,1H),2.83(t,J=11.0Hz,2H),2.76(s,6H),2.63(t,J=11.3Hz,2H ),2.07–2.03(m,1H),1.92(s,3H),1.81(dd,J=10.3,6.0Hz,1H),1.64–1.49(m,3H),1.39(q,J=4.0Hz,2H),1.26(q,J=4.3Hz,2H). 13 C NMR (151MHz, DMSO) δ170.26,150.67,148.74,148.59,146.84,137.94,131.44,130.14,129.37,127.45,126.64,126.17,125.87,1 23.04,118.09,115.73,61.08,49.72,49.55,40.53,33.99,24.54,23.17,18.39,14.09.MS(ESI,m / z):C27H32N4O,[M+H]+429.265.

[0321] Example 33:

[0322]

[0323] C33: 11H NMR (600 MHz, DMSO) δ 9.17 (s, 1H), 8.88 (d, J = 4.3 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.06 (dd, J = 8.4, 1.2 Hz, 1H), 7.77 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.3 Hz, 1H), 7.65–7.57 (m, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.95 (dd, J = 8.4, 2.7 Hz, 1H), 6.68 (d, J = 2.7 Hz, 1H), 3.70–3.65 (m, 4H), 3.10 (dd, J = 6.7, 3.7 Hz, 4H), 1.91 (s, 3H), 1.39 (t, J = 3.5 Hz, 2H), 1.27 (q, J = 4.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.12, 150.65, 148.73, 146.85, 145.69, 138.01, 131.74, 130.15, 129.42, 127.42, 126.69, 126.11, 125.79, 122.93, 117.37, 114.93, 50.18, 47.36, 34.06, 18.31, 14.03. MS (ESI, m / z): C24H25N3O3S, [M+H]+ 436.169.

[0324] Example 34:

[0325]

[0326] C34: 11H NMR (600 MHz, DMSO) δ 9.16 (d, J = 5.1 Hz, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (d, J = 8.6 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.3, 6.8, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.67 (ddd, J = 8.3, 6.9, 1.3 Hz, 1H), 6.86 (d, J = 8.3 Hz, 1H), 6.50 (d, J = 8.4 Hz, 1H), 6.28 (d, J = 2.7 Hz, 1H), 3.61 (d, J = 7.6 Hz, 1H), 3.47 (d, J = 11.7 Hz, 1H), 3.08 (s, 1H), 3.01 (s, 1H), 2.69 (d, J = 12.8 Hz, 1H), 2.00 (d, J = 4.5 Hz, 1H), 1.92 (s, 1H), 1.87 (s, 3H), 1.79 (s, 1H), 1.72 (s, 1H), 1.53 (s, 1H), 1.35 (s, 2H), 1.25 (s, 2H), 1.23 (dd, J = 7.2, 4.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.62, 150.65, 148.73, 146.87, 145.39, 138.20, 131.33, 130.10, 129.37, 127.46, 126.70, 125.88, 123.01, 122.20, 113.49, 111.69, 53.25, 47.69, 46.22, 45.71, 40.53, 33.85, 23.90, 22.62, 18.24, 17.81, 14.11. MS (ESI, m / z): C27H30N3O, [M+H]+ 427.249.

[0327] Example 35:

[0328]

[0329] C35: 11H NMR (600 MHz, DMSO) δ 9.04 (s, 1H), 8.71 (d, J = 8.5 Hz, 1H), 8.10–8.06 (m, 1H), 7.79 (dd, J = 8.0, 5.6 Hz, 1H), 7.71 (ddd, J = 8.4, 6.8, 1.4 Hz, 1H), 7.65 (ddd, J = 8.1, 6.8, 1.1 Hz, 1H), 7.29 (dd, J = 10.7, 7.9 Hz, 1H), 7.00 (d, J = 8.4 Hz, 1H), 6.94 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.69–3.64 (m, 4H), 3.09 (dd, J = 6.7, 3.7 Hz, 4H), 1.92 (s, 3H), 1.36 (t, J = 3.0 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 169.88, 158.54, 156.89, 145.70, 138.35, 134.48, 134.45, 133.50, 133.47, 131.69, 129.05 (d, J = 8.4 Hz), 127.40, 126.72, 126.10, 125.76, 123.44 (d, J = 16.3 Hz), 120.88 (d, J = 5.4 Hz), 117.26, 114.97, 109.01 (d, J = 19.3 Hz), 50.19, 47.39, 40.53, 34.20, 18.33, 14.51. MS (ESI, m / z): C25H25FN2O3S, [M+H]+ 453.164.

[0330] Example 36:

[0331]

[0332] C36: 11H NMR (600 MHz, DMSO) δ 9.16 (s, 1H), 8.87 (d, J = 4.3 Hz, 1H), 8.67 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (dd, J = 8.5, 6.8 Hz, 1H), 7.71–7.63 (m, 2H), 6.93 (d, J = 8.1 Hz, 1H), 6.37 (dd, J = 8.2, 2.6 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.59 (q, J = 7.6 Hz, 4H), 3.16 (s, 3H), 2.69 (s, 1H), 1.88 (s, 3H), 1.44 (s, 3H), 1.37 (q, J = 5.1 Hz, 2H), 1.25 (q, J = 5.1 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.35, 150.62, 149.73, 148.70, 146.92, 137.63, 131.18, 130.09, 129.38, 127.44, 126.61, 125.89, 123.44, 122.95, 113.05, 110.65, 73.24, 62.57, 62.53, 53.83, 50.68, 33.98, 22.52, 18.47, 18.39, 17.18, 14.04. MS (ESI, m / z): C25H27N3O2, [M+H]+ 402.218.

[0333] Example 37:

[0334]

[0335] C37: 11H NMR (600 MHz, DMSO) δ 9.15 (s, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.05 (dd, J = 8.5, 1.3 Hz, 1H), 7.76 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.66 (ddd, J = 8.3, 6.7, 1.3 Hz, 1H), 6.85 (d, J = 8.3 Hz, 1H), 6.51 (dd, J = 8.2, 2.6 Hz, 1H), 6.32 (d, J = 2.6 Hz, 1H), 3.82 (qd, J = 10.9, 5.6 Hz, 2H), 3.31–3.27 (m, 1H), 3.16 (dd, J = 13.4, 7.5 Hz, 1H), 2.97–2.85 (m, 1H), 1.86 (s, 3H), 1.35 (t, J = 3.7 Hz, 2H), 1.24 (q, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.07, 111.37, 47.03, 44.07, 42.54, 33.90, 18.27, 14.11. MS (ESI, m / z): C24H23N3O3, [M+H]+ 402.177.

[0336] Example 38:

[0337]

[0338] C38: 11H NMR (600 MHz, DMSO) δ 9.14 (dt, J = 8.7, 1.5 Hz, 1H), 9.05 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.6 Hz, 1H), 6.14 (d, J = 2.6 Hz, 1H), 3.58 (q, J = 7.7 Hz, 4H), 3.15 (s, 3H), 1.87 (s, 3H), 1.43 (s, 3H), 1.34 (t, J = 3.2 Hz, 2H), 1.20 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.07, 111.37, 47.03. 13 13C NMR (151 MHz, DMSO) δ 170.16, 157.95, 156.26, 150.67, 149.77, 138.35, 138.27, 137.88, 134.92, 134.89, 134.0, 131.17, 129.20, 129.15, 128.83, 123.30, 122.50, 112.98, 112.93, 112.81, 110.52, 73. .24, 62.57, 50.68, 40.53, 38.72, 33.63, 22.52, 18.35, 14.39. MS (ESI, m / z): C25H26FN3O2, [M + H]+ 420.208.

[0339] Example 39:

[0340]

[0341] C39: 11H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.00 (s, 1H), 8.95 (d, J = 4.2 Hz, 1H), 7.82 (dd, J = 8.0, 4.8 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.6, 7.9 Hz, 1H), 6.79 (d, J = 8.2 Hz, 1H), 6.40 (dd, J = 8.3, 2.5 Hz, 1H), 6.21 (d, J = 2.5 Hz, 1H), 3.21 (s, 1H), 3.03 (t, J = 11.5 Hz, 1H), 2.70 (s, 1H), 2.58 (s, 1H), 2.31 (d, J = 14.0 Hz, 1H), 1.88 (d, J = 2.9 Hz, 1H), 1.82 (s, 3H), 1.76–1.72 (m, 1H), 1.66 (s, 1H), 1.52 (s, 1H), 1.41 (s, 1H), 1.29 (s, 2H), 1.17 (dd, J = 12.5, 7.6 Hz, 4H). MS (ESI, m / z): C27H29FN4O, [M+H]+ 445.240.

[0342] Example 40:

[0343]

[0344] C40: 1 1H NMR (600 MHz, DMSO) δ 9.17 (dt, J = 8.6, 1.6 Hz, 1H), 9.12 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.99 (d, J = 8.4 Hz, 1H), 6.89 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.79 (d, J = 11.8 Hz, 1H), 3.49–3.43 (m, 1H), 3.06 (s, 1H), 2.79–2.70 (m, 2H), 2.65 (s, 6H), 2.58 (ddd, J = 11.8, 8.6, 2.5 Hz, 2H), 2.06–2.02 (m, 1H), 1.91 (s, 3H), 1.79 (dt, J = 9.4, 3.З Hz, 1H), 1.38 (q, J = 3.7 Hz, 2H), 1.20 (q, J = 4.3 Hz, 2H). 13C NMR(151MHz,DMSO)δ170.07,157.96,156.27,150.66,148.68,138.36,138 .28,138.03,134.93,134.89,134.07,131.42,129.23,129.18,128.85,12 5.83,122.52,117.86,115.49,112.93,112.81,60.84,50.10,49.53,33.6 6,24.88,23.40,18.38,14.41.MS(ESI,m / z):C27H31FN4O,[M+H]+447.248.

[0345] Example 41:

[0346]

[0347] C41: 1 H NMR(600MHz,DMSO)δ9.12(dt,J=8.7,1.6Hz,1H),9.07(s,1H),8.98(dd,J=4.1,1.6Hz, 1H),7.85(dd,J=8.0,5.0Hz,1H),7.73(dd,J=8.6,4.1Hz,1H),7.54(dd,J=10.7,8.0Hz ,1H),7.01(d,J=8.4Hz,1H),6.94(dd,J=8.4,2.8Hz,1H),6.67(d,J=2.8Hz,1H),3.69– 3.64(m,4H),3.11–3.06(m,4H),1.90(s,3H),1.42–1.35(m,2H),1.22(q,J=4.9Hz,2H). 13 CNMR(151MHz,DMSO)δ169.93,157.97,156.28,150.71,145.76,138.37,138.30,134.88,134.85,133.96,131.70,129.17,129.12,128.82, 125.96,122.53,117.28,114.86,112.94,112.81,50.20,47.39,40.53,33.71,18.27,14.38.MS(ESI,m / z):C24H24FN3O3S,[M+H]+454.153.

[0348] Example 42:

[0349]

[0350] C42: 1 1H NMR (699 MHz, dmso) δ 9.17 (s, 1H), 8.86 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.5 Hz, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.5 Hz, 1H), 7.68 (d, J = 4.4 Hz, 1H), 7.64 (t, J = 7.7 Hz, 1H), 7.02 (d, J = 8.2 Hz, 1H), 6.91 (d, J = 8.5 Hz, 1H), 6.64 (s, 1H), 3.72 (d, J = 13.0 Hz, 3H), 3.46 (d, J = 10.9 Hz, 4H), 3.08 (d, J = 11.7 Hz, 1H), 2.86 (d, J = 12.7 Hz, 1H), 1.90 (s, 3H), 1.35 (s, 2H), 1.26 (d, J = 6.6 Hz, 6H), 1.25–1.24 (m, 2H). MS (ESI, m / z): C27H32N4O, [M+H]+ 429.265.

[0351] Example 43:

[0352]

[0353] C43: 1 1H NMR (699 MHz, dmso) δ 9.14 (s, 1H), 8.85 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.4 Hz, 1H), 8.03 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.7 Hz, 1H), 7.67 (d, J = 4.4 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.82–6.80 (m, 1H), 6.57 (s, 1H), 2.94 (s, 3H), 2.60 (s, 3H), 1.87 (s, 3H), 1.61 (s, 1H), 1.35 (q, J = 5.0 Hz, 3H), 1.23 (s, 3H), 0.41 (s, 2H), 0.31 (s, 2H). MS (ESI, m / z): C27H30N4O, [M+H]+ 427.249.

[0354] Example 44:

[0355]

[0356] C44: 11H NMR (699 MHz, dmso) δ 9.78 (s, 1H), 9.11 (d, J = 8.7 Hz, 1H), 9.08 (s, 1H), 8.96 (d, J = 4.1 Hz, 1H), 7.83 (dd, J = 7.9, 4.8 Hz, 1H), 7.69 (dd, J = 8.6, 4.1 Hz, 1H), 7.53 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.3, 2.7 Hz, 1H), 6.63 (d, J = 2.8 Hz, 1H), 3.71 (d, J = 12.9 Hz, 2H), 3.49 (d, J = 9.8 Hz, 1H), 3.44 (d, J = 12.0 Hz, 2H), 3.05 (t, J = 10.9 Hz, 2H), 2.92 (t, J = 12.5 Hz, 2H), 1.88 (s, 3H), 1.33 (d, J = 5.0 Hz, 2H), 1.27 (d, J = 6.6 Hz, 6H), 1.19 (s, 2H). MS (ESI, m / z): C27H31FN4O, [M+H]+ 447.256.

[0357] Example 45:

[0358]

[0359] C45: 1 1H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.03 (s, 1H), 8.95 (d, J = 4.0 Hz, 1H), 7.82 (dd, J = 7.8, 4.7 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.8, 8.1 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.80 (dd, J = 8.3, 2.6 Hz, 1H), 6.56 (d, J = 2.8 Hz, 1H), 2.95 (d, J = 5.0 Hz, 4H), 2.60 (d, J = 5.0 Hz, 4H), 1.85 (s, 3H), 1.60 (s, 1H), 1.33 (s, 2H), 1.18 (d, J = 5.1 Hz, 2H), 0.41 (d, J = 6.5 Hz, 2H), 0.30 (s, 2H). MS (ESI, m / z): C27H29FN4O, [M+H]+ 445.239.

[0360] Example 46:

[0361]

[0362] C46: 1H NMR(699MHz,dmso)δ9.07(d,J=8.5Hz,1H),9.05(s,1H),8.90(d,J=4.0Hz,1H),7.92(d,J=8.4 Hz,1H),7.85(d,J=7.1Hz,1H),7.69(t,J=7.7Hz,1H),7.57(dd,J=8.6,4.1Hz,1H),6.94(d,J= 8.3Hz,1H),6.81(s,1H),6.56(s,1H),2.94(s,3H),2.60(s,2H),1.87(s,4H),1.60(s,1H),1. 34(s,3H),1.18(s,3H),0.41(s,2H),0.30(s,2H).MS(ESI,m / z):C27H30N4O,[M+H]+427.249.

[0363] Example 47:

[0364]

[0365] C47: 1 H NMR(699MHz,dmso)δ8.98–8.93(m,1H),7.82(h,J=8.1Hz,2H),7.75–7.70(m,1H),7.44 (dq,J=17.2,8.1Hz,2H),7.37(q,J=8.4Hz,1H),7.01(q,J=8.1Hz,1H),6.47–6.42(m,1 H),6.42–6.37(m,1H),3.90(t,J=8.5Hz,2H),3.54(s,1H),2.46(s,4H),2.21–1.97(m, 9H),1.36–1.31(m,2H),1.30–1.25(m,2H).MS(ESI,m / z):C26H29N3O,[M+H]+400.238.

[0366] Example 48:

[0367]

[0368] C48: 11H NMR (600 MHz, DMSO) δ 9.08 (d, J = 4.9 Hz, 1H), 8.72 (d, J = 8.5 Hz, 1H), 8.09 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 7.9, 5.5 Hz, 1H), 7.72–7.62 (m, 2H), 7.30 (dd, J = 10.6, 7.9 Hz, 1H), 7.03 (d, J = 8.4 Hz, 1H), 6.92 (dd, J = 8.6, 2.9 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.72 (s, 2H), 3.48 (s, 2H), 3.46 (s, 1H), 3.09 (q, J = 10.6 Hz, 2H), 2.99 (s, 1H), 2.92 (t, J = 12.4 Hz, 1H), 1.93 (s, 3H), 1.36 (s, 2H), 1.29 (d, J = 6.6 Hz, 6H), 1.21–1.16 (m, 2H). MS (ESI, m / z): C28H32FN3O, [M+H]+ 446.260.

[0369] Example 49:

[0370]

[0371] C49: 1 1H NMR (699 MHz, dmso) δ 9.00 (d, J = 3.9 Hz, 1H), 8.71–8.67 (m, 1H), 8.04 (dd, J = 8.5, 3.7 Hz, 1H), 7.76 (d, J = 8.1 Hz, 1H), 7.65 (d, J = 8.5 Hz, 1H), 7.62 (d, J = 8.0 Hz, 1H), 7.26 (d, J = 10.1 Hz, 1H), 6.93–6.89 (m, 1H), 6.78 (d, J = 8.3 Hz, 1H), 6.54 (s, 1H), 2.93 (d, J = 6.3 Hz, 4H), 2.58 (d, J = 5.5 Hz, 4H), 1.87 (d, J = 3.8 Hz, 3H), 1.59 (s, 1H), 1.32 (s, 2H), 1.14 (s, 2H), 0.40 (t, J = 5.3 Hz, 2H), 0.29 (s, 2H). MS (ESI, m / z): C28H30FN3O, [M+H]+ 444.244

[0372] Example 50:

[0373]

[0374] C50: 11H NMR (600 MHz, DMSO) δ 9.04 (d, J = 6.0 Hz, 1H), 8.72 (d, J = 8.7 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.81–7.76 (m, 1H), 7.69 (q, J = 7.3 Hz, 2H), 7.67–7.61 (m, 2H), 7.30–7.26 (m, 1H), 6.89 (d, J = 8.2 Hz, 1H), 6.51 (s, 1H), 6.29 (d, J = 10.1 Hz, 1H), 1.89 (s, 3H), 1.33 (q, J = 6.0 Hz, 3H), 1.16 (d, J = 6.3 Hz, 3H). MS (ESI, m / z): C25H26FN3O, [M+H]+ 404.2138.

[0375] Example 51:

[0376]

[0377] C51: 1 1H NMR (600 MHz, DMSO) δ 9.13 (dt, J = 8.7, 1.6 Hz, 1H), 9.03 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.83 (d, J = 8.2 Hz, 1H), 6.48 (dd, J = 8.2, 2.5 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 5.45 (s, 1H), 3.24 (s, 1H), 3.06 (s, 2H), 2.58 (s, 1H), 2.49 (s, 3H), 1.89 (d, J = 12.4 Hz, 2H), 1.85 (s, 3H), 1.47 (s, 1H), 1.32 (q, J = 4.6 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). MS (ESI, m / z): C26H29FN4O, [M+H]+ 433.232.

[0378] Example 52:

[0379]

[0380] C52: 1H NMR (600MHz, DMSO) δ9.16(d,J=8.6Hz,1H),9.07(s,1H),8.98(t,J=6.4Hz,1H),7.84(dd,J=8.2,4.7Hz,1H),7.7 0(td,J=8.4,4.2Hz,1H),7.57–7.51(m,1H),7.06(d,J=8.2Hz,1H),6.94(d,J=8.4Hz,1H),6.79–6.74(m,1H),6. 46(d,J=17.9Hz,1H),3.78(d,J=12.4Hz,1H),3.25(d,J=12.8Hz,2H),2.87(t,J=12.5Hz,2H),2.61(s,3H),1.88 (s,5H),1.62(d,J=13.1Hz,2H),1.36(s,2H),1.20(d,J=6.1Hz,2H).MS(ESI,m / z):C26H29FN4O,[M+H]+433.232.

[0381] Example 53:

[0382]

[0383] C53: 1 H NMR (600MHz, DMSO) δ9.16 (s, 1H), 9.08 (s, 1H), 8.99 (dt, J = 4.2, 2.3Hz, 1H), 7. 86(ddd,J=8.3,4.8,2.1Hz,1H),7.74(dq,J=7.6,4.1Hz,1H),7.60–7.52(m,2H ),6.93–6.86(m,2H),6.52(s,1H),6.30(s,1H),1.87(s,3H),1.34(t,J=2.9Hz ,3H),1.20(dd,J=6.9,4.8Hz,3H).MS(ESI,m / z):C24H25FN4O,[M+H]+405.208.

[0384] Example 54:

[0385]

[0386] C54: 11H NMR (600 MHz, DMSO) δ 9.03 (s, 1H), 8.76–8.70 (m, 1H), 8.07 (d, J = 8.2 Hz, 1H), 7.78 (t, J = 6.7 Hz, 1H), 7.69–7.61 (m, 1H), 7.33–7.22 (m, 1H), 7.06 (s, 1H), 6.92 (d, J = 8.5 Hz, 1H), 6.77–6.73 (m, 1H), 6.44 (d, J = 2.9 Hz, 1H), 3.02 (s, 3H), 2.73–2.65 (m, 3H), 2.14 (d, J = 9.4 Hz, 2H), 2.09–1.99 (m, 2H), 1.90 (s, 3H), 1.35 (s, 2H), 1.17 (s, 2H). MS (ESI, m / z): <>

[0387] C28H32FN3O, [M + H]+ 446.767.

[0388] Example 55:

[0389]

[0390] C55: 1 1H NMR (600 MHz, DMSO) δ 8.98 (s, 1H), 8.72 (d, J = 8.3 Hz, 1H), 8.07 (d, J = 8.1 Hz, 1H), 7.79 (dd, J = 7.9, 5.6 Hz, 1H), 7.70–7.66 (m, 1H), 7.64 (t, J = 7.5 Hz, 1H), 7.28 (dd, J = 10.6, 7.9 Hz, 1H), 6.80 (d, J = 8.3 Hz, 1H), 6.45 (dd, J = 8.3, 2.5 Hz, 1H), 6.24 (d, J = 2.5 Hz, 1H), 5.33 (d, J = 8.2 Hz, 1H), 2.98–2.92 (m, 2H), 2.54 (d, J = 11.8 Hz, 2H), 1.86 (s, 3H), 1.78 (dd, J = 13.1, 3.5 Hz, 2H), 1.32 (s, 2H), 1.15 (d, J = 5.5 Hz, 2H), 0.89–0.80 (m, 2H). MS (ESI, m / z): C26H28FN3O, [M + H]+ 418.222.

[0391]

[0392] Example 56:

[0393] C56: 11H NMR (600 MHz, DMSO) δ 9.13 (dd, J = 8.7, 1.6 Hz, 1H), 9.01 (s, 1H), 8.98 (dd, J = 4.1, 1.7 Hz, 1H), 7.84 (dd, J = 8.1, 4.9 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.7, 8.0 Hz, 1H), 6.80 (d, J = 8.2 Hz, 1H), 6.44 (dd, J = 8.3, 2.5 Hz, 1H), 6.23 (s, 1H), 5.28 (d, J = 8.2 Hz, 1H), 3.08 (d, J = 9.4 Hz, 1H), 2.88 (dt, J = 12.5, 3.7 Hz, 2H), 2.46–2.40 (m, 2H), 1.84 (s, 3H), 1.74 (dd, J = 13.0, 3.6 Hz, 2H), 1.32 (q, J = 4.5 Hz, 2H), 1.19 (d, J = 5.4 Hz, 2H), 1.11 (dd, J = 10.6, 3.2 Hz, 2H). MS (ESI, m / z): C25H27FN4O, [M+H]+ 419.217.

[0394] Example 57:

[0395]

[0396] C57: 1 1H NMR (400 MHz, Methanol-d4) δ 7.78 (dd, J = 7.9, 1.2 Hz, 1H), 7.62 (dd, J = 7.3, 1.1 Hz, 1H), 7.60 (d, J = 5.5 Hz, 1H), 7.44 (d, J = 5.5 Hz, 1H), 7.36 (t, J = 7.6 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.46 (dd, J = 8.2, 2.6 Hz, 1H), 6.41 (d, J = 2.5 Hz, 1H), 3.95 (dd, J = 7.7, 6.7 Hz, 2H), 3.59 (dd, J = 7.6, 5.8 Hz, 2H), 3.29 (q, J = 6.2 Hz, 1H), 2.25 (s, 6H), 2.07 (s, 3H), 1.36 (q, J = 2.4 Hz, 4H). 13C NMR(101MHz,Methanol-d4)δ172.81,149.54,140.40,139.14,136.76,135.41,130.73,125.79,124.48,124.11,123.89, 123.77,122.42,112.83,110.33,56.23,55.94,40.54,35.28,16.99,13.67.MS(ESI,m / z):C24H27N3OS,[M+H]+406.1948.

[0397] Example 58:

[0398]

[0399] C58: 1 H NMR(400MHz,DMSO-d6)δ9.17(dd,J=8.6,1.6Hz,1H),9.08(s,1H),9.04(dd,J=4.2,1.6Hz,1H),7.93 (d,J=8.0Hz,1H),7.77(dd,J=7.9,1.4Hz,1H),7.74(dd,J=8.6,4.2Hz,1H),6.92(d,J=8.2Hz,1H),6. 35(dd,J=8.2,2.5Hz,1H),6.13(d,J=2.5Hz,1H),3.81(t,J=7.0Hz,2H),3.41(dd,J=7.4,5.6Hz,2H) ,3.11(p,J=6.1Hz,1H),2.07(s,6H),1.86(s,3H),1.37(q,J=4.9,4.3Hz,2H),1.25(t,J=3.4Hz,2H). 13 C NMR(101MHz,DMSO-d6)δ170.31,151.39,150.05,143.87,141.28,138.62,137.80,134.24,131.15,128.85,128.73,123.08,122 .60,120.88,119.66,112.77,110.26,56.73,56.30,41.97,33.76,18.29,14.39.MS(ESI,m / z):C26H27F3N4O2,[M+H]+485.2159.

[0400] Example 59:

[0401]

[0402] C59: 11H NMR (400 MHz, DMSO-d6) δ 9.14 (dt, J = 8.7, 1.6 Hz, 1H), 9.11 (s, 1H), 8.97 (dd, J = 4.2, 1.6 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.8, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.37 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 4.39 (p, J = 6.3 Hz, 1H), 4.07 (dd, J = 7.5, 5.8 Hz, 2H), 3.80 (t, J = 7.3 Hz, 2H), 2.87 (s, 6H), 1.86 (s, 3H), 1.35 (q, J = 4.8, 4.4 Hz, 2H), 1.19 (q, J = 4.9 Hz, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.22, 150.64, 150.02, 137.98, 134.95, 134.05, 131.02, 128.84, 123.31, 122.48, 112.93, 112.76, 110.47, 64.45, 56.78, 55.36, 52.36, 33.61, 18.24, 14.40. MS (ESI, m / z): C25H27FN4O2, [M+H]+ 435.2191.

[0403] Example 60:

[0404]

[0405] C60: 1 1H NMR (400 MHz, Methanol-d4) δ 8.78 (dd, J = 9.9, 1.7 Hz, 1H), 7.62 (dd, J = 8.4, 5.0 Hz, 1H), 7.34 (dd, J = 10.7, 8.4 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 6.75 (d, J = 9.9 Hz, 1H), 6.45 (dd, J = 8.3, 2.6 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 3.94 (t, J = 7.1 Hz, 2H), 3.56 (dd, J = 7.5, 5.7 Hz, 2H), 3.26 (p, J = 6.3 Hz, 1H), 2.22 (s, 6H), 2.03 (s, 3H), 1.45–1.39 (m, 2H), 1.29 (t, J = 3.5 Hz, 2H). MS (ESI, m / z): C25H27FN4O2, [M+H]+ 435.2191.

[0406] Example 61:

[0407]

[0408] 61: 1 H NMR(400MHz,DMSO-d6)δ9.29(s,1H),9.07(d,J = 8.5Hz,1H),8.37(d,J = 7.1Hz,1H),8.20(s,1H),8.05–7.94(m,1H),6.94(d,J = 8.3Hz,1H),6.37(dd,J = 8.1,2.5Hz,1H),6.14(d,J = 2.5Hz,1H),3.82(t,J = 7.1Hz,2H),3.43(t,J = 6.5Hz,2H),3.18(d,J = 5.2Hz,1H),2.11(s,6H),1.89(s,3H),1.44(q,J = 2.3Hz,2H),1.24(q,J = 3.7,3.1Hz,2H).MS(ESI,m / z):C27H26F6N4O,[M + H]+537.2084.

[0409] Example 62:

[0410]

[0411] C62: 1 H NMR(400MHz,DMSO-d6)δ9.37(dd,J = 8.9,1.6Hz,1H),9.10(s,1H),8.04–7.91(m,2H),7.68(dd,J = 10.7,8.0Hz,1H),7.18(t,J = 54.6Hz,1H),6.96(d,J = 8.2Hz,1H),6.39(dd,J = 8.2,2.5Hz,1H),6.16(d,J = 2.5Hz,1H),3.92(t,J = 7.3Hz,2H),3.66(d,J = 7.0Hz,2H),3.44(dt,J = 9.3,4.6Hz,1H),2.49(s,6H),1.88(s,3H),1.37(q,J = 4.9,4.3Hz,2H),1.25(t,J = 3.3Hz,2H). 13C NMR(101MHz,DMSO-d6)δ170.14,155.74,149.39,137.99,137.24,136.61,135.13,131.22,130.99,129.27,123.83,118.17,114.49,114.2 0,114.02,113.05,110.53,56.49,55.96,55.37,49.06,41.02,33.60,19.02,18.31,14.43.MS(ESI,m / z):C26H27F3N4O,[M+H]+469.2210.

[0412] Example 63:

[0413]

[0414] C63: 1 H NMR (400MHz, DMSO-d6) δ9.15(dt,J=8.7,1.6Hz,1H),9.04(s,1H),8.98(dd,J=4.2,1.5Hz,1H),7.85(dd,J=8.1,5.1Hz ,1H),7.70(dd,J=8.7,4.1Hz,1H),7.54(dd,J=10.8,8.0Hz,1H),6.94(d,J=8.4Hz,1H),6.82(dd,J=8.4,2.7Hz,1H),6. 58(d,J=2.6Hz,1H),4.64(d,J=4.2Hz,1H),3.58(dq,J=9.0,4.5Hz,1H),3.48–3.34(m,2H),2.72(ddd,J=12.9,10.1,3 .0Hz,2H),1.88(s,3H),1.76(dd,J=13.1,4.1Hz,2H),1.46–1.38(m,2H),1.36(q,J=4.7Hz,2H),1.20(q,J=4.9Hz,2H). 13 C NMR(101MHz,DMSO-d6)δ170.23,150.63,149.14,137.91,134.96,134.04,131.29,129.18,129.10,128.83,124.74,122.43 ,117.19,114.79,112.94,112.76,66.38,47.08,34.20,33.67,18.30,14.36.MS(ESI,m / z):C25H26FN3O2,[M+H]+420.2082.

[0415] Example 64:

[0416]

[0417] C64: 1 1H NMR (400 MHz, DMSO-d6) δ 9.15–8.84 (m, 2H), 7.66 (dd, J = 8.1, 5.0 Hz, 1H), 7.46 (dd, J = 10.9, 8.1 Hz, 1H), 7.18 (d, J = 9.1 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.6 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 4.01 (s, 3H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.88 (s, 3H), 1.32 (q, J = 4.8, 4.4 Hz, 2H), 1.22–1.07 (m, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.11, 162.14, 157.09, 154.60, 150.06, 137.98, 137.52, 136.14, 136.02, 134.93, 134.88, 131.13, 126.82, 126.74, 125.86, 125.83, 123.08, 113.89, 113.67, 113.49, 112.71, 110.25, 56.77, 56.30, 53.80, 41.98, 33.73, 18.33, 14.45. MS (ESI, m / z): C26H29FN4O2, [M+H]+ 449.2347.

[0418] Example 65:

[0419]

[0420] C65: 11H NMR (400 MHz, DMSO-d6) δ 9.14 (dt, J = 8.7, 1.7 Hz, 1H), 9.06 (s, 1H), 8.97 (dd, J = 4.1, 1.5 Hz, 1H), 7.85 (dd, J = 8.0, 5.1 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.89 (d, J = 8.2 Hz, 1H), 6.31 (dd, J = 8.2, 2.5 Hz, 1H), 6.08 (d, J = 2.5 Hz, 1H), 4.34 (s, 1H), 3.66 (t, J = 7.6 Hz, 2H), 3.55 (t, J = 6.9 Hz, 2H), 2.72–2.60 (m, 1H), 1.85 (s, 3H), 1.35 (q, J = 4.7, 4.3 Hz, 2H), 1.20 (t, J = 3.2 Hz, 2H), 1.03 (s, 6H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.31, 158.36, 155.83, 150.64, 150.35, 138.37, 138.26, 137.88, 134.96, 134.91, 134.07, 131.01, 129.20, 129.13, 128.84, 128.82, 122.47, 112.95, 112.�7, 112.44, 109.96, 68.17, 53.03, 33.61, 27.11, 26.81, 18.31, 14.39. MS (ESI, m / z): C26H28FN3O2, [M+H]+ 434.2238.

[0421] Example 66:

[0422]

[0423] C66: 11H NMR (400 MHz, DMSO-d6) δ 9.19 (d, J = 8.7 Hz, 1H), 9.06 (s, 1H), 9.00 (dd, J = 4.2, 1.5 Hz, 1H), 8.45 (d, J = 4.7 Hz, 3H), 7.86 (dd, J = 8.0, 5.0 Hz, 1H), 7.74 (dd, J = 8.6, 4.2 Hz, 1H), 7.56 (dd, J = 10.8, 8.0 Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.49 (dd, J = 8.4, 2.6 Hz, 1H), 6.26 (d, J = 2.6 Hz, 1H), 3.48 (d, J = 9.5 Hz, 2H), 3.08 (d, J = 9.1 Hz, 2H), 2.39–2.31 (m, 1H), 2.09 (d, J = 2.8 Hz, 2H), 1.87 (s, 3H), 1.40 (s, 3H), 1.36 (q, J = 5.0 Hz, 2H), 1.20 (t, J = 3.4 Hz, 2H). 13 13C NMR (101 MHz, DMSO-d6) δ 170.26, 150.45, 145.85, 137.99, 131.31, 122.74, 122.51, 113.97, 111.49, 66.82, 49.57, 33.63, 31.48, 26.81, 21.65, 18.27, 14.41. MS (ESI, m / z): C25H25FN4O, [M+H]+ 417.2085.

[0424] Example 67:

[0425]

[0426] C67: 11H NMR (400 MHz, DMSO) δ 9.16 (s, 1H), 8.93 (d, J = 4.4 Hz, 1H), 8.47 (d, J = 8.3 Hz, 1H), 7.79 (d, J = 4.4 Hz, 1H), 7.70–7.52 (m, 2H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.14 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.4 Hz, 2H), 3.13 (t, J = 6.4 Hz, 1H), 2.08 (s, 6H), 1.86 (s, 3H), 1.42–1.33 (m, 2H), 1.27 (q, J = 5.7, 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.45, 159.56, 157.03, 150.87, 150.01, 147.02 (d, J = 2.7 Hz), 138.76 (d, J = 11.3 Hz), 137.61, 131.16, 129.27, 126.53 (d, J = 8.4 Hz), 123.61 (d, J = 81.9 Hz), 121.89 (d, J = 4.8 Hz), 113.50 (d, J = 18.4 Hz), 112.82, 110.37, 56.68, 56.29, 41.94, 34.16, 18.31, 14.09. MS (ESI, m / z): C25H27FN4O, [M+H]+ 419.217.

[0427] Example 68:

[0428]

[0429] C68: 11H NMR (400 MHz, DMSO) δ 9.03 (s, 1H), 8.72 (d, J = 8.2 Hz, 1H), 8.16–8.06 (m, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.72–7.60 (m, 2H), 7.50 (d, J = 74.0 Hz, 1H), 7.26 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.5 Hz, 1H), 6.11 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.5 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.90 (s, 3H), 1.35 (t, J = 3.6 Hz, 2H), 1.17 (d, J = 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.17, 150.01, 146.57 (d, J = 3.0 Hz), 137.99, 135.39, 133.33, 131.12, 128.75, 127.19, 126.71, 126.18, 125.88, 123.22, 121.98, 119.88, 117.32, 112.69, 110.44, 56.72, 56.30, 41.96, 34.18, 18.42, 14.58. MS (ESI, m / z): C27H29F2N3O2, [M+H]+ 466.223.

[0430] Example 69:

[0431]

[0432] C69: 11H NMR (400 MHz, DMSO) δ 9.15 (dd, J = 8.6, 1.7 Hz, 1H), 9.06 (s, 1H), 8.99 (dd, J = 4.2, 1. = 1.6 Hz, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.59 (d, J = 42.5 Hz, 1H), 7.52–7.25 (m, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.6 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.07 (s, 6H), 1.88 (s, 3H), 1.36 (q, J = 4.7, 4.2 Hz, 2H), 1.20 (q, J = 4.9 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.41, 151.48, 150.13, 146.72, 138.29, 138.12, 136.74, 134.41, 131.16, 129.40, 128.82, 123.26, 122.33, 118.90, 117.33, 113.82, 111.35, 60.08, 55.79, 42.69, 33.69, 17.61, 13.10. MS (ESI, m / z): C26H28F2N4O2, [M+H]+ 467.218.

[0433] Example 70:

[0434]

[0435] C70: 1H NMR (400MHz, DMSO) δ9.15 (s, 1H), 8.86–8.76 (m, 1H), 8.20–8.09 (m, 2H), 7.94 (d, J = 7. 5Hz,1H),7.86–7.72(m,2H),6.91(d,J=8.2Hz,1H),6.34(dd,J=8.2,2.5Hz,1H),6.12( d,J=2.6Hz,1H),3.80(t,J=7.0Hz,2H),3.40(dd,J=7.4,5.7Hz,2H),3.11(p,J=6.2Hz ,1H),2.07(s,6H),1.86(s,3H),1.40(q,J=4.7,4.2Hz,2H),1.25(q,J=4.8Hz,2H).13C NMR (101MHz, DMSO) δ170.39,150.01,144.24,137.72,133.05,132.46,131.92,131.15,128.95,128.43,127.86,126.78,125.38 ,123.19,118.18,112.79,110.38,108.84,56.70,56.29,41.95,34.66,18.34,14.56.MS(ESI,m / z):C27H28N4O,[M+H]+425.226

[0436] Example 71

[0437]

[0438] C71: 1 H NMR (400MHz, DMSO-d6) δ8.86(s,1H),8.20(s,1H),7.38(t,J=7.9Hz,2H),7.32(t,J=8.2Hz ,1H),7.12(t,J=7.4Hz,1H),7.01(t,J=7.3Hz,3H),6.97–6.91(m,2H),6.85–6.79(m,1H), 6.42(dd,J=8.2,2.3Hz,1H),6.35(d,J=2.2Hz,1H),3.96–3.89(m,2H),3.63–3.57(m,2H), 3.18–3.10(m,1H),2.32(s,6H),2.12(s,3H).MS(ESI,m / z):C28H31N3O2,[M+H]+442.242.

[0439] Example 72

[0440]

[0441] C72: 1 H NMR (400MHz, DMSO-d6) δ8.96 (s, 1H), 8.13–8.06 (m, 2H), 7.57 (d, J = 8.2Hz, 1H) ,7.55–7.41(m,3H),7.22–7.16(m,1H),7.05–6.99(m,1H),6.43(s,2H),3.94–3 .89(m,2H),3.55–3.50(m,2H),3.21–3.16(m,1H),2.19(s,3H),2.11(s,6H),1. 32–1.29(m,2H),1.25–1.22(m,2H).MS(ESI,m / z):C29H32N4O,[M+H]+453.258.

[0442] Example 73

[0443]

[0444] C73: 1 H NMR(400MHz,DMSO-d6)δ11.25(s,1H),8.88(s,1H),8.38–8.17(m,2H),7.84–7.71(m ,1H),7.58–7.46(m,1H),7.39–7.29(m,1H),6.91(d,J=7.2Hz,1H),6.41–6.28(m,1H ),6.20–6.09(m,1H),3.86–3.74(m,2H),3.16–3.04(m,1H),2.06(s,6H),1.92(s,3H ),1.26–1.13(m,2H),1.11–0.98(m,2H).MS(ESI,m / z):C25H28N4O2,[M+H]+417.221.

[0445] Example 74

[0446]

[0447] C74: 1H NMR (400MHz, DMSO-d6) δ9.03(s,1H),8.59(d,J=8.3Hz,1H),8.26(s,1H),8.20(d,J=8.2Hz,1H ),7.83(t,J=7.5Hz,1H),7.63(t,J=7.4Hz,1H),6.91(d,J=8.1Hz,1H),6.34(d,J=7.8Hz,1H),6 .13(s,1H),4.05(s,3H),3.81(t,J=6.7Hz,2H),3.20(s,1H),3.03(dd,J=14.3,7.1Hz,2H),2. 11(s,6H),1.90(s,3H),1.30(s,2H),1.14(s,2H).MS(ESI,m / z):C26H30N4O2,[M+H]+431.237.

[0448] Example 75

[0449]

[0450] C75: 1 H NMR(400MHz,DMSO-d6)δ9.09(d,J=8.2Hz,1H),9.06–8.99(m,1H),8.98–8.92(m,1H),7.75 (d,J=7.1Hz,1H),7.67–7.54(m,2H),6.92(d,J=8.0Hz,1H),6.34(d,J=7.5Hz,1H),6.11(s, 1H),3.80(t,J=6.6Hz,2H),3.44–3.37(m,2H),3.11(s,1H),2.70(s,3H),2.06(s,5H),1.8 9(s,3H),1.38–1.29(m,2H),1.20–1.12(m,2H).MS(ESI,m / z):C26H30N4O,[M+H]+415.242.

[0451] Figure 8 The figure shows the inhibition rate curve of compound C75.

[0452] Example 76

[0453]

[0454] C76: 1H NMR (400MHz, DMSO-d6) δ9.05(dd,J=8.6,1.5Hz,1H),8.96(s,1H),8.85(dd,J=4.0,1.5Hz,1H),7.78(d,J= 8.0Hz,1H),7.60(dd,J=8.6,4.1Hz,1H),7.13(d,J=8.1Hz,1H),6.91(d,J=8.3Hz,1H),6.34(dd,J=8.2,2. 4Hz,1H),6.11(d,J=2.4Hz,1H),3.96(s,3H),3.85–3.76(m,2H),3.48–3.40(m,2H),3.21–3.13(m,1H),2. 10(s,6H),1.88(s,3H),1.35–1.29(m,2H),1.16–1.11(m,2H).MS(ESI,m / z):C26H30N4O2,[M+H]+431.237.

[0455] Figure 9 The figure shows the inhibition rate curve of compound C76.

[0456] Example 77

[0457]

[0458] C77: 1 H NMR (400MHz, DMSO-d6) δ8.48(s,1H),7.02(dd,J=6.0,3.2Hz,1H),6.96(d,J=8.2Hz,1H ),6.76–6.70(m,2H),6.37(dd,J=8.2,2.4Hz,1H),6.28(d,J=2.4Hz,1H),4.32–4.27(m, 2H),4.26–4.20(m,2H),3.90–3.85(m,2H),3.52–3.46(m,2H),3.21–3.13(m,1H),2.11( s,6H),2.08(s,3H),1.08(d,J=3.2Hz,4H).MS(ESI,m / z):C24H29N3O3,[M+H]+408.221.

[0459] Example 78

[0460]

[0461] C78: 1H NMR(400MHz, DMSO-d6)δ8.82(s,1H),7.01(d,J=8.6Hz,1H),6.88(dd,J=7.4, 1.9Hz,1H),6.82–6.75(m,2H),6.44–6.39(m,2H),5.96(s,2H),3.94–3.87(m ,2H),3.55–3.48(m,2H),3.21–3.13(m,1H),2.16(s,3H),2.11(s,6H),1.43– 1.38(m,2H),1.17–1.12(m,2H).MS(ESI,m / z):C23H27N3O3,[M+H]+394.205.

[0462] Example 79

[0463]

[0464] C79: 1 H NMR(400MHz, CDCl3)δ9.02(d,J=4.0Hz,1H),8.45(d,J=8.6Hz,1H),7.93(s,1H),7.72(s,1H),7.61–7.55(m,1H),7.53–7.48(m,1H),7.48–7.42(m ,1H),7.36–7.31(m,1H),6.92(d,J=8.1Hz,1H),1.93(s,3H),1.83–1.75 (m,2H),1.49–1.41(m,2H).MS(ESI,m / z):C20H16BrFN2,[M+H]+383.048.

[0465] Example 80

[0466]

[0467] C80: 1H NMR(400MHz,DMSO-d6)δ9.00(d,J=4.0Hz,1H),8.44(d,J=8.5Hz,1H),7.71(s,1H), 7.70–7.60(m,3H),6.90(d,J=8.2Hz,1H),6.70(d,J=2.4Hz,1H),6.40–6.35(m,1H) ,3.89–3.82(m,2H),3.47–3.42(m,2H),3.16–3.10(m,1H),2.08(s,6H),1.83(s,3H ),1.66–1.62(m,2H),1.45–1.40(m,2H).MS(ESI,m / z):C25H27FN4,[M+H]+402.222.

[0468] Example 81

[0469]

[0470] C81: 1 H NMR(400MHz, CDCl3)δ9.10–9.04(m,1H),9.02(s,1H),7.96–7.89(m,1H),7.63–7.56(m,1H) ,7.46–7.36(m,1H),7.30(s,1H),7.00–6.92(m,1H),6.41–6.33(m,2H),6.24–6.19(m,1H), 3.92–3.84(m,2H),3.52–3.44(m,2H),2.98–2.91(m,2H),2.77–2.66(m,1H),2.07(d,J=4.7 Hz,3H),1.65–1.58(m,2H),1.42–1.35(m,2H).MS(ESI,m / z):C24H25FN4O,[M+H]+405.201.

[0471] Example 82

[0472]

[0473] C82: 1H NMR (400MHz, DMSO-d6) δ9.23(d,J=8.6Hz,1H),8.93(d,J=3.8Hz,1H),7.87–7.77(m,1H),7.64(dd,J=8. 6,4.1Hz,1H),7.54–7.42(m,1H),6.77(d,J=8.2Hz,1H),6.45–6.37(m,1H),6.31–6.27(m,1H),4.06–4.0 0(m,1H),3.85–3.76(m,1H),3.09–3.01(m,1H),2.70–2.55(m,2H),1.88(s,3H),1.75–1.67(m,1H),1.26 –1.20(m,2H),1.12–1.07(m,2H),1.06(s,3H),0.93(s,3H).MS(ESI,m / z):C26H29FN4O,[M+H]+432.233.

[0474] Example 83

[0475]

[0476] C83: 1 H NMR (400MHz, DMSO-d6) δ9.14(d,J=8.6Hz,1H),9.07(s,1H),8.97(d,J=3.3Hz,1H),7.90–7.82(m ,1H),7.75–7.69(m,1H),7.59–7.50(m,1H),6.92(d,J=8.2Hz,1H),6.36–6.28(m,1H),6.11(d,J =2.1Hz,1H),3.89–3.82(m,2H),3.43–3.37(m,3H),3.00–2.92(m,1H),2.85(s,2H),2.40(s,7H) ,1.86(s,3H),1.38–1.32(m,2H),1.22–1.17(m,2H).MS(ESI,m / z):C26H29FN4O,[M+H]+432.233.

[0477] Example 84

[0478]

[0479] C84: 1H NMR(400MHz, DMSO-d6)δ9.09–9.03(m,1H),8.99–8.95(m,1H),7.68(dd,J=8.6,4.1Hz,1H),7.56–7.43(m,2H),7.26(d,J=1.9Hz,1H),7.22–7.1 7(m,1H),6.95(d,J=8.1Hz,1H),3.47(s,2H),1.91(s,3H),1.20–1.13(m,2H),0.95–0.89(m,2H).MS(ESI,m / z):C20H18BrFN2,[M+H]+385.064.

[0480] Example 85

[0481]

[0482] C85: 1 H NMR(400MHz, DMSO-d6)δ9.06(d,J=8.6Hz,1H),9.00–8.94(m,1H),7.72–7.65(m, 1H),7.57–7.52(m,1H),7.52–7.46(m,1H),6.78(d,J=8.0Hz,1H),6.18–6.10(m,2 H),3.76–3.69(m,2H),3.41(s,2H),3.11–3.04(m,1H),2.06(s,6H),1.81(s,3H), 1.19–1.13(m,2H),0.94–0.88(m,2H).MS(ESI,m / z):C25H29FN4,[M+H]+405.238.

[0483] Example 86

[0484]

[0485] C86: 1 H NMR (400MHz, CDCl3) δ9.08–9.02(m,1H),8.92–8.85(m,1H),7.60–7.51(m,2H),7.41–7.33(m,1H),6.86–6.80(m,1H),6.49 –6.41(m,2H),3.49(s,2H),1.89(s,3H),1.28–1.23(m,2H),1.06–0.99(m,2H).MS(ESI,m / z):C20H20FN3,[M+H]+322.164.

[0486] Example 87

[0487]

[0488] C87: 1 H NMR(400MHz,DMSO-d6)δ9.25–9.12(m,1H),9.10–8.95(m,2H),7.94–7.84( m,1H),7.78–7.67(m,1H),7.61–7.49(m,1H),7.24(s,1H),6.76(d,J=7.9H z,1H),6.55–6.41(m,1H),6.28(s,1H),4.90(s,2H),1.84(s,3H),1.37–1. 29(m,2H),1.22–1.14(m,2H).MS(ESI,m / z):C20H18FN3O,[M+H]+336.143.

[0489] Example 88:

[0490]

[0491] C88: 1 H NMR(400MHz,DMSO)δ8.93(s,1H),8.71–8.61(m,1H),8.24–8.14(m,1H),7.72(d,J=7 .7Hz,1H),7.59–7.47(m,2H),7.06(d,J=7.8Hz,1H),6.91(d,J=8.2Hz,1H),6.33(dd, J=8.2,2.4Hz,1H),6.12(d,J=2.4Hz,1H),3.79(t,J=7.0Hz,2H),3.48–3.37(m,2H), 3.17–3.05(m,1H),2.81(s,6H),2.06(s,6H),1.94(s,3H),1.32(s,2H),1.12(s,2H). 13 CNMR(151MHz,DMSO)δ170.00,150.41,149.98,138.13,133.45,132.62,131.09,129.06,128.77,126.11,125.84,125.01,124.7 2,123.26,113.53,112.61,110.51,56.72,56.30,45.37,41.96,34.33,18.49,14.70.MS(ESI,m / z):C28H34N4O,[M+H]+443.273.

[0492] Example 89:

[0493]

[0494] C89: 1 1H NMR (400 MHz, DMSO-d6) δ 9.03–8.96 (m, 2H), 7.75 (dd, J = 8.1, 5.0 Hz, 1H), 7.58 (d, J = 8.8 Hz, 1H), 7.46 (dd, J = 10.9, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.1, 2.5 Hz, 1H), 6.13 (d, J = 2.5 Hz, 1H), 3.86 (d, J = 7.5 Hz, 2H), 3.52 (d, J = 14.5 Hz, 2H), 2.69 (s, 4H), 2.29 (s, 6H), 1.87 (s, 3H), 1.32 (q, J = 4.9 Hz, 2H), 1.16 (td, J = 5.0, 2.5 Hz, 2H). 13 13C NMR (101 MHz, MeOD) δ 173.88, 160.82, 150.73, 138.44, 135.60, 132.18, 129.83, 125.25, 124.33, 114.27, 113.88, 113.69, 111.13, 57.66, 56.86, 41.78, 34.62, 24.57, 18.22, 14.96. MS (ESI, m / z): C26H29FN4O, [M+H]+ 433.240.

[0495] Example 90:

[0496]

[0497] C90: 1 1H NMR (400 MHz, Methanol-d4) δ 9.20 (dt, J = 8.9, 1.6 Hz, 1H), 8.93 (dd, J = 4.3, 1.6 Hz, 1H), 8.00 (dd, J = 8.1, 5.0 Hz, 1H), 7.78–7.67 (m, 1H), 7.49 (dd, J = 10.6, 8.1 Hz, 1H), 6.96 (d, J = 8.3 Hz, 1H), 6.44 (dd, J = 8.2, 2.6 Hz, 1H), 6.23 (d, J = 2.5 Hz, 1H), 3.22 (s, 1H), 2.21 (s, 6H), 1.94 (s, 3H), 1.52–1.45 (m, 2H), 1.38–1.31 (m, 2H). 13C NMR(101MHz,MeOD)δ173.98,159.65,157.11,151.12,151.07,146.30,139. 25,139.14,138.26,135.70,135.44,133.94,132.12,130.82,130.74,130.2 7,126.34,124.90,123.39,120.09,114.24,113.92,113.73,111.10,57.19 ,42.02,34.58,18.22,14.94.MS(ESI,m / z):C25H23D4FN4O,[M+H]+423.249.

[0498] Example 91:

[0499]

[0500] C91: 1 H NMR (400MHz, Methanol-d4) δ7.30(t,J=7.0Hz,2H),7.20(d,J=3.2Hz,1H),7.14(t,J=7.7Hz,1H),7.04(d,J=8.2Hz,1H),6.85(d,J=3.2Hz,1H), 6.48(dd,J=8.2,2.6Hz,1H),6.36(d,J=2.6Hz,1H),4.14–4.01(m,2H), 3.83(s,5H),3.37(s,1H),2.85(s,6H),2.09(s,3H),1.36–1.26(m,4H). 13 C NMR(101MHz,MeOD)13C NMR (101MHz, DMSO-d6) δ169.19,148.54,137.97,136.63,134.07,130.77,128.83,127.08,124.15,120.43,118.59,112. 59,110.57,108.48,99.98,55.33,54.92,54.20,34.39,32.56,18.21,14.30.MS(ESI,m / z):C25H30N4O,[M+H]+403.249.

[0501] Compound preparation:

[0502] (1) Preparation of the substituted naphthyl-cyclopropylamine intermediate (1-(substituted naphthyl-1-yl)cyclopropylamine): The synthetic route is as follows:

[0503]

[0504] X=4-F,4-Br,4-Me,4-OMe,4-OCHF2,5-F,5-Cl,6-F,

[0505] 6,7-difluoro,4,5-difluoro,4-OMe-5-F,

[0506] Substituted naphthonitrile (1, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain the substituted naphthyl-cyclopropylamine intermediate 2.

[0507] (2) The preparation of the compounds in Examples 1-3, the synthetic routes are as follows:

[0508]

[0509] 2-Methyl-5-bromobenzoate (3, 2 mmol, 1.0 eq) was placed in a 50 mL sealed tube, and nitrogen-containing amine compound 4 (3 mmol, 1.5 eq), tris(dibenzylacetone)dipalladium (0.04 mmol, 0.02 eq), X-PHOS ligand (0.08 mmol, 0.04 eq), and cesium carbonate (4 mmol, 2.0 eq) were added. Toluene solvent (10 mL) was then added, and the reaction system was protected with argon gas, sealed, and heated to 110 °C with stirring overnight. After substrate conversion was confirmed by TLC, the organic solvent was evaporated and purified by column chromatography to obtain intermediate 5.

[0510] Intermediate 5 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water = 2:1 was added as a solvent. Then lithium hydroxide (4.0 eq) was added to the reaction system. After stirring at 60°C for 6 hours, the reaction system was acidified with 2N hydrochloric acid. After adding ethyl acetate, a white solid precipitated. The solid was filtered out and dried to obtain intermediate 6.

[0511] Add DMF solvent to 6 and the previously obtained three-membered cyclic amine intermediate 2 in a 1:1 ratio, add HATU (1.5 eq) and DIPEA (2.0 eq), react at 70 °C for 12 h, extract the reaction solution with ethyl acetate, wash three times with saturated ammonium chloride solution, evaporate the organic phase to dryness, and purify by silica gel column chromatography to obtain product 7.

[0512] When amine compound 6 is protected by Boc (tert-butyloxycarbonyl), the final product is obtained by removing the tert-butyloxycarbonyl group from compound 7 with hydrochloric acid.

[0513] (3) The preparation of the compounds in Examples 4-6, the synthetic routes are as follows:

[0514]

[0515] 1-(3-bromophenyl)cyclopropaneamine (8, 10 mmol, 1.0 eq) was placed in a 100 mL round-bottom flask, 50 mL of dichloromethane solvent was added, followed by di-tert-butyl dicarbonate (40 mmol, 4.0 eq). The mixture was stirred at room temperature for 4 hours, the organic solvent was evaporated, and the mixture was purified by column chromatography to obtain intermediate 9.

[0516] In a sealed tube containing 50 mL of intermediate 9 (4 mmol, 1.0 eq), thiophene-2-borate pinacol ester (6 mmol, 1.5 eq), tris(dibenzylacetone)dipalladium (0.08 mmol, 0.02 eq), X-PHOS ligand (0.16 mmol, 0.04 eq), and potassium phosphate (10 mmol, 2.5 eq) were added. Then, DMF:ethanol:water = (10 mL:10 mL:5 mL) was added as a solvent. The reaction system was protected with argon gas, sealed, heated to 95 °C, and stirred overnight. After substrate conversion was confirmed by TLC, the organic solvent was evaporated, the organic phase was extracted with ethyl acetate, and purified by column chromatography to obtain intermediate 10.

[0517] Intermediate 10 (4 mmol, 1.0 eq) was dissolved in 20 mL of dichloromethane solvent, and 2 mL of 4N hydrochloric acid-dioxane solution was added. The mixture was stirred at room temperature for 2 hours, and a white solid precipitated. The solid was filtered off and dried to obtain intermediate 11.

[0518] Product 11 was added to DMF solvent in a 1:1 ratio with the previously obtained carboxylic acid intermediate 6. HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The product 12 was then purified by silica gel column chromatography.

[0519] When amine compound 6 is protected by Boc (tert-butyloxycarbonyl), the final product is obtained by removing the tert-butyloxycarbonyl group from compound 7 with hydrochloric acid.

[0520] (4) Preparation of compounds in Examples 7 and 8: The synthetic routes are as follows:

[0521]

[0522] 16 m-tert-butylbenzonitrile (10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Subsequently, boron trifluoride diethyl ether (20 mmol, 2.0 eq) was added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 17.

[0523] The intermediate 17 of m-tert-butylbenzene-cyclopropylamine was added to DMF solvent in a 1:1 equivalent ratio with the previously obtained carboxylic acid intermediate 6. HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The product 18 was then purified by silica gel column chromatography.

[0524] In Example 7, amine compound 6 was protected by Boc (tert-butyloxycarbonyl), and the final product was obtained by removing the tert-butyloxycarbonyl group from compound 18 with hydrochloric acid.

[0525] (5) Preparation of compounds in Examples 9-18, the synthetic routes are as follows:

[0526]

[0527] 2-Methyl-5-bromobenzoate (3, 10 mmol, 1.0 eq) was placed in a 350 mL sealed tube, and 3-dimethylaminoacridine (19, 15 mmol, 1.5 eq), tris(dibenzylacetone)dipalladium (0.2 mmol, 0.02 eq), X-PHOS ligand (0.4 mmol, 0.04 eq), and cesium carbonate (50 mmol, 5.0 eq) were added. Toluene solvent (60 mL) was then added, and the reaction mixture was protected with argon gas, sealed, and heated to 110 °C with stirring overnight. After substrate conversion was confirmed by TLC, the organic solvent was evaporated, and the mixture was purified by column chromatography to obtain intermediate 20.

[0528] Intermediate 20 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water = 2:1 was added as a solvent. Then potassium hydroxide (4.0 eq) was added to the reaction system. After stirring at 60°C for 6 hours, the organic solvent was evaporated to dryness. Then, 2N hydrochloric acid was added to the remaining aqueous solution to acidify it and adjust the pH to 1. The aqueous solution was then evaporated to dryness, and methanol solution was added to extract the organic matter. The mixture was filtered and the residue was removed. The filtrate was collected and evaporated to dryness to obtain a white solid, which is intermediate 21.

[0529] Product 21 was added to DMF solvent in a 1:1 equivalent ratio with the previously obtained three-membered cyclic amine intermediate 2, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product was then purified by silica gel column chromatography to obtain product 22. The final product 22 is the relevant example.

[0530] (6) Preparation of the compound in Example 19, the synthetic route is as follows:

[0531]

[0532] Benzonitrile (23, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 24.

[0533] Cyclopropylamine intermediate 24 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 25 was then purified by silica gel column chromatography. The final product 25 is C19.

[0534] (7) Preparation of the compound in Example 20: The synthetic route is as follows:

[0535]

[0536] Benzo[B]thiophene-3-carboxynitrile (26, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 27.

[0537] Cyclopropylamine intermediate 27 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 28 was then purified by silica gel column chromatography. The final product 28 is C20.

[0538] (8) Preparation of the compound in Example 21, the synthetic route is as follows:

[0539]

[0540] 5,6,8,9-Tetrahydro-1-cyanonaphthalene (29, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 30.

[0541] Cyclopropylamine intermediate 30 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 31 was then purified by silica gel column chromatography. The final product 31 is C21.

[0542] (9) Preparation of the compound in Example 22, the synthetic route is as follows:

[0543]

[0544] 4-Cyanobenzyl (32, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 33.

[0545] Cyclopropylamine intermediate 33 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 34 was then purified by silica gel column chromatography. The final product 34 is Example C22.

[0546] (10) Preparation of the compound in Example 23, the synthetic route is as follows:

[0547]

[0548] 3-Cyanobenzyl (35, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 36.

[0549] Cyclopropylamine intermediate 36 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 37 was then purified by silica gel column chromatography. The final product 37 is C23.

[0550] (11) Preparation of the compound in Example 24, the synthetic route is as follows:

[0551]

[0552] Benzofuran-4-carboxynitrile (38, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 39.

[0553] Cyclopropylamine intermediate 39 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 40 was then purified by silica gel column chromatography. The final product 40 is C24.

[0554] (12) Preparation of the compound in Example 25, the synthetic route is as follows:

[0555]

[0556] 1-Tetrahydronaphthone (41, 20 mmol, 1.0 eq), trimethylcyanosilane (24 mmol, 1.2 eq), and zinc iodide (0.5 mmol, 0.025 eq) were placed in a 250 mL round-bottom flask, and 100 mL of toluene was added as solvent. After stirring at room temperature for eight hours, the reaction was checked by TLC to confirm completion. After the organic solvent was evaporated, the mixture was purified by silica gel column chromatography to obtain intermediate 42. Intermediate 42 (15 mmol, 1.0 eq) was placed in a 250 mL round-bottom flask, and 50 mL of pyridine was added. Then, phosphorus oxychloride (45 mmol, 3.0 eq) was added dropwise at room temperature. After the addition was complete, the temperature was raised to 80 °C and the reaction was carried out for 8 hours. After the reaction was completed, the organic solvent was evaporated, the reaction system was adjusted to neutral, and the organic phase was extracted with ethyl acetate. After the organic phase was evaporated, the mixture was purified by silica gel column chromatography to obtain intermediate 43.

[0557] Intermediate 43 (10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Then, tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Subsequently, boron trifluoride diethyl ether (20 mmol, 2.0 eq) was added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Then, excess saturated sodium hydroxide solution was added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain m-tert-butylphenyl-cyclopropylamine intermediate 44.

[0558] Cyclopropylamine intermediate 44 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 45 was then purified by silica gel column chromatography. The final product 45 is C25.

[0559] (13) Preparation of the compound in Example 26, the synthetic route is as follows:

[0560]

[0561] 8-Fluoroquinoline-4-carboxynitrile (71, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for three hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain 8-fluoroquinoline-cyclopropylamine intermediate 72.

[0562] Cyclopropylamine intermediate 72 and the previously obtained carboxylic acid intermediate 21 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 70 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 73 was then purified by silica gel column chromatography. The final product 73 is C26.

[0563] (14) Preparation of the compound in Example 27: The overall synthetic route is as follows:

[0564]

[0565] The preparation method for step 1 of the sub-route is as follows:

[0566]

[0567] Weigh 1.64 g (25 mmol, 2.5 eq.) of zinc powder, wash three times with 2 M hydrochloric acid or wash for 5 min with stirring in 0.5 M hydrochloric acid, then wash three times each with anhydrous ethanol and anhydrous diethyl ether. Dry the powder in a vacuum pump at 140 °C in an oil bath for 2 h with stirring. Place the activated zinc powder in a three-necked flask, add 5 mL of ultra-dry tetrahydrofuran under Ar protection, and add 173 μL (2 mmol, 0.2 eq.) of 1,2-dibromoethane. Reflux and heat to 75 °C. After observing the generation of a large number of bubbles, continue the reaction for 30 min. Allow it to cool naturally to room temperature, then slowly add 255 μL (2 mmol, 0.2 eq.) of trimethylchlorosilane. After observing the generation of a large number of bubbles, continue the reaction for 15 min. Heat to 65 °C, dissolve 1.04 mL of methyl 1-bromocyclopropanecarboxylate (10 mmol, 1.0 eq.) in 15 mL of ultra-dry tetrahydrofuran, and slowly add it dropwise to the reaction system. Maintain the reaction at 65℃ for 4 hours (if a large amount is added, the reaction can be carried out overnight to ensure complete reaction) to obtain intermediate 27-2, which can be directly used in step 2 without post-processing.

[0568] The preparation method for step 2 of the sub-route is as follows:

[0569]

[0570] The synthetic route for preparing intermediate 27-4a is as follows:

[0571]

[0572] Weigh 2080 mg (10 mmol, 1.0 eq.) of 5-bromoquinoline 27-3a, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4a. The synthetic route for preparing intermediate 27-4b is as follows:

[0573]

[0574] Weigh 2080 mg (10 mmol, 1.0 eq.) of 4-bromoquinoline 27-3b, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4b. The synthetic route for the preparation of intermediate 27-4c is as follows:

[0575]

[0576] Weigh 2410 mg (10 mmol, 1.0 eq.) of 4-bromo-8-chloroquinoline 27-3c, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4c.

[0577] The synthetic route for preparing intermediate 27-4d is as follows:

[0578]

[0579] Weigh 2370 mg (10 mmol, 1.0 eq.) of 4-bromo-8-methoxyquinoline 27-3d, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4d.

[0580] The synthetic route for preparing intermediate 27-4e is as follows:

[0581]

[0582] Weigh 2239 mg (10 mmol, 1.0 eq.) of 1-bromo-4-fluoronaphthalene 27-3e, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4e. The synthetic route for the preparation of intermediate 27-4f is as follows:

[0583]

[0584] Weigh 2249 mg (10 mmol, 1.0 eq.) of 5-bromo-8-fluoroquinoline 27-3f, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4f.

[0585] The preparation of intermediate 27-4g follows the synthetic route as follows:

[0586]

[0587] Weigh 2059 mg (10 mmol, 1.0 eq.) of 2-bromonaphthalene 27-3 g, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 27-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 27-4 g.

[0588] The preparation method for step 3 of the sub-route is as follows:

[0589]

[0590]

[0591] The synthetic route for preparing intermediate 27-5a is as follows:

[0592]

[0593] Weigh 2518 mg (11.09 mmol, 1.0 eq) of intermediate 27-4a and dissolve it in a tetrahydrofuran / methanol / water mixture (3:1:1, 65 mL). Add 2484 mg (44.37 mmol, 4.0 eq) of potassium hydroxide. React at 50 °C for 8 h. After confirming complete conversion of the reactants, adjust the pH to 3 with 2N HCl solution. After removing all the solvent by rotary evaporation, add 25 mL of methanol, filter, retain the filtrate, and evaporate the filtrate to dryness to obtain a gray solid. Finally, wash the gray solid repeatedly with DCM / PE to obtain the white solid product 27-5a.

[0594]

[0595] The preparation methods for intermediates 27-5b to 27-5g are the same as those for intermediate 27-5a.

[0596] The preparation route for step 4 of the sub-routines is as follows:

[0597]

[0598] The synthetic route for preparing intermediate 27-6a is as follows:

[0599]

[0600] 426 mg (2 mmol, 1.0 eq) of intermediate 27-5a was weighed and dissolved in 25 mL of ultra-dry toluene. 0.611 mL of triethylamine (4.4 mmol, 2.2 eq) was added, followed by 0.516 mL of DPPA (2.4 mmol, 1.2 eq) under Ar protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, followed by extraction with ethyl acetate. The organic phase was collected and 2.5 mL of HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution was added. The mixture was filtered using a sintered glass funnel and washed repeatedly with petroleum ether and ethyl acetate to obtain a white powder product 27-6a.

[0601]

[0602] The preparation methods for intermediates 27-6b to 27-6g are consistent with those for intermediate 27-6a.

[0603] The preparation route for step 5 of the sub-routines is as follows:

[0604]

[0605] The synthetic route for preparing intermediate 27-9a is as follows:

[0606]

[0607] Weigh 4580 mg of methyl 2-methyl-5-bromobenzoate 27-8 (20 mmol, 1.0 eq), 3740 mg of 3-(dimethylamino)azacyclobutane dihydrochloride 27-7a (22 mmol, 1.1 eq), 370 mg of Pd2(dba)3 (0.4 mmol, 0.02 eq), 760 mg of XPos (1.6 mmol, 0.08 eq), and 26080 mg of cesium carbonate (80 mmol, 4.0 eq) and dissolve them in 100 mL of toluene. Place the solution in a sealed tube and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9a.

[0608] The synthetic route for preparing intermediate 27-9b is as follows:

[0609]

[0610] Weigh 1700 mg of methyl 2-methyl-5-bromobenzoate 27-8 (7.4 mmol, 1.0 eq), 1000 mg of 3-dimethylaminopiperidine 27-7b (7.8 mmol, 1.05 eq), 204 mg of Pd2(dba)3 (0.22 mmol, 0.03 eq), 425 mg of XPhos (0.89 mmol, 0.12 eq), and 9600 mg of cesium carbonate (29.72 mmol, 4.0 eq) and dissolve them in 45 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9b.

[0611] The synthetic route for preparing intermediate 27-9c is as follows:

[0612]

[0613] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10 mmol, 1.0 eq), 1480 mg of thiomorpholine-1,1-dioxide 27-7c (11 mmol, 1.1 eq), 274.5 mg of Pd2(dba)3 (0.3 mmol, 0.03 eq), 572 mg of XPhos (1.2 mmol, 0.12 eq), and 1304 mg of cesium carbonate (40 mmol, 4.0 eq) and dissolve them in 60 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography gives intermediate 27-9c.

[0614] The synthetic route for preparing intermediate 27-9d is as follows:

[0615]

[0616] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10 mmol, 1.0 eq), 2190 mg of 3-aminoquinine ring hydrochloride 27-7d (11 mmol, 1.1 eq), 92 mg (0.1 mmol, 0.01 eq) of Pd2(dba)3, 1431 mg of XPhos (0.3 mmol, 0.03 eq), and 1304 mg of cesium carbonate (40 mmol, 4.0 eq) and dissolve them in 60 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography gives intermediate 27-9d.

[0617] The synthetic route for preparing intermediate 27-9e is as follows:

[0618]

[0619] Weigh 1420 mg of methyl 2-methyl-5-bromobenzoate 27-8 (6.2 mmol, 1.0 eq), 936 mg of 27-7e (11 mmol, 1.1 eq), 56 mg of Pd2(dba)3 (0.1 mmol, 0.01 eq), 118 mg of XPhos (0.4 mmol, 0.04 eq), and 8300 mg of cesium carbonate (40 mmol, 4.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9e.

[0620] The synthetic route for preparing intermediate 27-9f is as follows:

[0621]

[0622] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 1.5 mL of 27-7f (11 mmol, 1.1 eq), 91.5 mg of Pd2(dba)3 (0.1 mmol, 0.01 eq), 190 mg of XPhos (0.4 mmol, 0.04 eq), and 16300 mg of cesium carbonate (50 mmol, 5.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9f. The synthetic route for preparing intermediate 27-9g is as follows:

[0623]

[0624] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 1388 mg of 27-7 g (11 mmol, 1.1 eq), 91.5 mg of Pd2(dba)3 (0.1 mmol, 0.01 eq), 190 mg of XPhos (0.4 mmol, 0.04 eq), and 16300 mg of cesium carbonate (50 mmol, 5.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9 g. The synthetic route for the preparation of intermediate 27-9 h is as follows:

[0625]

[0626] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 2 mL of 27-7h (11 mmol, 1.1 eq), 274 mg of Pd2(dba)3 (0.3 mmol, 0.03 eq), 571 mg of XPhos (1.2 mmol, 0.12 eq), and 13040 mg of cesium carbonate (50 mmol, 5.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9h. The synthetic route for preparing intermediate 27-9i is as follows:

[0627]

[0628] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 2 mL of 27-7i (11 mmol, 1.1 eq), 92 mg (0.1 mmol, 0.01 eq) of Pd2(dba)3, 190 mg of XPhos (0.4 mmol, 0.04 eq), and 13040 mg of cesium carbonate (50 mmol, 5.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9i.

[0629] The synthetic route for preparing intermediate 27-9j is as follows:

[0630]

[0631] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 2350 mg of 27-7j (11 mmol, 1.1 eq), 92 mg of Pd2(dba)3 (0.1 mmol, 0.01 eq), 190 mg of XPhos (0.4 mmol, 0.04 eq), and 13040 mg of cesium carbonate (50 mmol, 5.0 eq) and dissolve them in 50 mL of toluene. Place the solution in a sealed tube and heat to 110 °C under Ar protection overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 27-9j.

[0632]

[0633] Weigh 2290 mg of methyl 2-methyl-5-bromobenzoate 27-8 (10.0 mmol, 1.0 eq), 2200 mg of 27-7k (11 mmol, 1.1 eq), 92 mg of Pd2(dba)3 (0.1 mmol, 0.01 eq), 190 mg of XPhos (0.4 mmol, 0.04 eq), and 13040 mg of cesium carbonate (50 mmol, 5.0 eq), dissolve them in 50 mL of toluene, place the solution in a sealed tube, heat to 110 °C under Ar protection, and react overnight. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the intermediate product 27-9k. The preparation method in step 6 of the fractional route is as follows:

[0634]

[0635] The synthetic route for preparing intermediate 27-10a is as follows:

[0636]

[0637] Weigh 10 mmol (1 eq.) of intermediate 27-9a and dissolve it in a mixture of 25 mL methanol and 25 mL water. Add potassium hydroxide (40 mmol (4 eq.) and heat and stir overnight at 60 °C. After the reaction is complete, add excess hydrochloric acid to adjust the pH of the reaction solution to acidic (do not make it too acidic, as this may cause ring-opening of the product). Completely evaporate the solvent (after the first evaporation, add small amounts of methanol repeatedly to remove as much water as possible). Add methanol, stir, and filter. If the filtered solid still contains a significant amount of product, dissolve the solid in methanol repeatedly and filter until the solid is completely insoluble (no fluorescence is detected by UV light on a plate). Collect and concentrate the filtrate, then recrystallize it from dichloromethane to obtain intermediate 27-10a.

[0638]

[0639] The preparation methods for intermediates 27-10b to 27-10l are consistent with those for intermediate 27-10a.

[0640] The final product is prepared in step 7 of the following route:

[0641]

[0642] Preparation of Compound 27 in Example: The synthetic route is as follows:

[0643]

[0644] Weigh 184 mg of amine intermediate 27-6a (1 mmol, 1.0 eq), 234 mg of carboxylic acid intermediate 27-10a (1 mmol, 1.0 eq), and 869 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product FS41, which is the compound of Example 27.

[0645] (15) Preparation of the compound in Example 28, the synthetic route is as follows:

[0646]

[0647] Weigh 30 mg of amine intermediate 28-6b (0.154 mmol, 1.0 eq), 36 mg of carboxylic acid intermediate 28-10a (0.154 mmol, 1.0 eq), and 133 μL of DIPEA (0.77 mmol, 5.0 eq) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 87 mg of HATU (0.231 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS42, which is the compound of Example 28.

[0648] (16) Preparation of the compound in Example 29, the synthetic route is as follows:

[0649]

[0650] Weigh 132 mg of amine intermediate 29-6c (0.58 mmol, 1.0 eq), 135 mg of carboxylic acid intermediate 29-10a (0.58 mmol, 1.0 eq), and 504 μL of DIPEA (2.9 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 330 mg of HATU (0.87 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS43, which is the compound of Example 29.

[0651] (17) Preparation of the compound in Example 30: The synthetic route is as follows:

[0652]

[0653] Weigh 85 mg of amine intermediate 30-6d (0.38 mmol, 1.0 eq), 106 mg of carboxylic acid intermediate 30-10a (0.45 mmol, 1.0 eq), and 330 μL of DIPEA (1.9 mmol, 5.0 eq) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 216 mg of HATU (0.57 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS44, which is the compound of Example 30.

[0654] (18) Preparation of the compound in Example 31, the synthetic route is as follows:

[0655]

[0656] Weigh 118 mg of amine intermediate 31-6e (0.5 mmol, 1.0 eq), 158 mg of carboxylic acid intermediate 31-10b (0.6 mmol, 1.2 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product FS45, which is the compound of Example 31.

[0657] (19) Preparation of the compound in Example 32, the synthetic route is as follows:

[0658]

[0659] Weigh 115 mg of amine intermediate 32-6b (0.5 mmol, 1.0 eq), 157 mg of carboxylic acid intermediate 32-10b (0.6 mmol, 1.2 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants have completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS46, which is the compound of Example 32.

[0660] (20) Preparation of compound 33 in Example 33: The synthetic route is as follows:

[0661]

[0662] Weigh 92 mg of amine intermediate 33-6b (0.5 mmol, 1.0 eq), 161 mg of carboxylic acid intermediate 33-10c (0.6 mmol, 1.2 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants have completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS47, which is the compound of Example 33.

[0663] (21) Preparation of the compound in Example 34: The synthetic route is as follows:

[0664]

[0665] Weigh 92 mg of amine intermediate 34-6b (0.5 mmol, 1.0 eq), 143 mg of carboxylic acid intermediate 34-10d (0.55 mmol, 1.1 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants have completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS48, which is the compound of Example 34.

[0666] (22) Preparation of compound 35 in Example 35: The synthetic route is as follows:

[0667]

[0668] Weigh 100.5 mg of amine intermediate 35-6e (0.5 mmol, 1.0 eq), 134 mg of carboxylic acid intermediate 35-10c (0.5 mmol, 1.0 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product FS50, which is the compound of Example 35.

[0669] (23) Preparation of the compound in Example 36, the synthetic route is as follows:

[0670]

[0671] Weigh 92 mg of amine intermediate 36-6a (0.5 mmol, 1.0 eq), 129 mg of carboxylic acid intermediate 36-10e (0.55 mmol, 1.1 eq), and 434 μL of DIPEA (2.5 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS52, which is the compound of Example 36.

[0672] (24) Preparation of compound 37 in Example 37: The synthetic route is as follows:

[0673]

[0674] Weigh 4240 mg of intermediate 37-8 (20 mmol, 1.0 eq) and 1920 mg of lithium hydroxide (80 mmol, 4.0 eq.) and dissolve them in H2O / MeOH / THF = 1 / 2 / 2 (75 mL). React at 50 °C overnight. After the reaction is complete, remove methanol and tetrahydrofuran by rotary evaporation. Wash the reaction solution with ethyl acetate and water, retaining the aqueous phase. Then add 2N HCl solution to adjust the pH of the aqueous solution to acidic. Wash the reaction solution with EA and water, retaining the organic phase. Dry by rotary evaporation to obtain intermediate 37-11.

[0675] Weigh 276 mg of amine intermediate 37-6a (1.5 mmol, 1.0 eq), 322 mg of carboxylic acid intermediate 37-11 (1.5 mmol, 1.0 eq), and 1304 μL of DIPEA (7.5 mmol, 5.0 eq) and dissolve them in 5 mL of THF. Stir until completely dissolved. Add 855 mg of HATU (2.25 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain intermediate 37-12.

[0676] Weigh 220 mg of intermediate 37-12 (0.58 mmol, 1.0 eq.), add 5.3 mg of Pd2(dba)3 (0.058 mmol, 0.01 eq.), 11 mg of Xphos (0.023 mmol, 0.01 eq.), and 756 mg of cesium carbonate (2.32 mmol, 4.0 eq.) dissolved in 5 mL of toluene. Place the solution in a sealed tube and heat to 110 °C overnight under Ar protection. After the reaction solution cools to room temperature, evaporate the toluene to dryness. Then, wash the reaction solution with 2N HCl solution and ethyl acetate, retaining the aqueous phase. Adjust the pH of the aqueous solution to alkaline using saturated sodium bicarbonate solution, then wash with water and ethyl acetate again, retaining the organic phase. After evaporating the organic phase, column chromatography yields product FS53, which is the compound of Example 37.

[0677] (25) Preparation of compound 38 in Example: The synthetic route is as follows:

[0678]

[0679] Weigh 113 mg of amine intermediate 38-6f (0.56 mmol, 1.4 eq.), 94 mg of carboxylic acid intermediate 38-10e (0.4 mmol, 1.0 eq.), and 139 μL of DIPEA (0.8 mmol, 2.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 182 mg of HATU (0.48 mmol, 1.2 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS54, which is the compound of Example 38.

[0680] (26) Preparation of compound 39 in Example 39: The synthetic route is as follows:

[0681]

[0682] Weigh 101 mg of amine intermediate 39-6f (0.5 mmol, 1.0 eq.), 143 mg of carboxylic acid intermediate 39-10d (0.55 mmol, 1.0 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS55, which is the compound of Example 39.

[0683] (27) Preparation of compound 40, the synthetic route is as follows:

[0684]

[0685] Weigh 101 mg of amine intermediate 40-6f (0.5 mmol, 1.0 eq.), 157 mg of carboxylic acid intermediate 40-10b (0.6 mmol, 1.2 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS56, which is the compound of Example 40.

[0686] (28) Preparation of the compound in Example 41, the synthetic route is as follows:

[0687]

[0688] Weigh 101 mg of amine intermediate 41-6f (0.5 mmol, 1.0 eq.), 148 mg of carboxylic acid intermediate 41-10c (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS57, which is the compound of Example 41.

[0689] (29) Preparation of compound 42 in Example: The synthetic route is as follows:

[0690]

[0691] Weigh 92 mg of amine intermediate 42-6a (0.5 mmol, 1.0 eq.), 144 mg of carboxylic acid intermediate 42-10f (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS59, which is the compound of Example 42.

[0692] (30) Preparation of compound 43 in Example 43: The synthetic route is as follows:

[0693]

[0694] Weigh 92 mg of amine intermediate 43-6b (0.5 mmol, 1.0 eq.), 143 mg of carboxylic acid intermediate 43-10 g (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS60, which is the compound of Example 43.

[0695] (31) Preparation of compound 44 in Example: The synthetic route is as follows:

[0696]

[0697] Weigh 101 mg of amine intermediate 44-6f (0.5 mmol, 1.0 eq.), 144 mg of carboxylic acid intermediate 44-10f (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product F61, which is the compound of Example 44.

[0698] (32) Preparation of compound 45 in Example: The synthetic route is as follows:

[0699]

[0700] Weigh 101 mg of amine intermediate 45-6f (0.5 mmol, 1.0 eq.), 143 mg of carboxylic acid intermediate 45-10 g (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product F62, which is the compound of Example 45.

[0701] (33) Preparation of compound 46 in Example: The synthetic route is as follows:

[0702]

[0703] Weigh 184 mg of amine intermediate 46-6a (1.0 mmol, 1.0 eq.), 572 mg of carboxylic acid intermediate 46-10 g (1.1 mmol, 1.1 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product F63, which is the compound of Example 46.

[0704] (34) Preparation of compound 47 in Example: The synthetic route is as follows:

[0705]

[0706] Weigh 92 mg of amine intermediate 47-6 g (0.5 mmol, 1.0 eq.), 129 mg of carboxylic acid intermediate 47-10a (0.55 mmol, 1.1 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS64, which is the compound of Example 47.

[0707] (35) Preparation of compound 48 in Example: The synthetic route is as follows:

[0708]

[0709] Weigh 201 mg of amine intermediate 48-6e (1.0 mmol, 1.0 eq.), 288 mg of carboxylic acid intermediate 48-10f (1.1 mmol, 1.1 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS65, which is the compound of Example 48.

[0710] (36) Preparation of compound 49 in Example: The synthetic route is as follows:

[0711]

[0712] Weigh 201 mg of amine intermediate 49-6e (1.0 mmol, 1.0 eq.), 286 mg of carboxylic acid intermediate 49-10 g (1.1 mmol, 1.1 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS66, which is the compound of Example 49.

[0713] (37) Preparation of the compound in Example 50: The synthetic route is as follows:

[0714]

[0715] Weigh 201 mg of amine intermediate 50-6e (1.0 mmol, 1.0 eq.), 321 mg of carboxylic acid intermediate 50-10h (1.0 mmol, 1.0 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product FS69-Boc. Dissolve the crude product in 2 mL of DCM and stir until completely dissolved. Add CF3COOH (10 mmol, 10 eq.) and stir at room temperature for 2 h. After the reaction is complete, wash the reaction solution with DCM / H2O, retaining the aqueous phase. Adjust the pH of the aqueous phase to alkaline, extract with ethyl acetate, retain the organic phase, and purify by column chromatography to obtain the final product FS69, which is the compound of Example 50.

[0716] (38) Preparation of the compound in Example 51, the synthetic route is as follows:

[0717]

[0718] Weigh 202 mg of amine intermediate 51-6f (1.0 mmol, 1.0 eq.), 372 mg of carboxylic acid intermediate 51-10i (1.5 mmol, 1.5 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS70, which is the compound of Example 51.

[0719] (39) Preparation of the compound in Example 52, the synthetic route is as follows:

[0720]

[0721] Weigh 202 mg of amine intermediate 52-6f (1.0 mmol, 1.0 eq.), 522 mg of carboxylic acid intermediate 52-10j (1.5 mmol, 1.5 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product FS71-Boc. Dissolve the crude product in 2 mL of DCM and stir until completely dissolved. Add CF3COOH (10 mmol, 10 eq.) and stir at room temperature for 2 h. After the reaction is complete, wash the reaction solution with DCM / H2O, retaining the aqueous phase. Adjust the pH of the aqueous phase to alkaline, extract with ethyl acetate, retain the organic phase, and purify by column chromatography to obtain the final product FS71, which is the compound of Example 52.

[0722] (40) Preparation of compound 53 in Example 53: The synthetic route is as follows:

[0723]

[0724] Weigh 303 mg of amine intermediate 53-6f (1.5 mmol, 1.0 eq.), 481 mg of carboxylic acid intermediate 53-10h (1.5 mmol, 1.0 eq.), and 1303 μL of DIPEA (7.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 855 mg of HATU (2.25 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product FS72-Boc. Dissolve the crude product in 2 mL of DCM and stir until completely dissolved. Add CF3COOH (10 mmol, 10 eq.) and stir at room temperature for 2 h. After the reaction is complete, wash the reaction solution with DCM / H2O, retaining the aqueous phase. Adjust the pH of the aqueous phase to alkaline, extract with ethyl acetate, retain the organic phase, and purify by column chromatography to obtain the final product FS72, which is the compound of Example 53.

[0725] (41) Preparation of the compound in Example 54: The synthetic route is as follows:

[0726]

[0727] Weigh 202 mg of amine intermediate 54-6e (1.0 mmol, 1.0 eq.), 370 mg of carboxylic acid intermediate 54-10l (1.5 mmol, 1.5 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product. Purify by column chromatography to obtain the final product FS74, which is the compound of Example 54.

[0728] (42) Preparation of compound 55, the synthetic route is as follows:

[0729]

[0730] Weigh 201 mg of amine intermediate 55-6e (1.0 mmol, 1.0 eq.), 334 mg of carboxylic acid intermediate 55-10k (1.0 mmol, 1.0 eq.), and 870 μL of DIPEA (5.0 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product FS76-Boc. Dissolve the crude product in 2 mL of DCM and stir until completely dissolved. Add CF3COOH (10 mmol, 10 eq.) and stir at room temperature for 2 h. After the reaction is complete, wash the reaction solution with DCM / H2O, retaining the aqueous phase. Adjust the pH of the aqueous phase to alkaline, extract with ethyl acetate, retain the organic phase, and purify by column chromatography to obtain the final product FS76, which is the compound of Example 55.

[0731] (43) Preparation of compound 56 in Example: The synthetic route is as follows:

[0732]

[0733] Weigh 101 mg of amine intermediate 56-6f (0.5 mmol, 1.0 eq.), 167 mg of carboxylic acid intermediate 56-10k (0.5 mmol, 1.0 eq.), and 434 μL of DIPEA (2.5 mmol, 5.0 eq.) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 285 mg of HATU (0.75 mmol, 1.5 eq.) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retaining the organic phase. Dry the solution by rotary evaporation to obtain the crude product FS77-Boc. Dissolve the crude product in 2 mL of DCM and stir until completely dissolved. Add CF3COOH (10 mmol, 10 eq.) and stir at room temperature for 2 h. After the reaction is complete, wash the reaction solution with DCM / H2O, retaining the aqueous phase. Adjust the pH of the aqueous phase to alkaline, extract with ethyl acetate, retain the organic phase, and purify by column chromatography to obtain the final product FS77, which is the compound of Example 56.

[0734] (44) Preparation of compound 57 in Example: The synthetic route is as follows:

[0735]

[0736] 7-Bromobenzo[b]thiophene (57-3, 10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 50 mL of dry DMF. Potassium ferrocyanide (5 mmol, 0.5 eq), Pd₂(dba)₃ (0.5 mmol, 0.05 eq), and cesium carbonate (15 mmol, 1.5 eq) were then added. The mixture was heated to 120 °C under argon protection and stirred for 12 hours. After the reaction was complete, 50 mL of water was added to the reaction system, followed by extraction with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain benzo[b]thiophene-7-carboxynitrile intermediate 57-4.

[0737] Benzo[b]thiophene-7-carboxynitrile (2, 10 mmol, 1.0 eq) was placed in a round-bottom flask, and 10 mL of dry tetrahydrofuran was added as a solvent. Tetraisopropyl titanate (10 mmol, 1.1 eq) was then added, and the reaction mixture was cooled to -78 °C. Ethyl Grignard reagent (20 mmol, 2.0 eq) was then slowly added dropwise. After the addition was complete, the reaction mixture was heated to room temperature and reacted for 1.5 hours. Boron trifluoride diethyl ether (20 mmol, 2.0 eq) was then added dropwise, and the mixture was stirred at room temperature for 3 hours after the addition was complete. After the reaction was complete, 20 mL of 2N hydrochloric acid was added dropwise, and the mixture was stirred and quenched for 20 minutes. Excess saturated sodium hydroxide solution was then added. The mixture was extracted with ethyl acetate, and the organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 57-5.

[0738] Intermediate 57-5 and the previously obtained carboxylic acid intermediate 57-6 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 57-7 was then purified by silica gel column chromatography. The final product 57-7 is the compound of Example 57.

[0739] (45) Preparation of compound 58 in Example: The synthetic route is as follows:

[0740]

[0741] 5-Bromo-8-trifluoromethoxyquinoline (58-8, 10 mmol, 1.0 eq), Pd2(dba)3 (0.1 mmol, 0.01 eq), and QPhos 71 mg (0.1 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 20 mL of anhydrous tetrahydrofuran. Under argon protection, intermediate 58-2 Reformatsky Reagent (20 mmol, 1N, 2.0 eq), dissolved in 20 mL of tetrahydrofuran, was added. The mixture was stirred at room temperature for 30 min. After confirming complete conversion, the solvent was evaporated, and the product was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the product intermediate 58-9.

[0742] Intermediate 58-9 (10 mmol, 1.0 eq) was dissolved in a tetrahydrofuran / methanol / water mixture (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by vortexing, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After vortexing to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 58-10.

[0743] Intermediate 58-10 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, and triethylamine (4.4 mmol, 2.2 eq) was added. DPPA (2.4 mmol, 1.2 eq) was then added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 58-11.

[0744] Intermediate 58-11 and the previously obtained carboxylic acid intermediate 58-6 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 58-12 was then purified by silica gel column chromatography. The final product 58-12 is the compound of Example 58.

[0745] (46) Preparation of compound 59 in Example: The synthetic route is as follows:

[0746]

[0747] The previously obtained product 59-13 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 h. After confirming complete conversion, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for another 4 h. The solvent was evaporated, and the product 59-14 was purified by column chromatography. The final product 59-14 is the compound of Example 59.

[0748] (47) Preparation of the compound in Example 60: The synthetic route is as follows:

[0749]

[0750] The previously obtained product 60-15 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 h. After confirming complete conversion, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for another 4 h. The solvent was evaporated, and the mixture was purified by column chromatography to obtain intermediate product 60-16.

[0751] Intermediate 60-16 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise with stirring in an ice bath, followed by DMF (1.5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 h. After confirming complete conversion, saturated sodium bicarbonate solution was added dropwise in an ice bath to adjust the pH to 8. Extraction was performed, and the organic phase was washed twice with water and once with saturated brine. The organic phase was collected, evaporated to dryness, and intermediate 60-17 was obtained without further purification.

[0752] Intermediate product 60-17 (3 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of anhydrous methanol, and sodium methoxide (5 M, 30 mmol, 10 e.q.) was added. The mixture was refluxed at 70 °C and stirred for 12 h. After confirming complete conversion, the solvent was evaporated to dryness, and the mixture was extracted with ethyl acetate and saturated ammonium chloride solution. The organic phase was washed once with saturated brine, collected, and evaporated to dryness. Intermediate product 60-18 was obtained without further purification.

[0753] Intermediate product 60-18 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by rotary evaporation, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After rotary evaporation to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 60-19.

[0754] Intermediate 60-19 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, and triethylamine (4.4 mmol, 2.2 eq) was added. DPPA (2.4 mmol, 1.2 eq) was then added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 60-20.

[0755] Intermediate 60-20 and the previously obtained carboxylic acid intermediate 60-6 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 60-21 was then purified by silica gel column chromatography. The final product 60-21 is the compound of Example 60.

[0756] (48) Preparation of the compound in Example 61, the synthetic route is as follows:

[0757]

[0758] 4-Bromo-2,8-bis(trifluoromethyl)quinoline (61-22, 10 mmol, 1.0 eq), Pd2(dba)3 (0.1 mmol, 0.01 eq), and QPhos 71 mg (0.1 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 20 mL of anhydrous tetrahydrofuran. Under argon protection, intermediate 61-2 Reformatsky Reagent (20 mmol, 1N, 2.0 eq), dissolved in 20 mL of tetrahydrofuran, was added. The mixture was stirred at room temperature for 30 min. After confirming complete conversion, the solvent was evaporated, and the product was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the product intermediate 61-23.

[0759] Intermediate 61-23 (10 mmol, 1.0 eq) was dissolved in a tetrahydrofuran / methanol / water mixture (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by rotary evaporation, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After rotary evaporation to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 61-24.

[0760] Intermediate 61-24 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, and triethylamine (4.4 mmol, 2.2 eq) was added. DPPA (2.4 mmol, 1.2 eq) was then added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 61-25.

[0761] Intermediate 61-25 and the previously obtained carboxylic acid intermediate 61-6 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 61-26 was then purified by silica gel column chromatography. The final product 61-26 is the compound of Example 61.

[0762] (49) Preparation of compound 62 in Example: The synthetic route is as follows:

[0763]

[0764] Intermediate 62-16 (4.4 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 40 mL of DCM. Methyl trifluoromethanesulfonate (4.4 mmol, 1.0 eq) was added dropwise with stirring at room temperature for 1 h. The solvent was evaporated, and the solution was dissolved in 20 mL of anhydrous acetonitrile. The mixture was stirred in an acetone bath on dry ice, and difluorobromomethyltrimethylsilane (19.8 mmol, 4.5 eq) and triphenylphosphine (13.2 mmol, 3.0 eq) were added sequentially. HMPA was then added dropwise, and the mixture was stirred for 3 h. The ice bath was removed, and the mixture was stirred at room temperature for 15 min. The mixture was stirred again in an acetone bath on dry ice, and triethylamine (22.0 mmol, 5.0 eq) and 20 mL of water were added sequentially. The ice bath was removed, and the mixture was stirred at room temperature for 12 h. After confirming complete conversion, the mixture was extracted with water and MTBE, washed once with saturated brine, and the organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the product intermediate 62-27.

[0765] Intermediate 62-27 (10 mmol, 1.0 eq) was dissolved in a tetrahydrofuran / methanol / water mixture (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by rotary evaporation, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After rotary evaporation to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain the white solid product 62-28.

[0766] Intermediate 62-28 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, and triethylamine (4.4 mmol, 2.2 eq) was added. DPPA (2.4 mmol, 1.2 eq) was then added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 62-29.

[0767] Intermediate 62-29 was added to DMF solvent in a 1:1 equivalent ratio with the previously obtained carboxylic acid intermediate 6. HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 50 °C for 12 h. The reaction mixture was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The resulting product was purified by silica gel column chromatography to obtain product 62-30. The final product 62-30 is the compound of Example 62.

[0768] (50) Preparation of compound 63 in Example: The synthetic route is as follows:

[0769]

[0770] Methyl 2-methyl-5-bromobenzoate 63-36 (10 mmol, 1.0 eq), 4-piperidinone ethylene glycol (10 mmol, 1.0 eq), Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene. The solution was placed in a sealed tube and heated to 110 °C under Ar protection overnight. The mixture was washed with water and ethyl acetate, retaining the organic phase. Column chromatography yielded intermediate 63-37.

[0771] Intermediate product 63-37 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of acetone, and then 10 mL of 5N hydrochloric acid was added. The mixture was heated under reflux at 60 °C with stirring for 4 h, followed by stirring at room temperature overnight. After the reaction was complete, the solvent was evaporated, and the mixture was extracted with water and ethyl acetate, retaining the organic phase. Column chromatography yielded intermediate product 63-38.

[0772] Intermediate 63-38 (3.3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 15 mL of anhydrous methanol. Sodium borohydride (3.7 mmol, 1.1 eq) was added with stirring in an ice bath. The ice bath was then removed, and the mixture was stirred at room temperature for 6 h. After the reaction was complete, the solvent was evaporated, and the mixture was extracted with water and ethyl acetate, retaining the organic phase. Column chromatography yielded intermediate 63-39.

[0773] Intermediate 63-39 (2.0 mmol, 1.0 eq) was dissolved in a tetrahydrofuran / methanol / water mixture (3:1:1, 50 mL), and potassium hydroxide (8 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, the solvent was evaporated to dryness, the pH was adjusted to 1 with 2N HCl solution, and the mixture was extracted with ethyl acetate. The organic phase was washed once with saturated brine, collected, and evaporated to dryness to give a white solid product 63-40.

[0774] Intermediate 63-40 and the previously obtained amine intermediate 63-41 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness. The product 63-42 was then purified by silica gel column chromatography. The final product 63-42 is the compound of Example 63.

[0775] (51) Preparation of compound 64 in Example: The synthetic route is as follows:

[0776]

[0777] The previously obtained product 64-13 (10 mmol, 1.0 eq) and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 h. After confirming complete conversion, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for another 4 h. The solvent was evaporated, and the mixture was purified by column chromatography to obtain intermediate product 64-43.

[0778] Intermediate product 64-43 (10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (12 mmol, 1.2 eq) was added dropwise with stirring in an ice bath, followed by DMF (5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 h. After confirming complete conversion, saturated sodium bicarbonate solution was added dropwise in an ice bath to adjust the pH to 8. Extraction was performed, and the organic phase was washed twice with water and once with saturated brine. The organic phase was collected and evaporated to dryness. Intermediate product 64-44 was obtained without further purification.

[0779] Intermediate product 64-44 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 30 mL of anhydrous methanol, and sodium methoxide (5 M, 100 mmol, 10 e.q.) was added. The mixture was refluxed at 70 °C and stirred for 12 h. After confirming complete conversion, the solvent was evaporated to dryness, and the mixture was extracted with ethyl acetate and saturated ammonium chloride solution. The organic phase was washed once with saturated brine, collected, and evaporated to dryness. Intermediate product 64-45 was obtained without further purification.

[0780] Intermediate product 64-45 (10 mmol, 1.0 eq), 3-(dimethylamino)azacyclobutane (10 mmol, 1.0 eq), Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene. The solution was placed in a sealed tube and heated to 110 °C under Ar protection overnight. The mixture was washed with water and ethyl acetate, retaining the organic phase. Column chromatography yielded product 64-46. The final product 64-46 is Example 64.

[0781] (52) Preparation of compound 65 in Example: The synthetic route is as follows:

[0782]

[0783] Intermediate 65-13 (10 mmol, 1.0 eq), 2-(azacyclobutan-3-yl)prop-2-ol (10 mmol, 1.0 eq), Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene. The solution was placed in a sealed tube and heated to 110 °C under Ar protection for 6 h. The mixture was washed with water and ethyl acetate, retaining the organic phase. Column chromatography yielded product 65-47. The final product 65-47 is the compound of Example 65.

[0784] (53) Preparation of compound 66 in Example: The synthetic route is as follows:

[0785]

[0786] Intermediate 66-13 (10 mmol, 1.0 eq), (3-azabicyclo[3.1.0]-6-hexyl)-tert-butyl carbamate (10 mmol, 1.0 eq), Pd2(dba)3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene. The solution was placed in a sealed tube and heated to 110 °C under Ar protection for 6 h. The mixture was washed with water and ethyl acetate, retaining the organic phase. Column chromatography yielded intermediate 66-48.

[0787] Intermediate product 66-48 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 50 mL of DCM, and then dioxane hydrochloride solution (4.0 M, 40 mmol, 4.0 eq) was added. The mixture was stirred overnight at room temperature. After complete conversion, the solvent was evaporated, and the mixture was extracted with saturated sodium carbonate solution and DCM. The organic phase was dried over anhydrous magnesium sulfate, filtered, and the solvent was evaporated. The DCM / cyclohexane mixture was then slurryed to obtain a yellow solid, which was product 66-49. The final product 66-49 is the compound of Example 66.

[0788] The preparation method for step 2 of the sub-route is as follows:

[0789]

[0790] The synthetic route for preparing intermediate 66-4i is as follows:

[0791]

[0792] Weigh 2260 mg (10 mmol, 1.0 eq.) of 4-bromo-8-fluoroquinoline 66-3i, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 66-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 66-4i.

[0793] The synthetic route for preparing intermediate 66-4j is as follows:

[0794]

[0795] Weigh 2730 mg (10 mmol, 1.0 eq.) of 1-bromo-4-(difluoromethoxy)naphthalene 66-3j, add 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 66-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 66-4j.

[0796] The synthetic route for preparing intermediate 66-4k is as follows:

[0797]

[0798] Weigh 2740 mg (10 mmol, 1.0 eq.) of 5-bromo-8-(difluoromethoxy)quinoline 66-3k, add 391.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba) and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 66-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 66-4k.

[0799] The synthetic route for preparing intermediate 66-4l is as follows:

[0800]

[0801] Weigh 2320 mg (10 mmol, 1.0 eq.) of 4-bromo-1-naphthonitrile 66-3l, add 91.5 mg (0.1 mmol, 0.01 eq.) of Pd2(dba)3 and 71 mg (0.1 mmol, 0.01 eq.) of Qphos, and dissolve in 20 mL of anhydrous tetrahydrofuran. Under Ar protection, add Reformatsky reagent (20 mmol, 1N, 2.0 eq.) of intermediate 66-2 dissolved in 20 mL of tetrahydrofuran. Stir at room temperature for 30 min. After confirming complete conversion, evaporate the solvent, dissolve in ethyl acetate, wash three times with water, wash once with saturated brine, and dry the organic phase with anhydrous sodium sulfate. Purify by column chromatography to obtain intermediate 66-4l.

[0802] The preparation method for step 3 of the sub-route is as follows:

[0803]

[0804] The synthetic route for preparing intermediate 66-5i is as follows:

[0805]

[0806] Weigh 2450 mg (10 mmol, 1.0 eq) of intermediate 66-4i and dissolve it in a tetrahydrofuran / methanol / water mixture (3:1:1, 65 mL). Add 2240 mg (40 mmol, 4.0 eq) of potassium hydroxide. React at 50 °C for 8 h. After confirming complete conversion of the reactants, adjust the pH to 3 with 2N HCl solution. After removing all the solvent by rotary evaporation, add 25 mL of methanol, filter, retain the filtrate, and evaporate the filtrate to dryness to obtain a gray solid. Finally, wash the gray solid repeatedly with DCM / PE to obtain the white solid product 66-5i.

[0807]

[0808] The preparation methods for intermediates 66-5j to 66-5l are consistent with those for intermediate 66-5i.

[0809] The preparation route for step 4 of the sub-routines is as follows:

[0810]

[0811] The synthetic route for preparing intermediate 66-6i is as follows:

[0812]

[0813] 462 mg (2 mmol, 1.0 eq) of intermediate 66-5i was weighed and dissolved in 25 mL of ultra-dry toluene. 0.611 mL of triethylamine (4.4 mmol, 2.2 eq) was added, followed by 0.516 mL of DPPA (2.4 mmol, 1.2 eq) under Ar protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, followed by extraction with ethyl acetate. The organic phase was collected and 2.5 mL of HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution was added. The mixture was filtered using a sintered glass funnel and washed repeatedly with petroleum ether and ethyl acetate to obtain a white powder product, 66-6i.

[0814]

[0815] The preparation methods for intermediates 66-6j to 66-6l are consistent with those for intermediate 66-6a.

[0816] The final product is prepared in step 7 of the following route:

[0817]

[0818] (54) Preparation of compound 67 in Example: The synthetic route is as follows:

[0819]

[0820] Weigh 202 mg of amine intermediate 67-6i (1 mmol, 1.0 eq), 234 mg of carboxylic acid intermediate 67-10 (1 mmol, 1.0 eq), and 890 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product WSZ390, which is the compound of Example 67.

[0821] (55) Preparation of compound 68 in Example: The synthetic route is as follows:

[0822]

[0823] Weigh 249 mg of amine intermediate 68-6j (1 mmol, 1.0 eq), 234 mg of carboxylic acid intermediate 68-10 (1 mmol, 1.0 eq), and 890 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Column purification yields the final product WSZ334, which is the compound of Example 68.

[0824] (56) Preparation of compound 69 in Example: The synthetic route is as follows:

[0825]

[0826] Weigh 250 mg of amine intermediate 69-6k (1 mmol, 1.0 eq), 234 mg of carboxylic acid intermediate 69-10 (1 mmol, 1.0 eq), and 890 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product 3W, which is the compound of Example 69.

[0827] (57) Preparation of the compound in Example 70: The synthetic route is as follows:

[0828]

[0829] Weigh 208 mg of amine intermediate 70-6 l (1 mmol, 1.0 eq), 234 mg of carboxylic acid intermediate 70-10 (1 mmol, 1.0 eq), and 890 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 5 mL of DMF. Stir until completely dissolved. Add 570 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product WSZ372, which is the compound of Example 70.

[0830] (58) Preparation of compounds 73, 74, 75, 76, 77, 78, 81, 82 and 83 in Examples: The synthetic routes are as follows:

[0831] 1. Preparation of intermediate A-5a: The synthetic route is as follows:

[0832]

[0833] 2518 mg (11.09 mmol, 1.0 eq) of intermediate A-4a was weighed and dissolved in a tetrahydrofuran / methanol / water mixture (3:1:1, 65 mL), and 2484 mg (44.37 mmol, 4.0 eq) of potassium hydroxide was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by rotary evaporation, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After rotary evaporation to dryness, a gray solid was obtained. Finally, the gray solid was repeatedly washed with DCM / PE to obtain the white solid product A-5a.

[0834]

[0835] The preparation method for intermediates A-5b to A-5f is the same as that for intermediate A-5a.

[0836] 2. The preparation route for step 4 is as follows:

[0837]

[0838] 3. Preparation of intermediate A-6a: The synthetic route is as follows:

[0839]

[0840] 426 mg (2 mmol, 1.0 eq) of intermediate A-5a was weighed and dissolved in 25 mL of ultra-dry toluene. 0.611 mL of triethylamine (4.4 mmol, 2.2 eq) was added, followed by 0.516 mL of DPPA (2.4 mmol, 1.2 eq) under Ar protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, followed by extraction with ethyl acetate and column chromatography to obtain a white powder product, A-6a.

[0841]

[0842] 4. Preparation of intermediate A-6b: The synthetic route is as follows:

[0843]

[0844] 426 mg (2 mmol, 1.0 eq) of intermediate A-5a was weighed and dissolved in 25 mL of ultra-dry toluene. 0.611 mL of triethylamine (4.4 mmol, 2.2 eq) was added, followed by 0.516 mL of DPPA (2.4 mmol, 1.2 eq) under Ar protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid starting material was converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. 4 M water was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, followed by extraction with ethyl acetate and column chromatography to obtain a gray powder product, A-6b.

[0845] The route from intermediate A-6c to A-6g is consistent with the preparation method of intermediate A-6a.

[0846] 5. The preparation route for step 5 is as follows:

[0847]

[0848] 6. Preparation of intermediate A-9a: The synthetic route is as follows:

[0849]

[0850] Weigh 4580 mg of methyl 2-methyl-5-bromobenzoate A-8 (20 mmol, 1.0 eq), 3740 mg of 3-(dimethylamino)azacyclobutane dihydrochloride A-7a (22 mmol, 1.1 eq), 370 mg (0.4 mmol, 0.02 eq) of Pd2(dba)3, 760 mg of XPos (1.6 mmol, 0.08 eq), and 26080 mg of cesium carbonate (80 mmol, 4.0 eq) and dissolve them in 100 mL of toluene. Place the solution in a sealed tube and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate A-9a.

[0851] 7. The preparation method for sub-routes step 6 is as follows:

[0852]

[0853] 8. Preparation of intermediate A-10a: The synthetic route is as follows:

[0854]

[0855] Weigh 10 mmol (1 eq.) of intermediate A-9a and dissolve it in a mixture of 25 mL methanol and 25 mL water. Add 40 mmol (4 eq.) of potassium hydroxide and heat and stir overnight at 60 °C. After the reaction is complete, add excess hydrochloric acid to adjust the pH of the reaction solution to acidic (do not make it too acidic, as this may cause ring-opening of the product). Completely evaporate the solvent (after the first evaporation, add small amounts of methanol repeatedly to remove as much water as possible). Add methanol, stir, and filter. If the filtered solid still contains a significant amount of product, dissolve the solid in methanol repeatedly and filter until the solid is completely insoluble (no fluorescence is detected by UV light on a plate). Collect and concentrate the filtrate, then recrystallize it from dichloromethane to obtain intermediate A-10a.

[0856] 9. The preparation method for the final product in step 7 is as follows:

[0857]

[0858] 10. Preparation of compound 74 in Example: The synthetic route is as follows:

[0859]

[0860] Weigh 214 mg of amine intermediate 74-6b (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 74-10a (1 mmol, 1.0 eq), and 1008 μL of DIPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-96, which is the compound of Example 74.

[0861] 11. Preparation of compound 73 in Example: The synthetic route is as follows:

[0862]

[0863] Weigh 200 mg of amine intermediate 73-6 g (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 73-10a (1 mmol, 1.0 eq), and 1008 μL of LDPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-95, which is the compound of Example 73.

[0864] 12. Preparation of compound 75, the synthetic route is as follows:

[0865]

[0866] Weigh 198 mg of amine intermediate 75-6c (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 75-10a (1 mmol, 1.0 eq), and 1008 μL of LDPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-118, which is the compound of Example 75.

[0867] 13. Preparation of compound 76 in Example: The synthetic route is as follows:

[0868]

[0869] Weigh 214 mg of amine intermediate 76-6d (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 76-10a (1 mmol, 1.0 eq), and 1008 μL of LDPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-120, which is the compound of Example 76.

[0870] 14. Preparation of compound 77 in Example: The synthetic route is as follows:

[0871]

[0872] Weigh 191 mg of amine intermediate 77-6e (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 77-10a (1 mmol, 1.0 eq), and 1008 μL of LDPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-130, which is Example 77.

[0873] 15. Preparation of compound 78 in Example: The synthetic route is as follows:

[0874]

[0875] Weigh 177 mg of amine intermediate 78-6f (1 mmol, 1.0 eq), 270 mg of carboxylic acid intermediate 78-10a (1 mmol, 1.0 eq), and 1008 μL of LDPEA (5 mmol, 5.0 eq) and dissolve them in 10 mL of DMF. Stir until completely dissolved. Add 668 mg of HATU (1.5 mmol, 1.5 eq) and react at room temperature for 3 h. After the reactants are completely converted, wash the reaction solution with water and ethyl acetate to remove DMF, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product XCH-136, which is the compound of Example 78.

[0876] The preparation method for step 8 of the sub-route is as follows:

[0877]

[0878] 2-Methyl-5-bromobenzoic acid and the previously obtained three-membered cyclic amine intermediate 78-6a were added to DMF solvent in a 1:1 ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 25 °C for 3 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The solution was then purified by silica gel column chromatography to obtain intermediate 78-11.

[0879] The final product is prepared via step 9 of the following route:

[0880]

[0881] 16. Preparation of the intermediate compound XCH-200-Boc from Example 81: The synthetic route is as follows:

[0882]

[0883] Weigh 399 mg 81-11 (1 mmol, 1.0 eq), 222 mg 3-(dimethylamino)azacyclobutane dihydrochloride 81-7a (1 mmol, 1.1 eq), 23 mg (0.025 mmol, 0.02 eq) Pd2(dba)3, 24 mg XPhos (0.05 mmol, 0.04 eq), and 1220 mg cesium carbonate (80 mmol, 3.0 eq), dissolve in 10 mL toluene, place in a sealed tube, and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the intermediate product XCH-200-Boc.

[0884] 17. Preparation of compound 81 in Example: The synthetic route is as follows:

[0885]

[0886] Weigh 252 mg of XCH-200-Boc (0.5 mmol, 1.0 eq), dissolve it in 3 mL of toluene, add 1 mL of trifluoroacetic acid, and place the solution in a flask with stirring at room temperature overnight. Extract with saturated sodium bicarbonate aqueous solution and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-200, which is the compound of Example 81.

[0887] 18. Preparation of intermediate compound XCH-205-Boc in Example 82: The synthetic route is as follows:

[0888]

[0889] Weigh 399 mg 82-11 (1 mmol, 1.0 eq), 244 mg 3-(dimethylamino)azacyclobutane dihydrochloride 82-7b (1 mmol, 1.1 eq), 23 mg (0.025 mmol, 0.02 eq) Pd2(dba)3, 24 mg XPhos (0.05 mmol, 0.04 eq), and 1220 mg cesium carbonate (80 mmol, 3.0 eq) and dissolve them in 10 mL of toluene. Place the solution in a sealed tube and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the intermediate product XCH-205-Boc.

[0890] 19. Preparation of compound 82 in Example: The synthetic route is as follows:

[0891]

[0892] Weigh 252 mg of XCH-205-Boc (0.5 mmol, 1.0 eq), dissolve it in 3 mL of toluene, add 1 mL of trifluoroacetic acid, and place the solution in a flask with stirring at room temperature overnight. Extract with saturated sodium bicarbonate aqueous solution and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-205, which is the compound of Example 82.

[0893] 20. Preparation of compound 83 in Example: The synthetic route is as follows:

[0894]

[0895] Weigh 399 mg of 83-11 (1 mmol, 1.0 eq), 244 mg of 3-(dimethylamino)azacyclobutane dihydrochloride 83-7c (1 mmol, 1.1 eq), 23 mg (0.025 mmol, 0.02 eq) of Pd2(dba)3, 24 mg of XPhos (0.05 mmol, 0.04 eq), and 1220 mg of cesium carbonate (80 mmol, 3.0 eq), dissolve them in 10 mL of toluene, place the solution in a sealed tube, and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-208, which is the compound of Example 83.

[0896] (59) Preparation of compounds in Examples 79 and 80: The synthetic routes are as follows:

[0897] The preparation of compound 79 in Example 79 was carried out via the following synthetic route:

[0898]

[0899] Weigh 183 mg 79-1x (1 mmol, 1.0 eq), 122 mg 79-2c (1 mmol, 1.0 eq), 33 μL (1 mmol, 1 eq) AcOH, and 635 mg NaBH(OAc)3 (3 mmol, 3.0 eq) and dissolve them in 10 mL THF. Place the solution in a flask and stir overnight under Ar protection. Wash with saturated sodium bicarbonate aqueous solution and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-193, which is the compound of Example 79. NMR mass spectrometry confirms the presence of a Schiff base product.

[0900] The preparation of compound 80 in Example 80 was carried out via the following synthetic route:

[0901]

[0902] Weigh 385 mg of compound XCH-193 (1 mmol, 1.0 eq), 244 mg of 3-(dimethylamino)azacyclobutane dihydrochloride (1 mmol, 1.1 eq), 23 mg (0.025 mmol, 0.02 eq) of Pd2(dba)3, 24 mg of XPhos (0.05 mmol, 0.04 eq), and 1220 mg of cesium carbonate (80 mmol, 3.0 eq) and dissolve them in 10 mL of toluene. Place the solution in a sealed tube and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-199, which is compound XCH-199 of Example 80.

[0903] (60) Preparation of compounds 84, 85 and 86 in Examples: The synthetic routes are as follows:

[0904]

[0905] The preparation route for step 1 is as follows:

[0906]

[0907] The synthetic route for preparing intermediate B-2a is as follows:

[0908]

[0909] 1000 mg (5 mmol, 1.0 eq) of intermediate B-1a was weighed and dissolved in 25 mL of dichloromethane. 0.313 mL of PBr3 (3.3 mmol, 0.6 eq) was added under ice bath conditions. The mixture was stirred at room temperature for 30 min, and the pH was adjusted to alkaline by adding saturated sodium bicarbonate aqueous solution. Ethyl acetate was then added for extraction, followed by column chromatography to obtain product B-2a.

[0910] The preparation of intermediate B-2b is the same as that of intermediate B-2a.

[0911] The preparation route for step 2 is as follows:

[0912]

[0913] The preparation of compound 84 in Example 84 was carried out via the following synthetic route:

[0914]

[0915] Weigh 271 mg of 84-2 (1 mmol, 1.0 eq), 190 mg of the three-membered cyclic amine intermediate (1 mmol, 1.0 eq), and 195 mg of K₂CO₃ (1.5 mmol, 1.5 eq), dissolve them in 10 mL of THF, place the solution in a flask, and stir overnight at room temperature under Ar protection. Wash with saturated sodium chloride aqueous solution and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-210, which is the compound of Example 84.

[0916] The synthetic route for preparing intermediate 84-3b is as follows:

[0917]

[0918] Weigh 271 mg of 84-2b (1 mmol, 1.0 eq), 190 mg of the three-membered cyclic amine intermediate (1 mmol, 1.0 eq), and 195 mg of K₂CO₃ (1.5 mmol, 1.5 eq), dissolve them in 10 mL of THF, place the solution in a flask, and stir overnight at room temperature under Ar protection. Wash with saturated sodium chloride aqueous solution and ethyl acetate, retaining the organic phase. Column chromatography yields intermediate 84-3b.

[0919] Preparation of Compound 86 in Example: The synthetic route is as follows:

[0920]

[0921] Weigh 351 mg 84-3b (1 mmol, 1.0 eq), 109 mg ammonium chloride (2 mmol, 2.0 eq), and 558 mg Fe (10 mmol, 10.0 eq) and dissolve them in a mixed solvent of 5 mL THF: 5 mL EtOH: 2.5 mL H2O. Place the solution in a flask and stir at 80 °C for 5 h under Ar protection. Filter with diatomaceous earth, extract with ethyl acetate, and retain the organic phase. Column chromatography yields the final product XCH-224, which is the compound of Example 86.

[0922] Preparation of compound 85 in Example: The synthetic route is as follows:

[0923]

[0924] Weigh 385 mg of compound 84 (XCH-210) from Example 84 (1 mmol, 1.0 eq), 244 mg of 3-(dimethylamino)azacyclobutane dihydrochloride (1 mmol, 1.1 eq), 23 mg (0.025 mmol, 0.02 eq) of Pd2(dba)3, 24 mg of XPhos (0.05 mmol, 0.04 eq), and 1220 mg of cesium carbonate (80 mmol, 3.0 eq), dissolve them in 10 mL of toluene, place the solution in a sealed tube, and heat to 110 °C overnight under Ar protection. Wash with water and ethyl acetate, retaining the organic phase. Column chromatography yields the final product XCH-211, which is compound 85 of Example 85.

[0925] (61) Preparation of compound C87 in Example: The synthetic route is as follows:

[0926]

[0927] 2-Methyl-5-nitrobenzoic acid and the three-membered cyclic amine intermediate 87-1 were added to DMF solvent in a 1:1 ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 25 °C for 3 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The solution was then purified by silica gel column chromatography to obtain intermediate 87-2.

[0928] Weigh 365 mg 87-2 (1 mmol, 1.0 eq), 109 mg ammonium chloride (2 mmol, 2.0 eq), and 558 mg Fe (10 mmol, 10.0 eq) and dissolve them in a mixed solvent of 5 mL THF: 5 mL EtOH: 2.5 mL H2O. Place the solution in a flask and stir at 80 °C for 5 h under Ar protection. Filter with diatomaceous earth, extract with ethyl acetate, and retain the organic phase. Column chromatography yields the final product XCH-226, which is the compound of Example 87.

[0929] (62) Preparation of compound 88 in Example: The synthetic route is as follows:

[0930]

[0931] Weigh 86 mg of amine intermediate 88-6-lk401 (0.38 mmol, 1.0 eq), 106 mg of carboxylic acid intermediate 88-10a (0.45 mmol, 1.0 eq), and 467 μL of DIPEA (1.9 mmol, 5.0 eq) and dissolve them in 3 mL of THF. Stir until completely dissolved. Add 216 mg of HATU (0.57 mmol, 1.5 eq) and react at room temperature for 4 h. After the reactants are completely converted, remove the THF by rotary evaporation. Then wash the reaction solution with water and ethyl acetate, retain the organic phase, and evaporate to dryness to obtain the crude product. Purify by column chromatography to obtain the final product lk401, which is the compound of Example 88.

[0932] (63) Preparation of compound 89 in Example: The synthetic route is as follows:

[0933]

[0934] 5-Bromo-8-fluoroquinoline 89-3 (40 mmol, 1.0 eq), Pd2(dba)3 (0.4 mmol, 0.01 eq), and QPhos 366.3 mg (0.4 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 80 mL of anhydrous tetrahydrofuran. Under argon protection, the intermediate 2Reformatsky Reagent (80 mmol, 1N, 2.0 eq), dissolved in 20 mL of tetrahydrofuran, was added. The mixture was stirred at room temperature for 30 min. After confirming complete conversion, the solvent was evaporated, and the product was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the product, yielding intermediate 89-4.

[0935] The previously obtained intermediate 89-4 (10 mmol, 1.0 eq) and m-CPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. The mixture was stirred at room temperature for 12 h. After confirming complete conversion, triphenylphosphine (5 mmol, 0.5 eq) was added, and the mixture was stirred at room temperature for another 4 h. The solvent was evaporated, and the product was purified by column chromatography to obtain intermediate 89-5.

[0936] Intermediate product 89-5 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise with stirring in an ice bath, followed by DMF (1.5 mmol, 0.5 eq). The mixture was stirred at room temperature for 12 h. After confirming complete conversion, saturated sodium bicarbonate solution was added dropwise in an ice bath to adjust the pH to 8. The solution was extracted with ethyl acetate, and the organic phase was washed twice with water and once with saturated brine. The organic phase was collected, evaporated to dryness, and intermediate product 89-6 was obtained without further purification.

[0937] Intermediate 89-6 (3 mmol, 1.0 eq), methylboric acid (6.6 mmol, 2.2 eq), PdCl2 (dppf) (0.3 mmol, 0.1 eq), and K2CO3 (9 mmol, 3.0 eq) were placed in a round-bottom flask and dissolved in 10 mL of toluene. The mixture was heated and stirred at 85 °C for 12 h. After confirming complete conversion, the solvent was evaporated, and the mixture was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was then dried over anhydrous sodium sulfate. Column chromatography was used to purify the product intermediate 89-7.

[0938] Intermediate product 89-7 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by rotary evaporation, 25 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After rotary evaporation to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 89-8.

[0939] Intermediate 89-8 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, and triethylamine (4.4 mmol, 2.2 eq) was added. DPPA (2.4 mmol, 1.2 eq) was then added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 4 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 89-9.

[0940] Intermediate 89-9 and the previously obtained carboxylic acid intermediate 89-10 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The final product XLQ-1170 was obtained by silica gel column chromatography, which is the compound of Example 89.

[0941] (64) Preparation of the compound in Example 90: The synthetic route is as follows:

[0942]

[0943] 3-(dimethylamino)azacyclobutane dihydrochloride 90-11 (6 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 2 mL of 2M hydrochloric acid. The mixture was stirred at room temperature. Sodium nitrite (7.2 mmol, 1.2 eq) was dissolved in 1 mL of water and added dropwise to the reaction mixture. The mixture was stirred at room temperature for 1.5 h. After confirming complete conversion, the mixture was extracted three times with ethyl acetate and washed once with saturated brine. The organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the intermediate product 90-12.

[0944] Intermediate 90-12 (3 mmol, 1.0 eq) and sodium methoxide (3 mmol, 3.0 eq) were placed in a round-bottom flask. Under argon protection, 1.5 mL of heavy water was slowly added dropwise. The mixture was heated and stirred at 80 °C for 10 h. After confirming complete conversion, the mixture was extracted three times with ethyl acetate and washed once with saturated brine. The organic phase was then dried over anhydrous sodium sulfate. Column chromatography was used to purify the product, intermediate 90-13.

[0945] Intermediate 90-13 (2.59 mmol, 1.0 eq) and sodium methoxide (7.77 mmol, 3.0 eq) were placed in a round-bottom flask. Under argon protection, 2 mL of heavy water and 2 mL of deuterated ethanol (C2H5OD) were slowly added dropwise. The mixture was then heated to 70 °C and reacted for 24 hours. Heating was stopped, and the mixture was allowed to cool to room temperature. Al-Ni alloy (810 mg) was added in portions, and the mixture was stirred overnight at room temperature. The solid metal was removed by filtration, and the filtrate was collected, extracted with ethyl acetate, washed once with saturated brine, and the organic phase was dried over anhydrous sodium sulfate. The drying agent was removed by filtration, and the organic phase was acidified with a 4 M HCl solution of dioxane. The organic solvent was evaporated to dryness to obtain solid product 90-14.

[0946] Intermediate 90-14 (3.84 mmol, 1.1 eq), methyl 2-methyl-5-bromobenzoate 90-15 (3.49 mmol, 1.0 eq), Pd2(dba)3 (0.035 mmol, 0.01 eq), XPhos (0.14 mmol, 0.04 eq), and cesium carbonate (13.96 mmol, 4.0 eq) were dissolved in 20 mL of toluene. The solution was placed in a sealed tube and heated to 110 °C under Ar protection overnight. The mixture was washed with water and ethyl acetate, retaining the organic phase. Column chromatography yielded intermediate 90-16.

[0947] Weigh 0.44 mmol (1 e.g.) of intermediate 90-16 and dissolve it in a mixture of 1.1 mL methanol and 1.1 mL water. Add potassium hydroxide (1.76 mmol, 4 e.g.) and heat and stir overnight at 60 °C. After the reaction is complete, add excess hydrochloric acid to adjust the pH of the reaction solution to acidic (do not make it too acidic, as this may cause ring-opening of the product). Rotate the solvent completely to dryness, dissolve the product in ethyl acetate, dry the organic phase with anhydrous sodium sulfate, and purify by column chromatography to obtain intermediate 90-17.

[0948] Intermediate 90-17 and the previously obtained cyclopropylamine intermediate 90-18 were added to DMF solvent in a 1:1 equivalent ratio, along with HATU (1.5 eq) and DIPEA (2.0 eq). The mixture was reacted at 50°C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The final product XLQ-1196 was obtained by silica gel column chromatography, which is the compound of Example 90.

[0949] (65) Preparation of the compound in Example 91, the synthetic route is as follows:

[0950]

[0951] 4-Bromoindole 91-19 (10 mmol, 1.0 eq), dimethyl carbonate (29 mmol, 2.9 eq), and potassium carbonate (7 mmol, 0.7 eq) were placed in a round-bottom flask and dissolved in 13 mL of DMF. The mixture was heated and stirred at 140 °C for 4 h. After confirming complete conversion, the solvent was evaporated, and the product was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was then dried over anhydrous sodium sulfate. Column chromatography was used to purify the product, yielding intermediate 91-20.

[0952] Intermediate 91-20 (2 mmol, 1.0 eq), Pd2(dba)3 (0.02 mmol, 0.01 eq), and QPhos1 4.1 mg (0.02 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 2 mL of anhydrous tetrahydrofuran. Under argon protection, intermediate 91-2 Reformatsky Reagent (4 mmol, 1N, 2.0 eq) dissolved in 6 mL of tetrahydrofuran was added. The mixture was stirred at room temperature for 30 min. After confirming complete conversion, the solvent was evaporated, and the product was dissolved in ethyl acetate. The solution was washed three times with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate. Column chromatography was used to purify the product, intermediate 91-21.

[0953] Intermediate product 91-21 (1.88 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 2.16 mL), and potassium hydroxide (7.52 mmol, 4.0 eq) was added. The reaction was carried out at 50 °C for 8 h. After confirming that the reactants had been completely converted, 2N HCl solution was added to adjust the pH to 3. After removing all the solvent by vortexing, 15 mL of methanol was added, the mixture was filtered, and the filtrate was retained. After vortexing to dryness, a pale yellow solid was obtained. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 91-22.

[0954] Intermediate 91-22 (1.49 mmol, 1.0 eq) was dissolved in 6.4 mL of ultra-dry toluene, and triethylamine (3.27 mmol, 2.2 eq) was added. DPPA (1.64 mmol, 1.2 eq) was added under argon protection. The mixture was stirred at room temperature for 30 min until all carboxylic acid precursors were converted to acyl azides. The mixture was then heated to 75 °C and reacted for 8 h until most of the acyl azides were converted to isocyanates. Excess hydrochloric acid (2 M aqueous solution, >4.0 eq) was added, and the mixture was cooled to 60 °C and reacted overnight. The pH was adjusted to alkaline with sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. The organic phase was collected, evaporated to dryness, and separated by silica gel column chromatography to obtain intermediate 91-23.

[0955] Intermediate 91-23 and the previously obtained carboxylic acid intermediate 10 were added to DMF solvent in a 1:1 equivalent ratio. HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 50 °C for 12 h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was dried by rotary evaporation. The final product XLQ-1220 was obtained by silica gel column chromatography, which is the compound of Example 91.

[0956] Experimental Example 1: Detection of PLpro inhibitory activity of the compounds prepared in the above examples

[0957] Biological testing conditions:

[0958] 1. Reaction buffer: 20mM HEPEs, pH 7.5, 100mM NaCl, 1mM TCEP

[0959] 2. Preparation of mother liquor:

[0960] (1) 20μM Ub-AMC (Ub-AMC dry powder is dissolved directly with reaction buffer, and the precipitate is removed by centrifugation before use);

[0961] (2) 400 nM PLpro (purified by molecular sieve and frozen to -80°C, thawed on ice before use and diluted with reaction buffer);

[0962] (3) 40 μM test compound (the dry powder of the test compound was dissolved in DMSO to 40 mM; diluted with 50% DMSO to 400 μM; and then diluted with reaction buffer to 40 μM);

[0963] 3. For the single-point inhibition test reaction system: 10 μM Ub-AMC, 100 nM PLpro, 1 μM test compound, total volume 20 μL, reaction in 384 wells;

[0964] Add 5 μL of PLpro stock solution and 5 μL of test compound stock solution to a 384-well plate and incubate at 4°C for 30 min.

[0965] Add 10 μL of Ub-AMC stock solution to a 384-well plate, react at 37 °C for 30 min, and then measure the AMC fluorescence intensity (excitation: 360 nm; emission: 460 nm).

[0966] 4. Control group (+Control): DMSO at the corresponding dilution factor replaces the test compound;

[0967] Blank group: Reaction buffer replaces PLpro;

[0968] 5. Data processing: Subtract the Blank value from the measured value and normalize it based on the DMSO value;

[0969] 6. IC 50 Measurement:

[0970] Concentration gradient of test compounds (nM): 10000, 5000, 1000, 500, 250, 125, 62.5, 31.25, 15.625, 10, 5, 2, 1, 0.5, 0.1, 0.01

[0971] Measure fluorescence value after 15 min of reaction (the enzyme reaction rate is in the linear range at around 15 min, and in the non-linear range at 30 min);

[0972] 7. Data fitting: After normalization, the data is processed using Sigmaplot (fitting equation: Logistic, 3Parameter).

[0973] The results are shown in the table below.

[0974] Table 1 Experimental Results

[0975]

[0976]

[0977]

[0978]

[0979]

[0980]

[0981]

[0982]

[0983]

[0984]

[0985]

[0986]

[0987] GRL0617 was a positive control (Ghosh et al., 2009; Ghosh et al., 2010; Ratia et al., 2008).

[0988] Example 26: Experiment on the inhibition of live virus from SARS-CoV-2 infection in cells by the compound:

[0989] To verify the anti-SARS-CoV-2 activity of Example 26, the Calu-3 cell infection model of live SARS-CoV-2 virus was used to detect the anti-SARS-CoV-2 activity of the molecules in Example 26.

[0990] A serially diluted sample of Example 26 was mixed with an equal volume of 100 TCID50 SARS-CoV-2 and added to a culture plate containing 1 × 10⁴ Calu-3 cells per well. Each well of the cell culture plate was supplemented with 100 μL of DMEM + 2% FBS medium, and the plates were incubated for 48 hours. The cell supernatant was then collected.

[0991] Viral RNA extraction and quantitative real-time PCR (qRT-PCR) were performed using TRIzol LS reagent (Invitrogen) to extract viral RNA from cell supernatants according to the manufacturer's instructions. Detection was performed using the One-Step PrimeScrip RT-PCR Kit (Takara, Japan, Cat.#RR064A) according to the manufacturer's instructions. The RT-PCR program was: Reverse transcription: 95℃ for 10 s, 42℃ for 5 min; PCR reaction: (95℃ for 5 s, 56℃ for 30 s, 72℃ for 30 s) * 40 cycles. Detection was performed using a BioRad real-time PCR instrument. The primer sequences are: SARS-CoV-2-NF (SEQ ID NO: 1): GGGGAACTTCTCCTGCTAGAAT, SARS-CoV-2-NR (SEQ ID NO: 2): CAGACATTTTGCTCTCAAGCTG, SARS-CoV-2-N-probe (5'-FAM-SEQ ID NO:3-TAMRA-3'):5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'.

[0992] Forty-eight hours post-infection, cell supernatant was collected, and the viral RNA copy number in the cell culture supernatant was evaluated by RT-qPCR. The in vitro inhibitory efficacy of the test drug against SARS-CoV-2 was calculated (by measuring EC50). 50 and EC 90 (Number).

[0993] Example 26: The inhibition rate of pharmaceutically acceptable salt crystal form A against SARS-CoV-2 live virus (Delta strain) infection is as follows:

[0994]

[0995] Experiments have shown that Example 26 can effectively inhibit the infection of human cells by live SARS-CoV-2 virus in vitro.

Claims

1. A compound or a pharmaceutically acceptable salt thereof, said compound having the following structure: in, Ar 1 For substituted naphthyl groups or substituted or unsubstituted non-naphthalene aromatic groups; The substituted naphthyl group is selected from: , , , Among them, R 44 R 45 R 46 Independently selected from: D, -CH3, -X, -CH2F, -CHF2, -CF3, -OH, -CN, -OCH3, -OCH2X, -OCHX2, -OCX3, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl); The substituted or unsubstituted non-naphthalene aromatic group is , where R 51 R 52 Independently selected from: H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3; Alternatively, the substituted or unsubstituted non-naphthalene aromatic group is ,in, W3 represents N; R6 represents H, D, or CH3; R 61 R 62 For H; Alternatively, the substituted or unsubstituted non-naphthalene aromatic groups are selected from: , , , , Among them, R7 and R7' are independently selected from: H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3; R8 is selected from: H or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl; Alternatively, the substituted or unsubstituted non-naphthalene aromatic groups are selected from: , , , , , , , , , Among them, S1, S2, S4, S5, S6, and S7 are CR. 94 ; R 94 Selected from: H, -D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3; R 91 Selected from: H, -D, C1-C6 alkyl groups; Alternatively, the substituted or unsubstituted non-naphthalene aromatic group is... , or ; R 72 R 73 Independently selected from: H, D, -F, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3; T 17 Represents one or more independent substituents on the ring, selected from: H, C1-C6 alkyl groups, and halogens; B is selected from: , , , , , , ; R 14 Selected from: H, D, C1-C6 alkyl, amino, ; R 13 Selected from: -H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF3, -CH2D, , ; for ; L1 does not exist; L4 is -NHC(O)-; L6 does not exist; X is selected from F, Cl, Br, and I.

2. The compound according to claim 1, characterized in that, R 44 R 45 R 46 The independent selections are: -F, -D, -Br, -Cl, -I, -CH3, -CH2F, -CHF2, -CF3, -NH2, -NHCH3, -N(CH3)2, -OCH3, -OH.

3. The compound according to claim 1, characterized in that, The substituted or unsubstituted non-naphthalene aromatic group is .

4. The compound according to claim 1, characterized in that, B has the following structure: .

5. The compound according to claim 1, characterized in that, The B is .

6. The compound according to claim 1, characterized in that, R 14 It can be H or D.

7. The compound according to claim 1, characterized in that, R 13 Selected from: -H, D, methyl, ethyl, n-propyl, isopropyl, .

8. The compound according to claim 4, characterized in that, R 14 For H or D, R 13 It is a methyl group.

9. The compound according to claim 1, characterized in that, The B is .

10. A compound or a pharmaceutically acceptable salt thereof, characterized in that, The compounds are selected from the following: 。 11. A pharmaceutical composition comprising the compound of any one of claims 1-10 or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.

12. The use of the compound of any one of claims 1-10 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 11, in the preparation of a medicament for the prevention and / or treatment of diseases or conditions caused or associated with a viral infection, wherein the virus is a coronavirus.

13. The application as described in claim 12, characterized in that, The viruses were selected from: HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, and SARS-CoV-2.

14. The application as described in claim 13, characterized in that, The diseases or symptoms mentioned are selected from: COVID-19, SARS, and MERS.

15. The use of the compound of any one of claims 1-10 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 11, in the preparation of a medicament for reducing and / or inhibiting coronavirus replication.

Images