Schima superba drought-resistant gene ssper17 and application thereof

Abstract

The present application belongs to the technical field of plant gene screening, and particularly relates to a Schima superba drought-resistant gene SsPER17 and application thereof. The SsPER17 is screened by combining a time sequence expression model with a GO annotation associated with a significant change trend, and combining a drought and rehydration test expected gene difference model time sequence feature, through in-depth analysis of common difference genes. The gene expression has a space-time specificity. With the aggravation of drought stress, the gene expression presents a significant upward trend. After rehydration, the gene expression level is reduced, which indicates that the target gene can be induced by drought and is closely related to drought stress. The expression in buds and roots is significantly highest, and the expression in leaves is significantly lowest, which indicates that the target gene is mainly expressed in roots and buds. Through transgenic Arabidopsis plants, the seeds can be normally kept germination under high osmotic potential, the seed activity is kept, and the root elongation is promoted, which indicates that SsPER17 can enhance the drought resistance of itself by improving the seed activity and promoting the root growth.

Description

Technical Field

[0001] This invention belongs to the technical field of plant gene screening, specifically relating to a drought-resistant gene SsPER17 from the tree *Symplocos lucida* and its applications. Background Technology

[0002] The most obvious manifestation of plant response to drought stress is the degree of wilting. Excessive water loss can lead to permanent wilting. Studies have shown that *Symplocos edulis* seedlings exhibited the highest wilting intensity after 96 hours, but recovered rapidly after rehydration. Similar findings were observed in leaf water content and stomatal aperture, both of which quickly returned to normal levels after rehydration. Stomatal regulation is one of the most direct mechanisms by which plants respond to drought, reducing water exchange with the external environment through stomatal regulation of transpiration and photosynthesis. This indicates that *Symplocos edulis* has a strong ability to adapt to and recover from drought stress. Chlorophyll content is often used to assess plant tolerance to drought stress. Drought stress reduces chlorophyll content in sensitive plants (Zhu, 2020), leading to reduced photosynthesis and ultimately inhibiting plant growth (Xue, 2018). However, some studies have also shown that drought stress can increase chlorophyll content in plant leaves (Dai Weiran, 2010).

[0003] Superoxide dismutase (SOD) is an important intracellular oxygen free radical scavenger that catalyzes the dismutation of superoxide anions to produce H₂O₂ and O₂. It is also a major H₂O₂-producing enzyme and plays a crucial role in the biological antioxidant system. CAT, APX, POD, and GPX can remove toxic H₂O₂ produced intracellularly. Plant cells use this series of enzymes to combat cell membrane toxicity under water stress. Increased activity of these antioxidant enzymes is one of the effective drought resistance mechanisms in plants (Farooq, 2009). Numerous experimental studies have shown that the activity of plant antioxidant enzymes is related to responses to abiotic stresses, including drought and salt stress (Bor, 2003; Demiral, 2005). For example, drought-tolerant plants such as beans, sunflowers, and sorghum exhibit higher POD activity under drought stress than sensitive plants (Shigeoka, 2002). Red oak in North America responds to short-term drought stress in seedlings by increasing SOD and POD activity (Wang Junfeng, 2021). Plants mitigate drought-induced cell damage through a series of antioxidant enzymes, thereby enhancing their resilience to adverse conditions and coping with drought stress.

[0004] Malondialdehyde (MDA) is a peroxide product of cell membrane lipids. The accumulation of MDA is an important indicator of cell membrane lipid peroxidation (Mao Yongcheng, 2016). Increased MDA content helps plants protect themselves from adverse conditions (Zhang, 2008; Wang Junfeng, 2021). In this study, the MDA content of *Symplocos edulis* was significantly increased during drought, but returned to normal levels after rehydration. This indicates that the cell membrane system was severely damaged during drought, and the return to normal levels after rehydration suggests that the damage to the membrane system of *Symplocos edulis* after prolonged drought stress can be recovered, demonstrating a strong recovery ability. Glutathione S-transferase (GST) protects cells from oxidative stress and toxic exogenous chemicals (Hayes, 2000), reduces reactive oxygen species levels, and plays a crucial role in protecting cells from damage by electrophilic compounds (Wang, 2010). GST activity increased with increasing drought stress duration, reaching a significant peak at 96 hours. This indicates that under drought stress, cells in *Symplocos macrantha* are damaged, and GST significantly increases to resist damage from electrophilic compounds. Furthermore, after rehydration, GST activity returned to normal levels, suggesting rapid recovery from damage and mitigating the effects of water loss. Studies have shown that GST protein may be located in chloroplasts, with higher expression levels in roots (Qiao, 2017). Transgenic GST genes can enhance the resistance of walnut and tomato plants to abiotic stresses (Xu, 2015; Yang, 2016). Therefore, plants cope with drought stress and improve their tolerance by accumulating MDA and increasing GST activity. Summary of the Invention

[0005] To address the above problems, the present invention aims to provide a drought-resistant gene SsPER17 from *Symplocos edulis* and its applications.

[0006] The technical content of this invention is as follows:

[0007] This invention provides a drought-resistant gene SsPER17 (self-named), the nucleic acid sequence of which is shown in SEQ ID NO.1.

[0008] The present invention also provides a protein encoded by the drought-resistant gene SsPER17 of the above-mentioned *Symplocos edulis*, the amino acid sequence of which is shown in SEQ ID NO.2, and the last amino acid is a stop codon, including one of TGA, TAA, and TAG.

[0009] The present invention also provides a primer pair for the above-mentioned drought-resistant gene SsPER17 of *Symplocos edulis*, the primer pair comprising a forward primer and a reverse primer, the nucleic acid sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0010] The present invention also provides an application of the above-mentioned drought-resistant gene SsPER17 of *Symplocos edulis* in improving the drought resistance of plants, wherein the plants include *Symplocos edulis* or *Arabidopsis thaliana*.

[0011] The application method involves genetically transforming the drought-resistant gene SsPER17 of *Symplocos edulis* into a strain by ligating an expression vector, obtaining a recombinant vector, and then transferring it into the plant's genome to obtain a drought-resistant plant.

[0012] The expression vector includes pGBO, which is derived from Beijing Forestry University;

[0013] The strains include competent Escherichia coli and Agrobacterium, with models DH5α and GV3101, respectively.

[0014] The beneficial effects of this invention are as follows:

[0015] The drought-resistant gene SsPER17 of *Symplocos edulis* was identified in this invention. Through transcriptional sequencing of *Symplocos edulis* seedlings during drought and rehydration periods, differential expression analysis, KEGG functional enrichment analysis, GO annotation analysis, and temporal expression analysis were used to screen for the SsPER17 gene, which is associated with plant drought resistance and whose temporal expression pattern is consistent with drought stress. Simultaneously, qRT-PCR analysis showed that the gene expression pattern was basically consistent with the sequencing results, indicating that SsPER17 is related to drought regulation. Online bioinformatics analysis revealed that the SsPER17-encoded protein has a molecular weight of 3.713 kDa and a molecular formula of C1. 638 H 2622 N 466 O 484 S 17 The theoretical pI = 9.22 indicates that it is an unstable protein, suggesting that the encoded protein is a secretory protein. Analysis of the 2000bp upstream promoter sequence of SsPER17 shows that the promoter contains a large number of light-responsive elements, hormone-responsive elements, and stress-responsive elements. Among them, the cis-acting element that may be related to drought stress is MYB / MYC. MYB-type transcription factors are widely present in plants.

[0016] Analysis of SsPER17 gene expression in different tissues and during different drought periods using qRT-PCR revealed spatiotemporal specificity. Gene expression showed a significant upward trend with increasing drought stress, decreasing after rehydration, indicating that the target gene can be induced by drought and is closely related to drought stress. Expression was significantly highest in buds and roots, and significantly lowest in leaves, suggesting that the target gene is mainly expressed in roots and buds. Transgenic Arabidopsis plants using the SsPER17 gene maintained normal seed germination and viability under high osmotic potential, promoting root elongation, indicating that SsPER17 enhances drought resistance by increasing seed viability and promoting root growth. Transcriptional analysis of AtPRX and AtAPX1 functional genes showed that drought significantly induced these drought-stress-related functional genes. After treatment, the transcriptional level of the stress-resistance gene AtPRX in SsPER17 transgenic Arabidopsis was significantly higher than that in wild-type plants, while AtAPX1 was significantly lower than that in wild-type plants. This indicates that the SsPER17 gene promotes AtPRX expression while inhibiting AtAPX1 expression under drought induction. Studies on the activities of plant peroxidases and ascorbate peroxidase (APX1) related to the functional genes scavenging reactive oxygen species (ROS) AtPRX and AtAPX1 revealed significant changes in enzyme activities after drought treatment. In SsPER17 transgenic Arabidopsis, POD activity was significantly higher than in the wild type, while APX activity was significantly lower, consistent with significant changes in the transcriptional levels of these functional genes. Furthermore, overexpression of the SsPER17 gene leads to positive AtPRX expression and negative AtAPX1 expression, suggesting a possible compensatory mechanism. All of these findings indicate that the SsPER17 gene plays a crucial regulatory role in drought stress, primarily relying on ROS scavenging pathways. Attached Figure Description

[0017] Figure 1 Figure 1 shows the results of KEGG enrichment analysis in the screening of drought-resistant genes in *Symplocos pubescens*.

[0018] Figure 2 Figure showing the GO annotation analysis results in the screening of drought-resistant genes in *Symplocos pubescens*.

[0019] Figure 3 Figure showing the results of temporal expression model analysis of common differentially expressed genes in the screening of drought-resistant genes in *Symplocos edulis*.

[0020] Figure 4 Figure showing the temporal expression trend and validation results of the screened SsPER17 gene;

[0021] Figure 5 Predicted signal peptide for the SsPER17 encoded protein;

[0022] Figure 6 Prediction of transmembrane regions for SsPER17

[0023] Figure 7 Figure showing the expression results of SsPER17 in different tissues of *Symplocos pubescens*.

[0024] Figure 8 PCR electrophoresis image of the SsPER17 gene clone;

[0025] Figure 9 The image shows the results of the identification of positive strains;

[0026] Figure 10 Photographs of the growth of T1 generation Arabidopsis thaliana and leaf screening;

[0027] Figure 11 The image shows the PCR results of T1 generation transgenic positive plants.

[0028] Figure 12 Germination of different lines of transgenic Arabidopsis thaliana seedlings;

[0029] Figure 13 Germination phenotype and germination potential of different strains;

[0030] Figure 14 For comparison of root phenotype and root length;

[0031] Figure 15 The relative expression levels of AtPRX and AtAPX1 genes in transgenic Arabidopsis seedlings;

[0032] Figure 16 Changes in POD and APX enzyme activities in transgenic Arabidopsis seedlings. Detailed Implementation

[0033] The present invention will be further described in detail below through specific implementation examples and accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection of the present invention. After reading the present invention, any modifications of the present invention in various equivalent forms by those skilled in the art fall within the scope of the appended claims.

[0034] Unless otherwise specified, all raw materials and reagents used in this invention are from the conventional market.

[0035] Example

[0036] A drought-resistant gene SsPER17 from *Symplocos lucida* and its application

[0037] 1. Screening for cold-resistance genes

[0038] 1) Treatment of drought and rehydration of *Symplocos edulis*

[0039] One- to two-year-old *Symplocos edulis* seedlings (obtained from the nursery of the Guangdong Academy of Forestry Sciences (23°11'59'N, 113°22'11'E)) were placed in an incubator and cultivated at 25°C and 70% humidity, with a photoperiod of 16 h light / 8 h dark and a light intensity of 600 μmol / m². -2 s -1 The experiment began with thorough watering, followed by drought treatment at 0h, 1d, 2d, and 4d. After 4 days of drought, rewatering was performed at 1h, 12h, and 24h.

[0040] 2) Transcriptome sequencing

[0041] Transcriptome sequencing of *Symplocos edulis* was performed using Beijing Quanxite Biotechnology Co., Ltd., and data analysis was completed through its biological cloud platform.

[0042] Transcriptome sequencing was performed on 21 samples from different drought periods of *Symplocos edulis* (transcriptome sequencing step 1) under 7 different treatments (three replicates per treatment). A total of 165.72 Gb of clean data was obtained, with Q30 base percentage above 94%. The number of unigenes assembled was 155,493, the number of transcriptions was 247,211, the average length was 853.18 bp, and the N50 length was 1254 bp.

[0043] Based on the quantitative results of the above expression levels, differential gene analysis was performed among the different treatment groups of *Symplocos edulis* using DESeq2 software (|log2FC|>=1&padjust<0.01). The results are shown in Table 1.

[0044] Table 1. Gene expression analysis between groups

[0045]

[0046]

[0047] 3) Screening for drought genes

[0048] Based on the quantitative results of the above expression levels, differential gene analysis was performed between the control and experimental groups (|log2FC|>=1&padjust<0.01), as shown in Table 1. The differentially expressed genes were mainly concentrated in the 96-hour drought and 1-hour rehydration periods, totaling approximately 20,000 genes. The number of differentially expressed genes in the early stages of drought stress and after rehydration was only about 4,000. Furthermore, the number of differentially expressed genes showed a temporal variation, increasing with the severity of drought and decreasing with prolonged rehydration time. Comparing the 96-hour drought treatment with the highest number of differentially expressed genes, KEGG analysis showed (e.g., ...) Figure 1This indicates that plant hormone signal transduction is the main part of functional enrichment.

[0049] Gene sets were established based on differentially expressed genes before and after drought treatment. Venn analysis was performed, identifying 714 shared differentially expressed genes. A new gene set was then established for GO annotation analysis (e.g., ...). Figure 2 The analysis revealed that the annotations primarily focused on cellular and metabolic processes within biological processes, membrane components within cellular components, and catalytic activity within molecular functions.

[0050] A thorough analysis of shared differentially expressed genes was conducted, and temporal expression models with significant changing trends were correlated with GO annotations. This was then combined with the temporal characteristics of the expected gene differential models from drought-re-watering experiments. The results are as follows: Figure 3 The SsPER17 gene was obtained, and the expected goal was achieved.

[0051] The SsPER17 gene was compared and validated by qRT-PCR, such as Figure 4 It can be seen that the gene expression patterns are basically consistent and conform to the expected expression model. Finally, it was preliminarily confirmed that SsPER17 is a key gene of *Symplocos edulis* in response to drought stress.

[0052] The reaction system for the real-time quantitative PCR (qRT-PCR) is as follows:

[0053] 1) Prepare the following reaction solution on ice:

[0054] Table 2 Real-time quantitative PCR reaction system

[0055]

[0056] 2) Add the above reaction system into a dedicated 96-well qPCR plate and seal it with an optical sealing film;

[0057] 3) Reaction Procedure

[0058] Table 3 Real-time quantitative PCR reaction procedure

[0059]

[0060] 2. Bioinformatics analysis of drought genes

[0061] 2.1 Physicochemical properties of the protein encoded by SsPER17

[0062] Preliminary analysis of the physicochemical properties of the SsPER17 protein was performed using ExPASy ProtParam. The results showed that the molecular weight of the SsPER17 gene protein is 3.713 kDa, and the molecular formula is C1. 638 H 2622 N 466 O484 S 17 The theoretical pI = 9.22. Amino acid composition analysis revealed that the SsPER17 gene had the highest proportions of leucine (Leu) (10.7%), serine (Ser) (9.2%), and alanine (Ala) (8.6%), with an instability coefficient of 43.99, classifying it as an unstable protein.

[0063] Signal peptides, located after the start codon, participate in protein transport and localization. They enable ribosomes undergoing translation to attach to the rER membrane, guiding proteins to subcellular organelles with different membrane structures. Signal peptide prediction for the SsPER17 gene-encoded protein was performed using SignaIP 5.0. Figure 5 The predicted positions are at 22 and 23: AAA-AP, Sec / SPI = 0.9809, indicating the presence of a signal peptide.

[0064] The transmembrane region of the protein encoded by the SsPER17 gene was predicted using TMHMM 2.0, and the results are as follows: Figure 6 As shown, the expected number of transmembrane helices is 18.55, the total probability of the N-term being located on the cytoplasmic side of the membrane is 82.0%, amino acids 1-4 are located on the inner side of the membrane, the transmembrane helical region (TMhelix) is located at 5-24, and 25-366 is located on the outer side of the membrane, indicating that the encoded protein is a transmembrane protein.

[0065] 2.4 Predictive Analysis of Promoter-Simultaneous Element

[0066] The upstream 2000bp promoter sequence of the target gene SsPER17 was obtained via local BLAST. PlantCARE was used to predict the cis-elements of the promoter, and the results are shown in Table 4. The sequence contained numerous light-responsive elements, such as AE-box, AT1-motif, GT1-motif, Gap-box, and TCCC-motif; hormone-responsive elements, such as CGTCA-motif, ERE, GARE-motif, and TGA-box; and stress-responsive elements, such as AT-rich element, MYB / MYC, TGACG-motif, Wbox, WUN-motif, and As-1. This indicates that SsPER17 gene expression is regulated by light, hormones, and stress.

[0067] Table 4 Prediction of cis-acting elements of promoters

[0068]

[0069]

[0070] 3. Functional identification of drought genes

[0071] 3.1 Tissue-specific expression analysis of the target gene

[0072] The expression of the SsPER17 gene in the leaves, buds, stems, and roots of 1-2 year old *Symplocos edulis* was investigated by qRT-PCR (see Tables 2 and 3). The primer pairs used were as follows:

[0073] F primer: ATGTCTCCCGCTCTTCTTCCC;

[0074] R primer: TCAAGAGGATGAGGACTCCAAC);

[0075] The results are as follows Figure 7 The study found that the SsPER17 gene was specifically expressed in different tissues of *Symplocos edulis*, with the highest expression in buds and roots and the lowest expression in leaves, indicating that the target gene is mainly expressed in roots and buds.

[0076] 3.2 Heterogeneous transformation of Arabidopsis thaliana

[0077] 1) SsPER17 gene CDS sequence amplification

[0078] mRNA was extracted from fresh leaves of 1-2 year old *Symplocos edulis* plants and reverse transcribed into cDNA as a cloning template, such as... Figure 8 As shown, the target size band of the SsPER17 gene was obtained by PCR cloning.

[0079] 2) Identification of expression vector-positive bacterial suspensions

[0080] The target gene SsPER17 was ligated into the overexpression vector pGBO, transformed into DH5α competent cells, and the resulting positive colonies were verified by PCR. The results are as follows: Figure 9 Sequencing bacterial cultures with correct bands yields sequencing results that are consistent with the CDS region of the gene, which can be used for heterologous transformation of Arabidopsis thaliana.

[0081] The reaction system for PCR verification is as follows:

[0082] Table 5 PCR reaction solution

[0083]

[0084] Table 6 PCR Amplification Procedure

[0085]

[0086]

[0087] 3) Identification of transgenic Arabidopsis seedlings

[0088] Arabidopsis thaliana T1 seeds (Col-1, Colombian wild type) were screened using 1 / 2 MS solid medium (containing 50 mg / L Kana). Successfully transgenic Arabidopsis thaliana plants grew normally, such as... Figure 10 The leaves of T1 generation transgenic Arabidopsis plants were analyzed by PCR using the Qingke T5 Direct PCR Kit (Plant) to obtain the target gene fragment size as shown in the figure. Figure 11 This proves that the transfer to Arabidopsis thaliana was successful.

[0089] 4) Phenotypic analysis of transgenic Arabidopsis seedlings

[0090] T2 seeds were sown on 1 / 2 MS medium, retaining homozygous Arabidopsis thaliana with the correct segregation ratio, and phenotypic tests were performed using the T3 generation. Transgenic SsPER17 and wild-type Arabidopsis thaliana were sown on 1 / 2 MS medium containing 200 mM mannitol, and after two days of vernalization, they were placed in an incubator for cultivation. Germination was recorded daily. Figure 12 Arabidopsis thaliana completes its germination process in 4 days, with germination reaching its peak on the second day. Wild-type Arabidopsis thaliana has a germination rate of 85% in 4 days, while the transgenic Arabidopsis thaliana SsPER17 has a germination rate of 100%.

[0091] The average germination potentials of WT, PER17-1, PER17-2, and PER17-3 were 36%, 82.61%, 82.61%, and 69.57%, respectively. Figure 13 The germination potential of WT seeds was significantly the lowest, while the germination potential of transgenic Arabidopsis seeds was significantly higher than that of wild-type Arabidopsis. This indicates that the SsPER17 gene promotes the germination of Arabidopsis seeds and enhances their germination vigor.

[0092] T3 generation Arabidopsis thaliana seeds and wild-type seeds were sown on 1 / 2 MS medium. After two true leaves emerged, they were transplanted to 1 / 2 MS medium containing 200 mM mannitol. Root length was measured and compared after two weeks of culture. Figure 14 The average root length of wild-type Arabidopsis thaliana was 8.88 mm, while that of transgenic Arabidopsis thaliana was 13.82 mm, significantly longer than that of wild-type. This indicates that the SsPER17 gene can promote root growth in Arabidopsis thaliana seedlings under osmotic stress, suggesting that SsPER17 enhances drought resistance by increasing root growth through improved seed viability.

[0093] 5) Detection and analysis of the relative expression levels of target genes in transgenic Arabidopsis seedlings

[0094] To investigate potential drought resistance regulatory pathways, SsPER17 positive strains were treated with wild Arabidopsis thaliana for 7 days under drought conditions. The Arabidopsis thaliana response genes PRX and APX1, which are associated with drought resistance, were selected, and their relative expression levels were analyzed using qRT-PCR. Figure 15Both drought-related genes were significantly induced to express, and their relative expression levels were significantly higher after drought treatment than before. Before drought treatment, the relative expression levels of AtPRX and AtAPX1 genes in wild-type Arabidopsis thaliana were not significantly different from those in transgenic plants. However, after drought treatment, there were significant differences in expression levels among different lines. Specifically, the relative expression level of AtPRX gene in transgenic lines was significantly higher than that in wild-type after drought treatment, while the relative expression level of AtAPX1 gene in transgenic lines was significantly lower than that in wild-type after drought treatment. This indicates that drought treatment in SsPER17 transgenic lines can induce AtPRX expression while inhibiting AtAPX1 gene expression.

[0095] 6) Biochemical index determination and analysis of Arabidopsis thaliana transgenic positive seedlings

[0096] AtPRX gene expression is associated with plant peroxidase (POD), while AtAPX1 gene expression is associated with plant ascorbate peroxidase (APX). To further investigate their functions, the enzyme activities were determined using ultraviolet spectrophotometry. Figure 16 POD activity showed a significant difference before and after drought treatment, with the activity after drought treatment being significantly higher than before. Before drought treatment, there was no significant difference in enzyme activity between transgenic and wild-type lines, but the activity after treatment was significantly higher than that of wild-type Arabidopsis, indicating that the transgenic lines had higher peroxidase activity. APX activity also showed a significant difference before and after treatment, but the activity of wild-type APX was significantly higher than that of transgenic lines after treatment, indicating that the transgenic plants had lower ascorbate peroxidase activity.

[0097] As shown above, overexpression of the SsPER17 gene leads to positive expression of AtPRX and negative expression of AtAPX1, suggesting a possible compensatory mechanism. A similar phenomenon was observed in Phalaenopsis aphrodite, where PhAPX expression decreased before browning of explants and returned to normal levels after 6 hours of culture, while PhPRX showed the opposite trend, increasing before browning and then decreasing (Xu Chuanjun, 2009). This provides new evidence for this compensatory mechanism. These results indicate that the SsPER17 gene plays an important regulatory role in drought stress, primarily relying on the ROS scavenging pathway.

Claims

1. A drought-resistant gene of *Symplocos lucida* SsPER17 Its characteristics are, The drought-resistant gene of the tree SsPER17 The nucleic acid sequence is shown in SEQ ID NO.

1.

2. A drought-resistant gene for *Symplocos edulis* as described in claim 1 SsPER17 The encoded protein.

3. The protein according to claim 2, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. The drought-resistant gene of *Symplocos edulis* as described in claim 1 SsPER17 Its application in improving plant drought resistance is characterized by, The plant in question is either *Symplocos edulis* or *Arabidopsis thaliana*.

5. The drought-resistant gene of *Symplocos edulis* according to claim 4 SsPER17 Its application in improving plant drought resistance is characterized by, Its application method involves using the drought-resistant genes of *Symplocos edulis*. SsPER17 By using genetic transformation, expression vectors are ligated and transformed into bacterial strains for expression, resulting in recombinant vectors that are then transferred into the plant genome to obtain drought-resistant plants.

Images