An anti-eph a2 fully human bivalent recombinant antibody scFv-fc

Abstract

The application relates to the technical field of antibody engineering, and discloses an anti-EphA2 full human single-chain antibody, which is scFv179. An anti-EphA2 full human bivalent recombinant antibody is also disclosed, which is scFv179-Fc; the recombinant antibody comprises the single-chain antibody and a human antibody constant region Fc segment amino acid sequence. The anti-EphA2 full human single-chain antibody or the anti-EphA2 full human bivalent recombinant antibody is used for preparing an anti-tumor drug. The screened anti-EphA2 full human bivalent recombinant antibody ScFv-Fc has high affinity, low immunogenicity, good stability and the ability of inhibiting tumor growth, and is suitable for being used as a carrier of immunotherapy or a radionuclide drug.

Description

Technical Field

[0001] This invention relates to the field of antibody engineering technology, specifically to an anti-EphA2 fully human bivalent recombinant antibody scFv-Fc. Background Technology

[0002] Eph receptors are one of the largest subgroups in the receptor tyrosine kinase (RTK) family, divided into two main classes, A and B, based on their extracellular domains. To date, 14 Eph receptors and 8 Ephrin ligands have been identified. These molecules play crucial roles in tumor formation and progression by influencing cell-related signaling pathways. Erythropoietin-producing hepatocytes A2 (EphA2) are important members of the Eph receptor family. In the human genome, the EphA2 gene is located at the tumor genetic locus on chromosome 1p36.1. Unlike other Eph receptors, EphA2 is widely expressed in various human epithelial-derived tissues and cell lines, and its expression level is low under normal conditions. Extensive clinical research evidence shows that EphA2 is highly expressed in various epithelial-derived malignancies, including hepatocellular carcinoma, non-small cell lung cancer, prostate cancer, breast cancer, colorectal cancer, gastric cancer, cervical cancer, and melanoma. High expression of EphA2 promotes tumor cell growth and increases its invasiveness, and is significantly associated with poor prognosis and reduced survival in cancer patients. The expression patterns, localization, and functional importance of EphA2 in various types of malignant tumors make it an attractive therapeutic target. At the same time, EphA2 is also an important target for delivering drugs, toxins, and imaging agents to tumor tissues.

[0003] Radionuclide therapy is a treatment approach based on specific tumor targets and malignant tissues. Monoclonal antibodies are the most widely used molecular targeting probes in the treatment of infectious diseases, inflammation, and tumors. They possess high specificity and affinity, and can recognize individual molecular phenotypes associated with cancer in a complex and dynamic biomolecular background without further modification. They are widely used in radionuclide imaging and radionuclide therapy. However, the primary challenge in developing antibody-targeted radiopharmaceuticals is the selection of antibody carriers. The affinity, immunogenicity, clearance rate, and half-life of antibody carriers often become major factors limiting the effectiveness of radioimmunotherapy. Generally, antibody fragments with moderate size and clearance rates (diabodies, minibodies, and ScFv-Fcs with molecular weights between 50 and 110 kDa) may be more suitable as nuclear labeling carriers than full-length IgG because they have higher penetration capabilities into solid tumors. Furthermore, the pharmacokinetics of full-length IgG antibodies are slow, and prolonged retention of radiopharmaceuticals in systemic circulation may cause dose-limiting toxicity to bone marrow and other non-target tissues and cells. Their larger molecular weight may also increase the circulatory burden on the body.

[0004] Single-chain antibody fragments (scFvs) are antibodies composed of the variable region (VH) of the heavy chain and the variable region (VL) of the light chain linked by a short peptide (linker) of 15–20 amino acids. scFvs retain their affinity for antigens well and are characterized by small molecular weight, strong penetrability, and weak antigenicity. scFv antibodies exhibit better cell penetration than intact antibodies. However, monovalently bound single-chain antibodies have small molecular weights, lower affinity, and short in vivo half-lives.

[0005] As is well known, IgG antibodies are the most abundant immunoglobulins in the blood and the main form of therapeutic antibodies. Full-length IgG has a molecular weight of approximately 150 kDa, and its blood clearance half-life (T1 / 2) in humans is 21 days. When full-length IgG is used as a carrier of radionuclides, the slow blood clearance increases the radiation dose to normal tissues during radioimmunotherapy. Simultaneously, its large molecular weight reduces its penetration into tumor tissue. These factors limit the potential of full-length IgG radioimmunotherapy. In contrast, another antibody fragment based on IgG, ScFv-Fc, exhibits similar tumor uptake to full-length IgG and good tumor targeting. Furthermore, ScFv-Fc has a smaller molecular weight than full-length IgG while retaining the tumor-penetrating characteristics of the monovalent antibody ScFv. However, compared to the monovalent binding of ScFv, this recombinant bivalent molecule, ScFv-Fc, has significantly enhanced affinity, reduced aggregation tendency, and increased serum half-life. Simultaneously, the added Fc segment can restore the immune effector function of the Fc region, enabling this bivalent recombinant antibody to not only serve as a good radionuclide carrier in radioimmunotherapy but also exert a therapeutic antibody effect, achieving better therapeutic results. Furthermore, ScFv-Fc not only serves as a good antibody carrier structure but also has important applications in the rapid diagnosis and screening of COVID-19 infection. Hye-Yeon Kim et al. prepared ScFv-Fc fusion antibodies using phage display technology for the specific detection of SARS-CoV-2 nucleocapsid protein (NP). Studies found that these ScFv-Fc antibodies specifically bind to the SARS-CoV-2 NP antigen with high affinity but do not bind to other coronavirus NPs. This COVID-19 infection biosensor based on the ScFv-Fc antibody structure can detect the SARS-CoV-2 virus within 20 minutes and distinguish it from other similar coronaviruses such as SARS-CoV. This detection method is a powerful complement to rapid screening methods for the novel coronavirus. Based on the above research, the ScFv-Fc bivalent fusion antibody has significant clinical application prospects.

[0006] EphA2 is an important oncogenic protein and an emerging drug target. Targeted therapies based on EphA2 have appeared in clinical trials at various stages of multiple malignant tumors. Among these, antibodies are the preferred choice for EphA2-targeted therapies due to their high specificity, affinity, stability, and multiple mechanisms of action with cell surface proteins. A series of antibodies targeting the EphA2 receptor have been studied in preclinical trials. Kelly Carles-Kinch et al. produced a monoclonal antibody targeting EphA2, and their further research showed that this EphA2 monoclonal antibody significantly inhibited the growth of malignant tumor cells and distant metastasis by inducing autophosphorylation and degradation of the EphA2 protein. In another study, EphA2 antibodies also showed strong therapeutic potential. Atsushi Sakamoto et al. prepared three anti-EphA2 monoclonal antibodies. In studies on melanoma cell lines, these EphA2 monoclonal antibodies significantly inhibited cell migration, invasion, and other metastatic behaviors. Meanwhile, researchers conjugated EphA2 monoclonal antibodies to immunotoxins and found that the conjugated EphA2 monoclonal antibodies exhibited strong growth inhibition and cytotoxicity, showing great promise in the treatment of melanoma, an aggressive tumor. These studies demonstrate that antibody research targeting EphA2 is extremely important in improving tumor treatment methods and enhancing treatment outcomes.

[0007] Over the past 30 years, antibody development has progressed through several stages: murine antibodies, chimeric antibodies, humanized antibodies, and fully human antibodies. The main limitation of murine antibodies is the immunogenicity of the exogenous protein, which can activate the human immune system, producing a human anti-mouse antibody (HAMA) response and causing immune damage. Although chimeric and humanized antibodies optimize antibody sources, they still cannot completely eliminate the adverse reactions and loss of efficacy caused by the immunogenicity of murine monoclonal antibodies. In contrast, fully human antibodies are entirely encoded by human genes, have low immunogenicity, and exhibit good clinical efficacy, making them a major research direction for immunotherapy antibodies and nuclear-labeled targeted antibodies. Screening for fully human ScFv-Fc recombinant antibodies targeting the EphA2 tumor target using phage display technology provides high-affinity, high-specificity, and low-immunogenic antibodies for malignant tumor immunotherapy and targeted radionuclide therapy, which has significant clinical implications and therapeutic prospects. Summary of the Invention

[0008] The applicant of this invention constructed a large-capacity phage single-chain antibody library using fully human phage display technology. After three rounds of affinity enrichment screening, 240 ScFv strains that specifically bind to the EphA2 protein were obtained. Through DNA fingerprinting, enzyme-linked immunosorbent assay (ELISA), and gene sequencing comparison, three ScFv strains with different sequences that specifically bind to the EphA2 receptor on PC-3, HepG2, and A549 tumor cells were selected. Using molecular biology techniques, ScFv was ligated into the sp-Fc / pcDNA3.1 vector and expressed in 293F eukaryotic cells. The expression supernatant was collected and purified. At the cellular and tissue levels, flow cytometry, immunohistochemistry, and other experimental methods confirmed that the purified bivalent recombinant antibody ScFv-Fc can specifically bind to the EphA2 antigen, exhibits high affinity, and inhibits tumor cell growth. Based on this, the present invention claims protection for the following technical solutions:

[0009] A fully human single-chain antibody against EphA2, wherein the single-chain antibody is scFv179;

[0010] The amino acid sequence of the heavy chain variable region of scFv179 is shown in SEQ ID No. 5, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 6.

[0011] In the above technical solution, the heavy chain variable region and the light chain variable region of the single-chain antibody are connected by a linker, and the amino acid sequence of the linker is (Gly4Ser)3.

[0012] A fully human bivalent recombinant antibody against EphA2, wherein the recombinant antibody is scFv179-Fc; the recombinant antibody comprises the above-mentioned single-chain antibody and the amino acid sequence of the Fc segment of the human antibody constant region.

[0013] The amino acid sequence of the scFv179-Fc is shown in SEQ ID No. 9.

[0014] This invention also protects a polynucleotide molecule encoding the above-described fully human bivalent recombinant antibody against EphA2.

[0015] The present invention also protects a recombinant DNA expression vector comprising the above-described polynucleotide molecules.

[0016] The present invention also protects the use of the above-mentioned fully human single-chain antibody against EphA2, or the above-mentioned fully human bivalent recombinant antibody against EphA2, in the preparation of antitumor drugs, wherein the tumor is prostate cancer, hepatocellular carcinoma, or lung adenocarcinoma.

[0017] In the above-described application and technical solution, the drug is an anti-tumor immunotherapy drug.

[0018] The antibodies screened from different types of phage antibody libraries have varying affinities. Based on their source, antibody libraries can be broadly categorized into immune libraries and non-immune libraries. Immune libraries are constructed from antibody V genes isolated from B cells (IgG) of patients or immunized animals, and are typically used in medical research to obtain antibodies against a specific target antigen. Non-immune libraries, on the other hand, are constructed from antibody V genes in B cells (IgM) of unimmunized donors, and their binding to antigens lacks specificity. Studies have shown that antibodies screened from non-immune libraries lack in vivo rearrangements and mutations, resulting in lower affinity. Furthermore, antibody screening in non-immune libraries involves a high background, low antibody abundance against specific target antigens, and requires a large library size to screen for antibodies with high affinity, significantly increasing the screening difficulty. In contrast, immune libraries contain a large number of antibodies against specific target antigens, resulting in a significantly reduced screening background. Meanwhile, antibodies screened from the immune library have undergone affinity maturation in the host body, exhibiting high affinity. Furthermore, screening for high-affinity antibodies from cancer patients suggests that these antibodies may already possess anti-tumor capabilities within the patient's body, making it easier to screen for therapeutic antibodies. In this study, mRNA was extracted from PBMCs of 200 malignant tumor patients to construct a ScFv phage immune library. The tumor types included lung cancer, cervical cancer, ovarian cancer, cervical cancer, nasopharyngeal carcinoma, esophageal cancer, colorectal cancer, and gastric cancer. This diverse range of tumor types avoids bias towards antibody genes from single tumor types and ensures the diversity of ScFv genes.

[0019] Obtaining high-affinity antibodies is a complex process influenced by multiple factors, and the source of the phage antibody library is only one of the reasons affecting affinity. Notably, in vitro screening for antibody affinity is also a key influencing factor. Before homologous recombination of ScFv to form the bivalent antibody ScFv-Fc, we expressed 39 initially obtained high-affinity ScFv strains in small quantities and bound them to the EphA2 protein, detecting their binding to the target protein using ELISA. The results showed that 83% of the ScFv strains were positive for binding. From the ELISA-positive strains, high-affinity ScFvs were further screened and subjected to cell ELISA with PC-3, HepG2, and A549 cells to detect the binding of ScFv to tumor cell surface antigens. Based on the combined results of the three cell ELISA experiments, high-affinity ScFvs were selected for homologous recombination. Extensive ELISA screening ensured that the finally obtained ScFv targeting the EphA2 antigen possessed high binding activity and specificity. Meanwhile, we randomly selected single colonies from the immunotherapy libraries before and after enrichment screening for BstNⅠ DNA fingerprinting identification. The results showed that the constructed phage immunotherapy libraries exhibited diversity. After three rounds of affinity screening, the specificity and affinity of ScFv targeting the EphA2 antigen gradually increased.

[0020] We screened three high-affinity fully human EphA2 bivalent recombinant antibodies, ScFv-Fc, using phage display technology. The screened recombinant antibodies have the ability to inhibit tumor growth, providing good antibodies for tumor immunotherapy and radioimmunotherapy drugs.

[0021] The beneficial effects of this invention are:

[0022] The fully human phage display library constructed in this invention has extremely high application prospects in the screening of specific antibodies. The screened fully human bivalent recombinant antibody ScFv-Fc against EphA2 has high affinity, low immunogenicity, good stability, and the ability to inhibit tumor growth. It is suitable as a carrier for immunotherapy drugs or targeted radionuclide drugs, and is expected to be used for targeted killing of tumor cells in vivo in order to obtain good radioimmunotherapy effects. It has great market application prospects. Attached Figure Description

[0023] Figure 1This study presents the expression of the EphA2 gene in tumor cells and its relationship with the survival prognosis of tumors in the TCGA database. Figure a shows the results of analyzing the expression level of the EphA2 gene in each cell line using the Human Protein Atlas Database. Figures b and c show the survival plots and Kaplan-Meier curves obtained by analyzing the relationship between EphA2 gene expression and overall survival (b) and disease-free survival (c) of different tumors in the TCGA database using the GEPIA2 tool.

[0024] Figure 2 For the construction of scFv phage libraries and the diversity analysis of immune libraries, (a) the amplified band is the VH gene library, (b) the amplified band is the Vκ gene library, (c) the amplified band is the Vλ gene library, (d) the VH-Vκ gene library and VH-Vλ gene library amplified by overlap extension PCR, (e) the fingerprint analysis of antibody library diversity before screening, (f) the fingerprint analysis of antibody library diversity after the first round of phage display screening, (g) the fingerprint analysis of antibody library diversity after the second round of phage display screening, and (h) the fingerprint analysis of antibody library diversity after the third round of phage display screening.

[0025] Figure 3 To screen for high-affinity anti-EphA2 scFvs, (a) phage ELISA was used to determine the binding activity of the initially screened 39 scFv antibodies to the EphA2 antigen; (b) phage cell ELISA was used to determine the binding of 28 scFv strains to the EphA2 receptor on PC-3 cells; (c) phage cell ELISA was used to determine the binding of 28 scFv strains to the EphA2 receptor on HepG2 cells; and (d) phage cell ELISA was used to determine the binding of 28 scFv strains to the EphA2 receptor on A549 cells.

[0026] Figure 4The images show the ligation of scFv with sp-Fc / pcDNA3.1. (a) Gel electrophoresis results of scFv-Fc179, lanes 1-3 show the amplified scFv target band; (b) Gel electrophoresis results of scFv-Fc14, lanes 1-4 show the amplified scFv target band; (c) Gel electrophoresis results of scFv-Fc77, lanes 1-5 show the amplified scFv target band; (d) SDS-PAGE results of EphA2-scFv-Fc recombinant protein, M is the protein molecular weight standard, lane 1 is the blank control; lane 2 is the pre-purified band of scFv-Fc179; lane 3 is the purified protein band of recombinant protein scFv-Fc179; lane 4 is the pre-purified band of scFv-Fc14; lane 5 is the purified protein band of scFv-Fc14; lane 6 is the pre-purified band of scFv-Fc179; lane 6 is the purified protein band of sp-Fc179; lane 77 is the pre-purified protein band of sp-Fc179; lane 8 is the pre-purified protein band of sp-Fc179; lane 9 is the pre-purified protein band of sp-Fc179; lane 10 is the pre-purified protein band of sp-Fc179; lane 11 is the pre-purified protein band of sp-Fc179; lane 12 is the pre-purified protein band of sp-Fc179; lane 13 is the pre-purified protein band of sp-Fc179; lane 14 is the pre-purified protein band of sp-Fc179; lane 14 is the pre-purified protein band of sp-Fc179; lane 15 is the pre-purified protein band of sp- (e) Pre-purified band of 77, 7 is the purified protein band of scFv-Fc 77; (f) Structural diagram of scFv-Fc vector; (c) Structural diagram of scFv-Fc antibody.

[0027] Figure 5 The study investigated the high affinity binding of scFv-Fc to the EphA2 receptor on the surface of tumor cells. The results included: (a) binding of different concentrations of recombinant antibody scFv-Fc to the EphA2 receptor on PC-3 cells; (b) binding of different concentrations of recombinant antibody scFv-Fc to the EphA2 receptor on A549 cells; (c) changes in average fluorescence intensity of recombinant antibody scFv-Fc binding to the EphA2 receptor on PC-3 cells at different concentrations; and (d) changes in average fluorescence intensity of recombinant antibody scFv-Fc binding to the EphA2 receptor on A549 cells at different concentrations.

[0028] Figure 6 To ensure the effective binding of scFv-Fc to the EphA2 receptor on the surface of tumor tissue, the following analyses were performed: (a) binding of recombinant antibody scFv-Fc to adenocarcinoma tissue and adjacent normal lung tissue; (b) semi-quantitative analysis of EphA2 expression in adenocarcinoma tissue and adjacent normal lung tissue. * represents P<0.05, ** represents P<0.01, *** represents P<0.001, and **** represents P<0.0001. Statistical analysis was performed using a grouped t-test.

[0029] Figure 7 This study investigates the inhibitory effect of the recombinant antibody scFv-Fc on the proliferation of lung cancer cells A549. Detailed Implementation

[0030] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0031] Unless otherwise specified, the experimental methods in the following examples are conventional methods; the biological and chemical reagents used are conventional reagents in the art and can be obtained commercially.

[0032] In this embodiment, the primers used for library screening are those disclosed in the prior art, specifically Qing Yuan, 2012, Construction of human nonimmune library and selection of scFvs against IL-33. Applied Biochemistry and Biotechnology, 2012, 167: 498-509.

[0033] Example 1

[0034] 1. Materials and Methods

[0035] 1.1 Survival prognosis analysis of EphA2

[0036] To elucidate the relationship between EphA2 regulatory genes and tumor survival prognosis, this application used the "Survival Map" module of GEPIA2 (http: / / gepia2.cancer-pku.cn / ), an online TCGA gene expression and survival analysis tool, to obtain significance maps of EphA2's overall survival (OS) and disease-free survival (DFS) for all TCGA tumors. High (50%) and low (50%) cutoff values ​​were used as expression thresholds to divide high-expression and low-expression cohorts. Hypothesis testing employed a log-rank test, and survival curves were also obtained using the "Survival Analysis" module of GEPIA2.

[0037] 1.2 Separation of PBMC

[0038] Mononuclear cells were isolated from peripheral blood of 200 cancer patients to construct an ScFv immune library. This experiment was approved by the ethics committee, and all cancer patients were adults who provided written informed consent. Lymphocytes were isolated from peripheral blood collected from the 200 cancer patients using lymphocyte separation medium. An equal volume of 1×PBS was added to the peripheral blood, and an equal volume of lymphocyte separation medium (Ficoll solution) was added to a 15 ml centrifuge tube and incubated at room temperature. The diluted blood sample was then added to the Ficoll solution and centrifuged at 1500 rpm for 30 min at room temperature. After centrifugation, the lymphocyte layer was aspirated into another clean centrifuge tube, and 5 volumes of 1×PBS were added. The tube was then centrifuged at 1500 rpm for 15 min at room temperature. This process was repeated twice to remove residual lymphocyte separation medium and collect the lymphocytes.

[0039] 1.3 Extraction of total RNA from lymphocytes and PCR amplification of light and heavy chain genes

[0040] Total RNA was extracted from lymphocytes using Trizol reagent. The purified RNA was used as a template, and first-strand cDNA was synthesized via reverse transcription using Oligo (DT) primers. Primer sequences were designed based on the light and heavy chain framework regions of the human antibody sequence [primers see QingYuan, 2012, Construction of human nonimmune library and selection of scFvsagainst IL-33. Applied Biochemistry and Biotechnology, 2012, 167: 498-509], and PCR was performed to amplify the coding regions of the antibody VH and VL (Vλ and Vκ) fragments. PCR reaction conditions: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles, followed by incubation at 72℃ for 10 min. The PCR product was purified by 1.5% agarose gel electrophoresis and then recovered for later use. VH or VL DNA from different patients was mixed for the next step of VH and VL ligation.

[0041] 1.4 Construction of a fully human EphA2-ScFv antibody library

[0042] Using purified VH and VL as templates, the ScFv fragment was synthesized by overlap PCR. The classic linker (Gly4Ser)3 (sequence SEQ ID No. 10: GGGGSGGGGSGGGGSGGGGS) was used as the linker between the heavy chain variable region and the light chain variable region. After overlap extension PCR splicing, the VH-Linker-VL ScFv gene fragment containing SfiⅠ and NotⅠ restriction enzyme sites was formed.

[0043] First round of overlap extension PCR: No primers added, 94℃ for 2 min; then 94℃ for 1 min, 68℃ for 1 min, 20 cycles; finally 72℃ for 7 min. Using the first round PCR product as a template, a second round of PCR was performed, with the upstream primer V... HFvF, downstream primer VλFvR or VκFvR [sequence details in Qing Yuan, 2012, Construction of human nonimmunelibrary and selection of scFvs against IL-33. Applied Biochemistry and Biotechnology, 2012, 167: 498-509], were used for the second round of PCR. Reaction conditions: 94℃ for 2 min, then 94℃ for 1 min, 55℃ for 1 min, 72℃ for 1 min, 30 cycles, followed by 72℃ for 10 min. PCR products were recovered by 1.5% agarose gel electrophoresis and stored at -20℃. Primer sequences are as follows:

[0044] V H FvF: 5′-ATCGACGCTACTGCGGCCCAGCCGGCCCAGGT-3′ (SEQ ID No. 11),

[0045] VλFvR: 5′-ACGGCTGCGTCAGAGTGCGGCCGCACGTTT-3′ (SEQ ID No. 12),

[0046] VκFvR: 5′-ACGGCTGCGTCAGAGTGCGGCCGCACC-3′ (SEQ ID No. 13).

[0047] V H- linker-Vκ, V H The ScFv library gene and pCANTAB 5E vector plasmid, prepared by mixing the linker-Vλ, were digested with SfiⅠ and NotⅠ restriction enzymes, respectively. The digestion products were recovered from the gel and used to construct a ScFv-gene III fusion library at 16°C using T4 DNA ligase. The ligation products were transformed into TG1 competent cells. The transformation products were added to LB agar (LBAG) containing 100 μg / ml ampicillin and 2.0% glucose. Twenty single colonies from the library were randomly selected for PCR identification. The PCR products were digested with BstNI and subjected to DNA fingerprinting analysis to assess ScFv diversity. All single colonies on the plates were scraped off and resuspended in LBAG liquid medium containing 20% ​​glycerol, aliquoted, and stored at -80°C.

[0048] 1.5 Phage Amplification

[0049] Take 150 μl of the library bacterial culture stored at -80℃ and inoculate it into 40 ml of LBAG liquid medium. Incubate at 37℃ and 250 rpm with shaking to allow the OD of the bacterial culture to adjust. 600 The value reached approximately 0.2. Centrifuge at 4000 rpm for 15 min at room temperature, collect the bacterial pellet, and resuspend it in 40 ml of LB broth (LBA broth) containing 100 μg / ml ampicillin and no glucose. Add to a final concentration of 3 × 10⁻⁶. 9 PFU / ml M13K07 helper phage was inoculated into LBA liquid medium and incubated at 37°C for 15 min. Then, it was placed on a horizontal shaker and incubated at 37°C and 200 rpm for 2 h. Kanamycin was added to a final concentration of 20 μg / ml, and the mixture was incubated overnight at 32°C. The mixture was centrifuged at 8000 rpm and 4°C for 20 min, the supernatant was discarded, and the bacterial pellet was resuspended in 1 / 5 of a volume of polyethylene glycol-sodium chloride (20% PEG, 2.5M NaCl). The mixture was incubated on ice for 1 h, centrifuged at 10000 rpm and 4°C for 20 min, the supernatant was discarded, and the bacterial pellet was resuspended in 1× PBS buffer.

[0050] 1.6 EphA2-ScFv Affinity Screening

[0051] ScFv affinity screening was performed using liquid chromatography. Purified EphA2 protein was biotinylated according to the EZ-Link® SulfoNHS-LC-Biotinylation (Thermo Science) manual. The amplified ScFv library phages were incubated with blocking buffer (containing 3% bovine serum albumin (BSA)) at room temperature for 1 h. The incubated library phages were then added to 1.5 ml centrifuge tubes, along with streptavidin-coated Dynabeads M-280 (Invitrogen) beads, and incubated at room temperature for 1 h. The magnetic beads were removed, and the supernatant was collected to remove non-specifically bound components from the library phages. 2 μg of biotinylated EphA2 protein was added to the treated library phages, and the mixture was incubated at room temperature for 2 h. The bound phage antigen complexes were captured using streptavidin-coated Dynabeads M-280 beads, and the mixture was washed 5–10 times with PBST. The phages were eluted with 0.1 M Glycine-HCl (pH=2.2), and then neutralized to pH 7.0 with 1 M Tris. The neutralized phages were used to infect TG1 cells in the logarithmic growth phase, plated on LBAG, and colonies were harvested for the next round of screening.

[0052] The amplification process was repeated as described above. In the second and third rounds of affinity screening, 1 μg of biotinylated EphA2 protein was used. Simultaneously, multiple single colonies were randomly selected from the enriched affinity screening libraries in each of the three rounds for PCR amplification. The amplification products were digested with BstNI to generate DNA fingerprints, which were used to assess the diversity of the ScFv library after enriched affinity screening.

[0053] 1.7 Low-level expression of EphA2-ScFv

[0054] Colonies were randomly selected from single-stranded libraries that had undergone three rounds of screening, and the bacterial culture was grown at 37°C and 200 rpm until the OD value was reached. 600 The value was approximately 0.2. Centrifuged at 4500 rpm for 10 min at room temperature, and the supernatant was discarded. The bacterial pellet was resuspended in LBA liquid medium, and M13K07 helper phage was added to a final concentration of 3 × 10⁻⁶. 9 PFU / ml, static infection for 15 min, incubate at 37℃, 200 rpm, shaking for 2 h. Add kanamycin to a final concentration of 20 μg / ml. Incubate overnight on a horizontal shaker at 32℃, 200 rpm. After incubation, centrifuge at 8000 rpm, 4℃ for 10 min. Collect the supernatant in a centrifuge tube, add 1 / 5 volume of polyethylene glycol-sodium chloride (20% PEG, 2.5M NaCl), and incubate on ice for 1 h. After the ice incubation, centrifuge at 10,000 rpm, 4℃ for 20 min. Discard the supernatant, resuspend the bacterial pellet with PBS, and store at 4℃.

[0055] 1.8 Phage ELISA

[0056] The purified EphA2 protein was diluted to 3 μg / ml with coating buffer (0.1 M NaHCO3 / Na2CO3) and coated overnight at 4°C. The coating buffer was discarded, and the plate was washed three times with PBST (0.05% Tween-20 added to PBS), 5 min each time. The wash buffer was discarded, and the plate was blocked with ELISA blocking buffer (PBST containing 5% skim milk powder) at 37°C for 1 h. After blocking, the plate was washed three times with washing buffer, 5 min each time. ELISA blocking buffer and a small amount of phage expression supernatant were added to each well in equal proportions, and the plate was incubated at 37°C for 1 h. After incubation, the plate was washed three times with washing buffer, 5 min each time. The bound phage antibody was detected using anti-M13 horseradish peroxidase (HRP) conjugated secondary antibody (Anti-M13-HRP). Anti-M13-HRP was diluted 1:5000 with blocking buffer and incubated at 37°C for 1 h. Wash four times with washing buffer, 5 min each time, and pat dry any remaining liquid in the wells. Incubate with tetramethylbenzidine liquid substrate (TMB) in the dark for 15 min, then stop the reaction by adding 50 μl of 2M H2SO4. 450Take the reading at the location.

[0057] 1.9 Phage ELISA

[0058] Prostate cancer cell line PC-3, hepatocellular carcinoma cell line HepG2, and lung adenocarcinoma cell line A549 were selected and analyzed using the Human Protein Atlas database (…). (http: / / www.proteinatlas.org) The expression of the EphA2 gene in each cell line was analyzed.

[0059] like Figure 1 As shown, PC-3, HepG2, and A549 cell lines exhibited significantly higher EphA2 expression levels compared to other cell lines in male reproductive system tumors, hepatobiliary tumors, and lung cancer cell lines, respectively. Phage cell ELISA experiments were performed on these three cell lines to screen for EphA2-ScFv cells that highly bind to tumor cells.

[0060] Cells were digested with trypsin and the cell density was adjusted to 1.0 × 10⁶ cells / year using complete culture medium (Gibco 1640 medium containing 10% fetal bovine serum). 5 Cells / ml, 100 μl per well, are seeded into a 96-well plate and incubated in a 5% CO2 incubator for 24–48 h to achieve a cell density of 80%–90% in each well. The culture medium is discarded, and the plate is washed twice with 1×PBS for 5 min each time. After the plate dries, 80 μl of fixative (0.25% glutaraldehyde solution prepared with PBS) is added to each well, and fixation is performed for 10 min. The fixative is discarded, and the plate is washed three times with 1×PBS for 5 min each time. 1×PBS is discarded, and the plate is blocked with ELISA blocking buffer at 37°C for 1 h. After blocking, the plate is washed three times with 1×PBST for 5 min each time. A 1:1 mixture of blocking buffer and phage expression supernatant is added to each well, and the plate is incubated at 37°C for 1 h. After incubation, the plate is washed three times with 1×PBST for 5 min each time. The binding of phage antibodies was detected using anti-M13-HRP. Anti-M13-HRP was diluted 1:5000 with washing buffer and incubated at 37°C for 1 h. The plate was washed four times with 1×PBST washing buffer for 5 min each time, and the remaining liquid in the wells was patted dry. The plate was incubated with TMB in the dark for 15 min, and the reaction was terminated by adding 50 μl of 2M H2SO4. The reaction was then carried out at OD... 450 Take the reading at the location.

[0061] 1.10 Homologous recombination and expression of EphA2 bivalent recombinant antibody ScFv-Fc

[0062] Based on human IgG-Fc (crystallizable fragment), EphA2-ScFv, which was screened to have good binding activity and specificity, was amplified by PCR. The amplification primers for scFv14, scFv77, and scFv179 were scFv14F, scFv14R; scFv77F, scFv77R; and scFv179F, scFv179R, respectively. The PCR products were recovered and homologously ligated into the sp-Fc / pcDNA3.1 recombinant vector (the structure of which has been disclosed in Chinese Patent ZL 201910738442.9, invention title "fully human anti-CD20 recombinant antibody") to recombinate EphA2-ScFv into bivalent EphA2-ScFv-Fc. The recombinant product was transformed into *E. coli* TOP10 competent cells. Colony PCR was performed using the upstream primer T7 of the pcDNA3.1 vector and the ScFv-specific downstream primers (scFv14R, scFv77R, scFv179R) to verify the presence of the ScFv target band. Gene sequencing was used to verify homologous recombination between ScFv and the recombinant vector. The homologous recombination pcDNA3.1 / SP-ScFv-Fc was used to extract plasmids using a plasmid extraction kit (Tiangen Biotech Co., Ltd.), and transfected with PEI to express the EphA2-ScFv-Fc fusion protein in 293F eukaryotic cells. On day 7 of expression, the supernatant was collected after centrifugation at 10,000 rpm for 10 min, and the antibody was purified from the supernatant using a protein A affinity chromatography column. The primer sequences are as follows:

[0063] The upstream primer T7 for the pcDNA3.1 vector is 5'-TAATACGACTCACTATAGGGAGA-3' (SEQ ID No. 14).

[0064] ScFv14F: 5'- CAGCTACAGGCACCCACGCC CAGGTGCAGCTACAGCAGT-3' (SEQ IDNo. ​​15),

[0065] ScFv14R: 5'- GGGCATGTATGGGTCTTATCTTTGATCTCCACCTTGGTCC-3' (SEQ IDNo.16),

[0066] ScFv77F:5'- CAGCTACAGGCACCCACGCC CAGGTCCAGCTTGTACAGTCT-3' (SEQ IDNo. ​​17),

[0067] ScFv77R:5'- GGGCATGTATGGGTCTTATC TAGGACGGTCACCTTGGTCC3' (SEQ IDNo. ​​18),

[0068] ScFv179F:5'- CAGCTACAGGCACCCACGCC CAGGTGCAGCTGGTGGAGTC-3' (SEQ IDNo. ​​19),

[0069] ScFv179R: 5'-GGGCATGTATGGGTCTTATCTAGGACGGTCACCTTGGTCC-3' (SEQ ID No. 20).

[0070] 1.11 Purification of EphA2 fusion protein

[0071] Each anti-EphA2 expression supernatant was bound to protein A resin (resuspended in 1×PBS) overnight at 4°C. The bound fusion protein was added to a gravity column that had been equilibrated, washed five times with 1×PBS, and eluted with elution buffer (0.1M Gly-HCl, pH 3.0) to achieve a final pH of 7.0. The fusion protein was collected and dialyzed with pre-cooled 1×PBS overnight at 4°C.

[0072] 1.12 Flow cytometry fluorescence sorting technology

[0073] PC-3 and A549 cells were digested with trypsin and counted to achieve a total cell count of 2 × 10⁻⁶ cells per tube. 5 Centrifuge at 1000 rpm for 5 min at room temperature, discard the supernatant, and resuspend the cells in 1×PBS. Add purified bivalent recombinant antibody ScFv-Fc to each tube to final concentrations of 20 μg / ml, 10 μg / ml, 5 μg / ml, 2.5 μg / ml, and 1.25 μg / ml, respectively. The blank control group is 1×PBS. Incubate at 4℃ for 1 h. After incubation, centrifuge at 1000 rpm for 5 min at room temperature and discard the complete culture medium. Add 500 μl of 1×PBS to each tube to resuspend the cells, centrifuge at 1000 rpm for 5 min at room temperature, and discard the supernatant. Repeat twice to remove recombinant antibody ScFv-Fc that has not bound to the EphA2 antigen on the surface of tumor cells. Add Alex Fluo-488 anti-Human-IgG fluorescent antibody diluted 1:500 in the dark, and incubate at 4℃ for 1 h. Centrifuge at 1000 rpm for 5 min at room temperature and discard the supernatant. Wash the cells twice with 1×PBS. Finally, the cells were resuspended in 100 μl of 1×PBS, and the cell suspension was collected in a flow cytometry tube for analysis using a flow cytometer.

[0074] 1.13 Immunohistochemical Techniques

[0075] Lung adenocarcinoma tissue and adjacent normal tissue were fixed, dehydrated, embedded, and sectioned. Dewaxed sections were placed in hydrogen peroxide (containing 3% methanol) at room temperature for 10 min, then washed with 1×PBS. The tissue sections were then immersed in 0.01M citrate buffer (pH 6.0) and heated to boiling. After cooling, they were washed with PBS. Blocking buffer (goat serum) was added and incubated at room temperature for 20 min. The purified bivalent recombinant antibody EphA2-ScFv-Fc was added as the primary antibody and incubated overnight at 4°C. Goat-anti-human-IgG-HRP was added as the secondary antibody and incubated at 37°C for 90 min. After incubation, the sections were washed with 1×PBS. Color development was performed using a DAB chromogenic kit (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.). After light counterstaining with hematoxylin, the sections were mounted with neutral resin.

[0076] 1.14 CCK8 cell proliferation experiment

[0077] A549 cells in good growth condition (logarithmic growth phase) were collected, digested with trypsin to prepare a cell suspension, and then distributed at 6 × 10⁶ cells per well. 4 100 μL of antibody at a density of 0 μg / ml was evenly spread into 96-well cell culture plates and incubated at 37°C with 5% CO2 for 24 h. The antibody was diluted with Gibco 1640 medium to final concentrations of 0 μg / ml, 1.25 μg / ml, 5 μg / ml, and 10 μg / ml, with 100 μL added to each well. The negative control group received only an equal volume of culture medium without antibody. Each concentration was tested in triplicate. The blank control group consisted of an antibody-added group and a non-antibody group. After slowly adding and labeling the antibody, the 96-well plates were incubated for 72 h. After incubation, 1 μL of CCK8 reagent was added to each well and mixed thoroughly. After 1 h of incubation, the 96-well plates were removed, and the OD was measured using a microplate reader. 450 The absorbance value at nm was used to calculate cell survival rate and inhibition rate against tumor cells.

[0078] 2. Results

[0079] 2.1 EphA2 significantly affects tumor survival and prognosis

[0080] Tumor cases were divided into high-expression and low-expression groups based on EphA2 expression levels. The TCGA dataset was used to study the correlation between EphA2 expression and prognosis in different tumor patients.

[0081] like Figure 1As shown, high expression of EphA2 was associated with poor prognosis in GBM (P=0.034), LGG (P=3.8e-07), LUAD (P=0.032), and PAAD (P=0.0074) tumors identified in the TCGA study. Disease-free survival analysis data ( Figure 1 The data from TCGA studies showed that high EphA2 expression in LGG (P=0.0035), PAAD (P=0.011), and other cancers was associated with poor prognosis. Furthermore, low EphA2 expression was associated with poor overall survival (OS) in KIRC (P=0.049) and THCA (P=0.029), and poor disease-free survival (DFS) in KIRC (P=0.015). These data indicate that the expression level of the EphA2 gene significantly affects the prognosis of cancer patients, and that EphA2 is an important target for cancer therapy.

[0082] 2.2 Construction of human ScFv phage display library

[0083] Peripheral blood mononuclear cells (PBMCs) were isolated from the peripheral blood of 200 cancer patients, and mRNA was extracted to synthesize first-strand cDNA. The synthesized cDNA formed smears of 0.1–8 kb on gels, with satisfactory size, intensity, and yield (data not shown). Using the first-strand cDNA as a template, variable regions of heavy chain genes (VH) and light chain genes (VL) were amplified. VL includes the Vλ and Vκ genes; the amplified VH, Vλ, and Vκ gene bands were approximately 400 bp in size. Figure 2 a-2c, M is the DL 2,000 bp DNA marker). The purified VH, VL (Vλ and Vκ) amplification products were subjected to overlap extension PCR to obtain the VH-linker-VL gene library (approximately 800 bp). Figure 2 d) A fully human ScFv DNA library was successfully constructed.

[0084] DNA from the ScFv library was ligated to the phage vector pCANTAB5E and transformed into *E. coli* TG1. Twenty single colonies were randomly selected, and the ScFv insert was identified by PCR. The results showed that all single colonies contained the full-length ScFv gene. DNA fingerprinting of ScFv DNA using BstNⅠ enzymes revealed that each ScFv was unique. Figure 2 e) The constructed human ScFv phage display library is diverse, and the gene sequences in the antibody library are abundant.

[0085] 2.3 Screening and Affinity Assessment of EphA2-ScFv

[0086] A liquid-phase screening method was used to add biotinylated EphA2 protein to an amplified ScFv library. Dynabeads M-280 (Invitgen) coated with streptavidin was used to capture and bind phage antibody-antigen complexes. After three rounds of enrichment screening, antibody clones targeting the target antigen were enriched. After each round of affinity screening, multiple single colonies were randomly selected, and ScFv DNA was digested with BstN I. DNA fingerprinting showed that after three rounds of enrichment affinity screening, the diversity of ScFv targeting the EphA2 antigen gradually decreased. Figure 2 fh), the specificity gradually increases and the affinity continuously increases.

[0087] After three rounds of enrichment and affinity screening, 240 single-clone colonies were randomly selected for expression. The binding activity of the low-expressed scFv to the target antigen EphA2 was detected using ELISA. Based on OD... 450 The results were used to preserve the strain. The preserved strain was then subjected to another ELISA experiment to determine whether it stably expressed ScFv( Figure 3 a) Screening for ScFvs that exhibit high binding activity and stability to the target antigen EphA2. Results showed that approximately 83% were ELISA positive, with the OD value of the positive reaction being twice that of the negative reaction.

[0088] Tumor cells PC-3, HepG2, and A549 were fixed with fixatives, respectively. Based on the results of phage ELISA, ScFv, which had undergone multiple rounds of screening and highly bound to the target antigen EphA2, was used as the primary antibody, and anti-M13-HRP was used as the secondary antibody for cell ELISA. The binding activity of the screened anti-EphA2 ScFv to the tumor cell surface antigen was detected, as shown in the figure. Figure 3 (b~3d) All 28 screened anti-EphA2 ScFv strains could bind to the EphA2 antigen on the surface of three types of tumor cells, OD 450 The value was higher in the negative control well than in the negative control well.

[0089] 2.4 Homologous recombination and expression of EphA2-ScFv-Fc

[0090] After multiple rounds of affinity selection, anti-EphA2 scFvs were selected based on their OD values ​​at 450 nm. ScFvs with higher OD values ​​were then sequenced and an Fc fragment was added to form bivalent recombinant antibodies. Three selected scFvs (scFv14, scFv77, and scFv179) were ligated into a recombinant vector, and the recombinant products were transformed into *E. coli* TOP10 competent cells. Colony PCR amplification was performed using the upstream primer T7 of the pcDNA3.1 vector and the scFv-specific downstream primer. The results confirmed the presence of the scFv target band, with a band size of approximately 800 bp. Figure 4a~4c, M is the DL 2000 bp DNA Marker), and subsequent gene sequencing confirmed that the three ScFv strains successfully underwent homologous recombination with the recombinant vector.

[0091] The amino acid sequence of the heavy chain variable region of scFv14 is shown in SEQ ID No. 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 2; the amino acid sequence of the heavy chain variable region of scFv77 is shown in SEQ ID No. 3, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 4; the amino acid sequence of the heavy chain variable region of scFv179 is shown in SEQ ID No. 5, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 6.

[0092] The constructed pcDNA3.1 / SP-ScFv-Fc expression vector was transiently co-transfected into 293F eukaryotic cells. Expression supernatant was collected on day 7 of expression. The collected expression supernatant was purified using protein A resin, and the expression supernatant before and after purification was verified by SDS-PAGE. Figure 4 d) The results showed that the target protein was well purified, and its molecular size was approximately 50 kDa.

[0093] 2.5 Affinity Identification of EphA2 Bivalent Recombinant Antibody ScFv-Fc

[0094] (1) Binding activity of bivalent recombinant antibody ScFv-Fc to tumor cell surface antigen

[0095] Prostate cancer cells (PC-3) and lung adenocarcinoma cells (A549) are tumor cells that highly express the EphA2 receptor. We screened for ScFv cells that bind to the extracellular domain of the EphA2 receptor using a phage antibody library. Using molecular biology techniques, the Fc fragment was added to ScFv cells to construct a bivalent recombinant antibody. Flow cytometry was used to detect the binding ability of the recombinant antibody to the EphA2 receptor. The recombinant antibody was co-incubated with tumor cells at 4°C for 1 hour. The final concentrations of the recombinant antibody were 20 μg / ml, 10 μg / ml, 2.5 μg / ml, and 1.25 μg / ml, respectively, and reacted with PC-3 and A549 cells. Flow cytometry was used to detect the binding. Figure 5 (a~5b).

[0096] Binding to PC-3 cells showed that recombinant antibody 179 (scFv179-Fc) and recombinant antibody 77 (scFv77-Fc) at concentrations of 1.25 μg / ml and above achieved binding rates exceeding 99%, while recombinant antibody 14 (scFv14-Fc) at concentrations of 2.5 μg / ml and above achieved binding rates exceeding 86%. Binding to A549 cells showed that recombinant antibody 77 at concentrations of 1.25 μg / ml and above achieved binding rates exceeding 99%, recombinant antibody 179 at concentrations of 2.5 μg / ml and above achieved binding rates exceeding 93%, and recombinant antibody 14 at concentrations of 2.5 μg / ml and above achieved binding rates exceeding 81%. These results indicate that the three bivalent recombinant antibodies we constructed can effectively bind to the EphA2 receptor on PC-3 and A549 cells. Furthermore, the average fluorescence intensity was positively correlated with the antibody concentration. Figure 5 c~5d).

[0097] The amino acid sequence of scFv14-Fc is shown in SEQ ID No. 7; the amino acid sequence of scFv77-Fc is shown in SEQ ID No. 8; the amino acid sequence of scFv179-Fc is shown in SEQ ID No. 9; and the nucleotide coding sequences of scFv14-Fc, scFv77-Fc, and scFv179-Fc are shown in SEQ ID No. 21, SEQ ID No. 22, and SEQ ID No. 23, respectively.

[0098] (2) Binding of bivalent recombinant antibody ScFv-Fc to tumor surface antigen

[0099] Immunohistochemical results showed that all three purified bivalent recombinant antibodies, ScFv-Fc, effectively bound to the EphA2 antigen on the surface of cancer tissue, exhibiting good binding efficacy. The purified bivalent recombinant antibody ScFv-Fc possessed high affinity and binding activity. Simultaneously, we performed semi-quantitative analysis on different samples using Image-Pro Plus 6.0 software. Using the entire image area (2048×1536 pixels) as the measurement area, we calculated the average optical density values ​​of positive expression in lung adenocarcinoma tissue and adjacent normal tissue. The results indicated that EphA2 was highly expressed in lung adenocarcinoma tissue, and the expression difference between cancer tissue and adjacent normal tissue was significant. Figure 6 ).

[0100] 2.6 Inhibitory effect of anti-EphA2 antibody on the proliferation of lung cancer cells A549

[0101] The results of culturing A549 cells in good growth condition with 0 μg / ml, 1.25 μg / ml, 5 μg / ml, and 10 μg / ml anti-EphA2 scFv-Fc antibody for 72 h showed that: scFv179-Fc antibody inhibited A549 cell growth by 14%, 55%, and 76% respectively; scFv77-Fc antibody inhibited A549 cell growth by 3%, 17%, and 74%; and scFv14-Fc antibody inhibited A549 cell growth by 74%, 74%, and 77%. Compared with the negative control without antibody, all three antibodies at a concentration of 10 μg / ml significantly inhibited the growth of A549 tumor cells. Figure 7 ).

Claims

1. A fully human single-chain antibody against EphA2, characterized in that: The single-chain antibody is scFv179; the amino acid sequence of the heavy chain variable region of scFv179 is shown in SEQ ID No. 5, and the amino acid sequence of the light chain variable region is shown in SEQ ID No.

6.

2. The anti-EphA2 fully human single-chain antibody as described in claim 1, characterized in that: The heavy chain variable region and the light chain variable region of the single-chain antibody are linked by a linker peptide, the amino acid sequence of which is (Gly4Ser)3.

3. A fully human bivalent recombinant antibody against EphA2, characterized in that: The recombinant antibody is scFv179-Fc; the recombinant antibody comprises the amino acid sequence of the single-chain antibody and the constant region Fc segment of the human antibody as described in claim 2.

4. The anti-EphA2 fully human bivalent recombinant antibody as described in claim 3, characterized in that: The amino acid sequence of the scFv179-Fc is shown in SEQ ID No.

9.

5. A polynucleotide molecule encoding the anti-EphA2 fully human bivalent recombinant antibody as described in claim 3 or 4.

6. A recombinant DNA expression vector comprising the polynucleotide molecule of claim 5.

7. Use of the anti-EphA2 fully human single-chain antibody according to claim 1 or 2 or the anti-EphA2 fully human bivalent recombinant antibody according to claim 3 or 4 in the preparation of an antitumor drug, wherein the tumor is prostate cancer, hepatocellular carcinoma or lung adenocarcinoma.

Images