Use of reagent for detecting methylation level of CpG island region of GYPC gene
This kit, which detects the methylation level of the CpG island region of the GYPC gene, solves the problems of invasiveness and diagnostic accuracy in existing gastric cancer screening methods, achieving highly sensitive and specific gastric cancer diagnosis. It is suitable for non-invasive or minimally invasive detection of samples such as saliva, urine, and blood.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WUHAN AIMISEN LIFE TECH CO LTD
- Filing Date
- 2022-04-21
- Publication Date
- 2026-07-31
AI Technical Summary
Existing methods for detecting gastric cancer, such as gastroscopy and imaging examinations, are highly invasive, have poor patient compliance, and low diagnostic accuracy. Furthermore, the biomarkers in liquid biopsy technology lack specificity and sensitivity in the diagnosis of gastric cancer and cannot accurately locate the organ where the tumor occurs.
A gastric cancer diagnostic kit was prepared using reagents to detect the methylation level of the CpG island region of the GYPC gene, and methods such as methylation-specific PCR and bisulfite sequencing. Non-invasive or minimally invasive detection was performed using samples such as saliva, urine, and blood.
It improves the sensitivity and specificity of gastric cancer diagnosis, enhances the detection rate of gastric cancer, is simple and quick, applicable to various sample types, and reduces the pain and risks of examination.
Smart Images

Figure CN116970698B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and more specifically, to the application of a reagent for detecting the methylation level of the CpG island region of the GYPC gene. Background Technology
[0002] Currently, gastroscopy is the gold standard for gastric cancer screening, and it, along with tissue biopsy, is the main traditional method for diagnosing gastric cancer. However, as an invasive procedure, patient compliance is poor, the examination process is painful, acceptance is low, and it may cause complications and other risks. Taking imaging screening for gastric cancer as an example, computed tomography (CT) is usually used to check the development and metastasis of gastric cancer. However, gastric cancer patients often do not have obvious clinical symptoms in the early stages, so it is difficult to make an accurate diagnosis using imaging examinations alone. Taking electronic fiberoptic gastroscopy as another example, due to the nonspecificity and diversity of early gastric cancer manifestations, as well as the differences in the experience and skills of physicians in different regions, its missed diagnosis rate fluctuates between 8% and 35%, and it is also heavily dependent on laboratory equipment and endoscopist resources.
[0003] With the rise of precision medicine, liquid biopsy (blood and other body fluids) technology plays a crucial role in cancer diagnosis. However, commonly used gastrointestinal tumor markers, such as carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), and carbohydrate antigens (CA72-4, CA19-9), exhibit significant differences in specificity and sensitivity when diagnosing gastrointestinal tumors, and cannot precisely locate the organ where the tumor occurs, thus limiting their clinical application value.
[0004] Therefore, there is an urgent need for highly sensitive biomarkers to specifically diagnose gastric cancer. Summary of the Invention
[0005] Therefore, the present invention aims to provide the application of a reagent for detecting the methylation level of the CpG island region of the GYPC gene in the preparation of a gastric cancer diagnostic kit. The present invention uses a reagent for detecting the methylation level of the CpG island region of the GYPC gene to prepare a gastric cancer diagnostic kit, which exhibits high detection sensitivity and specificity.
[0006] In a first aspect of the invention, the use of a reagent for detecting the methylation level of the CpG island region of the GYPC gene in the preparation of a gastric cancer diagnostic kit is provided.
[0007] In some embodiments of the present invention, with reference to GRCh38.p13, the CpG island region of the GYPC gene contains Chr2:126656121-126656595.
[0008] In some embodiments of the present invention, the CpG island region of the GYPC gene is selected from one or more of regions 1 to 8 as defined below:
[0009] Region 1: Chr2:126656121-126656254, positive chain;
[0010] Region 2: Chr2:126656237-126656378, positive chain;
[0011] Region 3: Chr2:126656382-126656500, positive chain;
[0012] Region 4: Chr2: 126656513-126656595, positive chain;
[0013] Region 5: Chr2: 126656595-126656463, negative chain;
[0014] Region 6: Chr2: 126656443-126656351, negative chain;
[0015] Region 7: Chr2: 126656329-126656235, negative chain;
[0016] Region 8: Chr2:126656205-126656125, negative chain.
[0017] In some embodiments of the present invention, the reagent is used to detect the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and quantitative fluorescence method.
[0018] In some embodiments of the present invention, the reagent comprises a detection primer pair for detecting one or more regions of the CpG island region 1 to region 8 of the GYPC gene and a detection probe corresponding to the detection primer pair.
[0019] In some embodiments of the present invention, the reagent comprises one or more combinations of the following detection primer pairs and corresponding detection probes:
[0020] The detection primer pair shown in SEQ ID No. 1-2 and the detection probe shown in SEQ ID No. 17 correspond to region 1.
[0021] The detection primer pair shown in SEQ ID No. 3-4 and the detection probe shown in SEQ ID No. 18 correspond to region 2.
[0022] The detection primer pair shown in SEQ ID No. 5-6 and the detection probe shown in SEQ ID No. 19 correspond to region 3.
[0023] The detection primer pair shown in SEQ ID No. 7-8 and the detection probe shown in SEQ ID No. 20 correspond to region 4.
[0024] The detection primer pair shown in SEQ ID No. 9-10 and the detection probe shown in SEQ ID No. 21 correspond to region 5.
[0025] The detection primer pair shown in SEQ ID No. 11-12 and the detection probe shown in SEQ ID No. 22 correspond to region 6.
[0026] The detection primer pair shown in SEQ ID No. 13-14 and the detection probe shown in SEQ ID No. 23 correspond to region 7.
[0027] The detection primer pair shown in SEQ ID No. 15-16 and the detection probe shown in SEQ ID No. 24 correspond to region 8.
[0028] In some embodiments of the present invention, the reagent further comprises amplification buffer, dNTPs, DNA polymerase, and Mg. 2+ One or more of them.
[0029] In some embodiments of the present invention, the reagent further comprises a primer pair for detecting an internal reference gene and a probe corresponding to the primer pair, wherein the internal reference gene comprises the ACTB gene, the primer pair for detecting the ACTB gene comprises the primers shown in SEQ ID No. 25-26, and the corresponding probe is shown in SEQ ID No. 27.
[0030] In some embodiments of the present invention, the detection probe and the control probe are labeled with a fluorescent reporter group and a fluorescent quencher group.
[0031] In some embodiments of the present invention, the fluorescent reporter group is selected from one or more of FAM, HEX, VIC, CY5, ROX, Texsa Red, JOE and Quasar 705.
[0032] In some embodiments of the present invention, the fluorescence quenching group is selected from one or more of MGB, BHQ1, BHQ2 and BHQ3.
[0033] In some embodiments of the present invention, the reagent further comprises one or more of a DNA extraction reagent and a reagent for converting unmethylated cytosine bases into uracil.
[0034] In a second aspect of the invention, a diagnostic kit for gastric cancer is provided, comprising the reagents defined in the first aspect of the invention.
[0035] In some embodiments of the present invention, the detection kit further includes amplification buffer, dNTPs, DNA polymerase, and Mg. 2+ One or more of them.
[0036] Compared with traditional technologies, the beneficial effects of the present invention include:
[0037] The GYPC gene is located on human chromosome 2, specifically at positions 126656158-126696668 bp. It encodes blood group glycoprotein C, a minor salivary glycoprotein carried on the membrane of human erythrocytes. GYPC protein plays a crucial role in regulating the mechanical stability of erythrocytes. This invention discovers that using the GYPC gene as a biomarker, by detecting methylation in its CpG island region, particularly the Chr2:126656121-126656595 region, gastric cancer can be diagnosed with high sensitivity and specificity, effectively improving the detection rate of gastric cancer. Gastric cancer diagnosis based on GYPC gene CpG island region methylation is applicable to a variety of sample types, including saliva, urine, and blood, facilitating non-invasive or minimally invasive detection, and is simple and rapid. Attached Figure Description
[0038] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0039] Figure 1 ROC curves were obtained for plasma samples from gastric cancer patients and normal individuals for the GYPC gene regions 1-8. Detailed Implementation
[0040] The present invention will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the invention. The purpose of providing these embodiments and examples is to enable a more thorough and complete understanding of the disclosure of the present invention. It should also be understood that the present invention can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present invention, and the equivalent forms obtained also fall within the protection scope of this application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present invention. It should be understood that the present invention can be implemented without one or more of these details.
[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for descriptive purposes only and is not intended to be limiting of the invention.
[0042] the term
[0043] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:
[0044] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").
[0045] In this invention, terms such as "multiple", "multi-items", "multiple times", and "multi-components" are used, and unless otherwise specified, they refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.
[0046] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.
[0047] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this invention, solve the technical problem of this invention, and achieve the expected technical effect of this invention.
[0048] In this article, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this invention.
[0049] In this invention, terms such as "further," "even more," and "particularly" are used for descriptive purposes and to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.
[0050] In this invention, "optionally," "optionally," and "optional" mean that they are optional, that is, they are selected from either "with" or "without." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "option" is independent.
[0051] In this invention, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on the quantity.
[0052] In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions that include the listed features.
[0053] In this invention, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.
[0054] In this disclosure, the term “gastric cancer” (which has the same meaning as “stomach cancer”) refers to cancer originating from the gastric mucosal epithelium, which can occur in the lining of the stomach and in the cardia, body, and antrum of the stomach.
[0055] In this disclosure, the term "diagnosis" includes aspects such as auxiliary diagnosis, recurrence risk assessment, assessment of cancer risk and degree, and prognosis.
[0056] The term "gene" refers to a segment of DNA that encodes a polypeptide chain that produces amino acids. It includes sequences located in coding and non-coding regions that are involved in gene transcription / translation and transcription / translation regulation, as well as exon and intron sequences.
[0057] The terms "oligonucleotide," "polynucleotide," "nucleotide," or "nucleic acid" refer to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the final function or use of the oligonucleotide. Oligonucleotides can be produced in any way, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.
[0058] The term "methylation" is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in a CpG dinucleotide of the genome, under the action of DNA methyltransferases. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.
[0059] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides within a DNA sequence is methylated, or the frequency / proportion / percentage of methylation. It represents both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels depending on the specific circumstances. For example, in some cases, comparisons can be made based on the Ct values of the samples; in others, the proportion of gene methylation in the sample can be calculated as (number of methylated molecules / (number of methylated molecules + number of unmethylated molecules)) × 100, and then compared; in still others, statistical analysis and integration of various indicators are necessary to arrive at a final judgment criterion.
[0060] The term "CpG island" refers to a region on DNA rich in cytosine and guanine linked by phosphate ester bonds. CpG dinucleotides are typically concentrated in promoter regions and exons of human genes. In the normal human genome, CpG sites outside CpG islands are usually methylated, while CpG sites within CpG islands are usually unmethylated. This form of methylation is stably inherited with cell division. When tumors develop, the degree of unmethylation of CpG sites outside CpG islands increases, while CpG sites within CpG islands become hypermethylated, leading to increased chromosome helicalization, transcriptional repression, and loss of gene expression.
[0061] The term "methylation level of a CpG island region" refers to the methylation level of cytosine in one or more CpG dinucleotides within a CpG island. "Methylation site" refers to at least one CpG dinucleotide site within the region, and more particularly, cytosine in at least one CpG dinucleotide site within the region.
[0062] The term "primer" refers to an oligonucleotide that can be used in amplification methods (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a region thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific to that polynucleotide sequence. The exact length of a primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but may also contain fewer nucleotides. In this disclosure, the term "primer" refers to a pair of primers capable of hybridizing to the double strand of a target DNA molecule or to regions of the target DNA molecule located on either side of the nucleotide sequence to be amplified.
[0063] The term "TaqMan probe" refers to an oligonucleotide sequence containing a 5' fluorescent group and a 3' quencher group. When the probe binds to the corresponding site on DNA, it does not fluoresce because of the presence of the quencher group near the fluorescent group. During amplification, if the probe binds to the strand being amplified, the 5'-3' exonuclease activity of a DNA polymerase (such as Taq polymerase) digests the probe. Since the fluorescent group is far from the quencher group, its energy is not absorbed, thus producing a fluorescent signal. With each PCR cycle, the fluorescence signal, like the target fragment, undergoes a synchronous exponential growth process.
[0064] The term "methylation-specific PCR" is one of the most sensitive experimental techniques for studying methylation, capable of detecting methylation in as little as approximately 50 pg of DNA. After single-stranded DNA undergoes bisulfite conversion, all unmethylated cytosine is deaminated to uracil, while methylated cytosine at CpG sites remains unchanged. Therefore, two pairs of primers are designed, one for methylated and one for unmethylated sequences, and PCR amplification can distinguish between methylated and unmethylated DNA sequences. In this disclosure, methylation primers are added during real-time quantitative methylation-specific PCR. If the Ct value meets the aforementioned requirements (e.g., Ct ≤ 38 in tissue samples), it indicates that the target sequence is methylated.
[0065] First aspect of the invention
[0066] This invention provides the application of a reagent for detecting the methylation level of the CpG island region of the GYPC gene in the preparation of a gastric cancer diagnostic kit.
[0067] In some embodiments of the present invention, with reference to GRCh38.p13, the CpG island region of the GYPC gene contains Chr2:126656121-126656595.
[0068] The GYPC gene is located on human chromosome 2, specifically at positions 126656158-126696668 bp. All loci or regions mentioned in this article refer to GRCh38.p13. GYPC (glycophorin C) encodes the blood group glycoprotein C, a minor salivary glycoprotein carried on the human erythrocyte membrane. GYPC plays a crucial role in regulating the mechanical stability of erythrocytes. This invention discovers that using the GYPC gene as a biomarker, by detecting methylation of its CpG island region, particularly the Chr2:126656121-126656595 region, gastric cancer can be diagnosed with high sensitivity and specificity, effectively improving the detection rate of gastric cancer. Gastric cancer diagnosis based on GYPC gene CpG island region methylation is applicable to a variety of sample types, including saliva, urine, and blood, facilitating non-invasive or minimally invasive detection, and is simple and rapid.
[0069] In some embodiments of the present invention, the CpG island region of the GYPC gene is selected from one or more of regions 1 to 8 as defined below:
[0070] Region 1: Chr2:126656121-126656254, positive chain;
[0071] Region 2: Chr2:126656237-126656378, positive chain;
[0072] Region 3: Chr2:126656382-126656500, positive chain;
[0073] Region 4: Chr2: 126656513-126656595, positive chain;
[0074] Region 5: Chr2: 126656595-126656463, negative chain;
[0075] Region 6: Chr2: 126656443-126656351, negative chain;
[0076] Region 7: Chr2: 126656329-126656235, negative chain;
[0077] Region 8: Chr2:126656205-126656125, negative chain.
[0078] Preferably, the CpG island region of the GYPC gene is selected from one or more of regions 2, 3, 4, 5, and 7. More preferably, the CpG island region of the GYPC gene is selected from one or more of regions 2 and 7.
[0079] In some embodiments of the present invention, the reagent is used to detect the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and quantitative fluorescence method.
[0080] In some embodiments of the present invention, the reagent comprises a detection primer pair for detecting one or more regions of the CpG island region 1 to region 8 of the GYPC gene and a detection probe corresponding to the detection primer pair.
[0081] In some embodiments of the present invention, the reagent comprises one or more combinations of the following detection primer pairs and corresponding detection probes:
[0082] The detection primer pair shown in SEQ ID No. 1-2 and the detection probe shown in SEQ ID No. 17 correspond to region 1.
[0083] The detection primer pair shown in SEQ ID No. 3-4 and the detection probe shown in SEQ ID No. 18 correspond to region 2.
[0084] The detection primer pair shown in SEQ ID No. 5-6 and the detection probe shown in SEQ ID No. 19 correspond to region 3.
[0085] The detection primer pair shown in SEQ ID No. 7-8 and the detection probe shown in SEQ ID No. 20 correspond to region 4.
[0086] The detection primer pair shown in SEQ ID No. 9-10 and the detection probe shown in SEQ ID No. 21 correspond to region 5.
[0087] The detection primer pair shown in SEQ ID No. 11-12 and the detection probe shown in SEQ ID No. 22 correspond to region 6.
[0088] The detection primer pair shown in SEQ ID No. 13-14 and the detection probe shown in SEQ ID No. 23 correspond to region 7.
[0089] The detection primer pair shown in SEQ ID No. 15-16 and the detection probe shown in SEQ ID No. 24 correspond to region 8.
[0090] Preferably, the reagent comprises one or more of the following: the detection primer pairs shown in SEQ ID No. 3-4 and the detection probe shown in SEQ ID No. 18; the detection primer pairs shown in SEQ ID No. 5-6 and the detection probe shown in SEQ ID No. 19; the detection primer pairs shown in SEQ ID No. 7-8 and the detection probe shown in SEQ ID No. 20; the detection primer pairs shown in SEQ ID No. 9-10 and the detection probe shown in SEQ ID No. 21; and the detection primer pairs shown in SEQ ID No. 13-14 and the detection probe shown in SEQ ID No. 23. Further, the reagent comprises one or more of the following: the detection primer pairs shown in SEQ ID No. 3-4 and the detection probe shown in SEQ ID No. 18; the detection primer pairs shown in SEQ ID No. 13-14 and the detection probe shown in SEQ ID No. 23.
[0091] In some embodiments of the present invention, the reagent further comprises amplification buffer, dNTPs, DNA polymerase, and Mg. 2+ One or more of them.
[0092] In some embodiments of the present invention, the reagent further comprises a primer pair for detecting an internal reference gene and a probe corresponding to the primer pair, wherein the internal reference gene comprises the ACTB gene, the primer pair for detecting the ACTB gene comprises the primers shown in SEQ ID No. 25-26, and the corresponding probe is shown in SEQ ID No. 27.
[0093] Additionally, it should be noted that useful primers and probes include nucleotide sequences with greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the primers shown in SEQ ID NO: 1-16 or the probes in SEQ ID NO: 17-24. Modifications to such primers and probes are also considered and can be prepared according to standard techniques.
[0094] The term "% identity," in the context of two or more nucleotide or amino acid sequences, refers to two or more sequences or subsequences that are identical or have a specific percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence, as measured by one of the following sequence comparison algorithms or by visual inspection. For example, % identity is relative to the entire length of the coding region of the sequences to be compared.
[0095] For sequence comparisons, a reference sequence is typically used, and the test sequence is compared to this reference sequence. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, and subsequence coordinates are specified if necessary, along with the sequence algorithm program parameters. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. Percentage identity can be determined using search algorithms such as BLAST and PSI BLAST (Altschul et al., 1990, J Mol Biol 215:3, 403-410; Altschul et al., 1997, Nucleic Acids Res25:17, 3389-402).
[0096] Primer and probe modifications can be performed using well-known methods. Modified versions of these primer and / or probe sequences may include, by non-limiting examples, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' and 3' ends, adding a tail, shortening the sequence, lengthening the sequence, shifting the sequence upstream or downstream by several bases, or any combination thereof.
[0097] Base modifications, such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2'-deoxyadenosine, C-5-propynyl-deoxycytidine, C-5-propynyl-deoxyuridine, 2-amino-2'-deoxyadenosine-5'-triphosphate, 2,6-diaminopurine (2-amino-dA), reversed-dT, reversed-dideoxy-T, hydroxymethyl-dC, iso-dC, 5-methyl-dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNAs), including at least one mismatched base at one of the bases, or replacing at least one of the bases with an RNA base, can achieve, for example, increased nucleic acid interaction at the 3' end of mutant-specific primers to increase Tm. The addition of stable double-stranded base modifications has a positive effect on PCR, enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. Modified probes should retain the ability to distinguish between the mutant and wild-type sites to be detected.
[0098] In some embodiments of the present invention, the detection probe and the control probe are labeled with fluorescent reporter groups and fluorescent quencher groups.
[0099] In some embodiments of the present invention, the fluorescent reporter group is selected from one or more of FAM, HEX, VIC, CY5, ROX, TexsaRed, JOE and Quasar 705.
[0100] In some embodiments of the present invention, the fluorescence quenching group is selected from one or more of MGB, BHQ1, BHQ2 and BHQ3.
[0101] In some embodiments of the present invention, the reagent further comprises one or more of a DNA extraction reagent and a reagent for converting unmethylated cytosine bases into uracil.
[0102] In some embodiments of the present invention, a reagent for converting unmethylated cytosine bases into uracil is used, for example, a bisulfite.
[0103] In some embodiments of the present invention, the samples to be tested may be derived from blood (whole blood, preferably peripheral blood), plasma, cell culture supernatant, feces, saliva, semen, bronchoalveolar lavage fluid, amniotic fluid, villi, tissue or tissue lysate, bone or hair.
[0104] The term "tissue or tissue lysis fluid" used in this article can also be used interchangeably with terms such as "lysate," "lysed sample," and "tissue or cell extract," referring to samples and / or biological sample materials containing lysed tissue or cells, i.e., samples in which tissue or cells are lysed.
[0105] The structural integrity of the cells has been disrupted. To release the contents of a cell or tissue sample, the material is typically treated with enzymes and / or chemical reagents to dissolve, degrade, or destroy the cell walls and cell membranes of such tissues or cells. Skilled technicians are very familiar with the appropriate methods used to obtain lysates. This process is encompassed by the term "lysis".
[0106] Those skilled in the art will understand that the ideal diagnostic scenario is one where a single event or process causes a variety of diseases, especially when the etiology of the disease is not fully understood, such as in the case of many types of cancer, or the gastric cancer described in this application. As a skilled person will appreciate, for a given multifactorial disease, diagnosis without biochemical markers is 100% specific and 100% sensitive; however, those skilled in the art are capable of using multiple disease markers or combining detection methods to increase the accuracy of the test.
[0107] Determining whether there is a significant difference between the initial state (baseline) of the subject and the healthy population / benign tumor control group / subject can be performed using statistical methods known in the art, and confirmed using confidence intervals and / or p-values. In some embodiments, the confidence intervals can be 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, or 99.99%, and the p-values can be 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001.
[0108] Second aspect of the invention
[0109] The present invention provides a diagnostic kit for gastric cancer, comprising the reagents defined in the first aspect.
[0110] Furthermore, the detection kit of the present invention also includes amplification buffer, dNTPs, DNA polymerase, and Mg. 2+ One or more of them. Specific Implementation
[0112] The embodiments of the present invention will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this invention, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0113] Example 1
[0114] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 1 and nucleic acid combination 9.
[0115] Nucleic acid combination 1 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 1-2 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 17. The specific sequences are shown in Table 1.
[0116] Nucleic acid combinatorial 1 can detect the methylation level of the positive strand of the Chr2:126656121-126656254 region (Region 1) on the GYPC gene. The nucleotide sequence of the positive strand of Region 1 is as follows (5'-3'):
[0117] CGGCCCGCGCGGGAGGAGTGGTGACCCAGGTGCCG C TTCCTCTCGCCGCCGAGGGTCAGGAGCCCGGGAGCGCGACCCTCCCCGGCCCGGCCTGGCCCGGCCTGGCCAGTCCCCGCGGTCTCTGCCCGGGCTGA (SEQ ID NO: 28)
[0118] Nucleic acid combination 1 can detect methylation of cytosine at positions Chr2:126656121, Chr2:126656126, Chr2:126656128, Chr2:126656130, Chr2:126656169, Chr2:126656184, Chr2:126656190, Chr2:126656236, and Chr2:126656247 on the positive strand of region 1.
[0119] Example 2
[0120] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 2 and nucleic acid combination 9.
[0121] Nucleic acid combination 2 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 3-4 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 18. The specific sequences are shown in Table 1.
[0122] Nucleic acid combinatorial 2 can detect the methylation level of the positive strand of the Chr2:126656237-126656378 region (Region 2) on the GYPC gene. The nucleotide sequence of the positive strand of Region 2 is as follows (5'-3'):
[0123] GGTCTCTGCCCGGGCTGA CGCCCAGGAATGTGGTCGACGAGAAGCCCCAACAGCACGGCGTGGCCTCT CAGCCTCGGTGAGTACCCGCCGTGGGGAAGGGTCCTGGGGACCCACTGGAGGCCGCGGCCCGCAGCAGCCAGGG (SEQ ID NO: 29)
[0124] Nucleic acid combination 2 can detect methylation of cytosine at positions Chr2:126656247, Chr2:126656255, Chr2:126656311, Chr2:126656322, Chr2:126656325, Chr2:126656358, Chr2:126656360, and Chr2:126656365 on the positive strand of region 2.
[0125] Example 3
[0126] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 3 and nucleic acid combination 9.
[0127] Nucleic acid combination 3 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 5-6 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 19. The specific sequences are shown in Table 1.
[0128] Nucleic acid combinatorial 3 can detect the methylation level of the positive strand of the Chr2:126656382-126656500 region (region 3) on the GYPC gene. The nucleotide sequence of the positive strand of region 3 is as follows (5'-3'):
[0129] GAGCCACGGCCACGGACGCCCTGGTGTCCCGGTCCGTGCCGGGCCTCCAGGCGGAGGAGGCGTCCGCTGGGCTCAGATCCCGACTCCAGCCCCGGTTCCCCGGCGCCTGGGCTGCGCG (SEQ ID NO: 30)
[0130] Nucleic acid combination 3 can detect methylation of cytosine at positions Chr2:126656388, Chr2:126656394, Chr2:126656398, Chr2:126656411, Chr2:126656416, Chr2:126656421, Chr2:126656433, Chr2:126656486, Chr2:126656497, and Chr2:126656499 on the positive strand of region 3.
[0131] Example 4
[0132] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 4 and nucleic acid combination 9.
[0133] Nucleic acid combination 4 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 7-8 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 20. The specific sequences are shown in Table 1.
[0134] Nucleic acid combinatorial 4 can detect the methylation level of the positive strand of the Chr2:126656513-126656595 region (region 4) on the GYPC gene. The nucleotide sequence of the positive strand of region 4 is as follows (5'-3'):
[0135] CGCGTCCCGGACCCCTACGCGCAGCCTCCACGCGCTCCGAGCTGGAGAAGCCGCCAGCCCGCCCTCCCAGGGCGTGTCGCCCG (SEQ ID NO: 31)
[0136] Nucleic acid combination 4 can detect methylation of cytosine at positions Chr2:126656513, Chr2:126656515, Chr2:126656520, Chr2:126656530, Chr2:126656543, Chr2:126656545, Chr2:126656550, Chr2:126656564, Chr2:126656585, Chr2:126656590, and Chr2:126656594 on the positive strand of region 4.
[0137] Example 5
[0138] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 5 and nucleic acid combination 9.
[0139] Nucleic acid combination 5 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 9-10 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 21. The specific sequences are shown in Table 1.
[0140] Nucleic acid combinatorial 5 can detect the methylation level of the negative strand of the Chr2:126656595-126656463 region (region 5) on the GYPC gene. The nucleotide sequence of the negative strand of region 5 is as follows (5'-3'):
[0141] CGGGCGACACGCCCTGGGAGGGCGGGCTGGCGGCTTCTCCAGCTCGGAGCGCGTGGAGGCTGCGCGTAGGGGTCCGGGACGCGGGACAGGG A CTCCGCGCAGCCCAGGCGCCGGGGAACCGGGGCTGGAGTCG (SEQ ID NO: 32)
[0142] Nucleic acid combination 5 can detect methylation of cytosine at positions Chr2:126656595, Chr2:126656591, Chr2:126656586, Chr2:126656546, Chr2:126656544, Chr2:126656533, Chr2:126656531, Chr2:126656476, and Chr2:126656464 on the negative strand of region 5.
[0143] Example 6
[0144] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 6 and nucleic acid combination 9. Nucleic acid combination 6 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 11-12 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 22, the specific sequences of which are shown in Table 1.
[0145] Nucleic acid combinatorial 6 can detect the methylation level of the negative strand of the Chr2:126656443-126656351 region (region 6) on the GYPC gene. The nucleotide sequence of the negative strand of region 6 is as follows (5'-3'):
[0146] CGCCTCTCCGCCTGGAGGCCCGGCACGGACCGGGACACCAGGGCGTCCGTGGCCGTGGCTCGGCCCCTGGCTGCTGCGGGCCGCGGCCTCCA (SEQ ID NO: 33)
[0147] Nucleic acid combination 6 can detect methylation of cytosine at positions Chr2:126656443, Chr2:126656434, Chr2:126656422, Chr2:126656417, Chr2:126656412, Chr2:126656399, Chr2:126656366, Chr2:126656361, and Chr2:126656359 on the negative strand of region 6.
[0148] Example 7
[0149] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, which includes nucleic acid combination 7 and nucleic acid combination 9.
[0150] Nucleic acid combination 7 includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 13-14 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 23. The specific sequences are shown in Table 1.
[0151] Nucleic acid combinatorial 7 can detect the methylation level of the negative strand of the Chr2:126656329-126656235 region (region 7) on the GYPC gene. The nucleotide sequence of the negative strand of region 7 is as follows (5'-3'):
[0152] CCACGGCGGGTACTCACCGAGGCTG AGAGGCCACGCCGTGCTGTTGGGGCTTCTCGTCGACCAC ATTCCTGGGCG TCAGCCCGGGCAGAGACCGC (SEQ ID NO: 34)
[0153] Nucleic acid combination 7 can detect methylation of cytosine at positions Chr2:126656326, Chr2:126656323, Chr2:126656312, Chr2:126656293, Chr2:126656275, Chr2:126656272, Chr2:126656256, Chr2:126656248, Chr2:126656237, and Chr2:126656235 on the negative strand of region 7.
[0154] Example 8
[0155] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 8 and nucleic acid combination 9. Nucleic acid combination 8 includes a primer pair with nucleotide sequences as shown in SEQ ID NO: 15-16 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 24, the specific sequences of which are shown in Table 1.
[0156] Nucleic acid combinatorial 8 can detect the methylation level of the negative strand of the Chr2:126656205-126656125 region (region 8) on the GYPC gene. The nucleotide sequence of the negative strand of region 8 is as follows (5'-3'):
[0157] CCGGGGGAGGGTCGCGCTCCCGGGCTCCTGACCCTCGGCGGCGAGAGGAA G CGGCACCTGGGTCACACTCCTCCCGCGCGG (SEQ ID NO: 35)
[0158] Nucleic acid combination 8 can detect methylation of cytosine at positions Chr2:126656204, Chr2:126656193, Chr2:126656191, Chr2:126656170, Chr2:126656167, Chr2:126656164, Chr2:126656131, Chr2:126656129, and Chr2:126656127 on the positive strand of region 8.
[0159] Table 1. Primer and probe sequences for each region of the target gene.
[0160]
[0161]
[0162] Example 9
[0163] This embodiment provides a method for diagnosing or assisting in the diagnosis of gastric cancer using any one or more of the reagent kits from Examples 1-8, which includes the following steps:
[0164] 1. DNA template extraction:
[0165] For tissue samples, DNA was extracted using the QIAamp DNA FFPE Tissue Kit (56404), following the instructions in the kit's manual.
[0166] For blood samples, the plasma cfDNA was extracted using the Magnetic Bead Method Serum / Plasma Free DNA (cfDNA) Extraction Kit (DP709) from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the specific operation was carried out according to the kit instructions. In addition, the genomic DNA of white blood cells was extracted using the Blood / Cells / Tissues Genomic DNA Extraction Kit (DP304) from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the specific operation can be found in the kit instructions.
[0167] 2. Bisulfite conversion
[0168] The extracted sample genomic DNA was subjected to bisulfite conversion using the Nucleic Acid Conversion Reagent (E Han Xie Bei 20200843) from Wuhan Aimisen Life Science and Technology Co., Ltd., and the specific experimental operation was referred to the kit instructions.
[0169] 3. Methylation quantitative PCR reaction
[0170] Using the bisulfite-converted sample DNA as a template, the primers and probes in Table 1 were used respectively, and the reaction system was configured according to the formula in Table 2. The methylation quantitative PCR reaction was carried out using Invitrogen Platinum II Taq Hot Start DNA Polymerase, and the PCR reaction conditions were shown in Table 3. Each PCR reaction can detect the methylation level of a region of the GYPC gene in a certain sample. That is, in addition to adding the necessary reaction components and template to a reaction tube, the detection primers and probes corresponding to a target gene region need to be added, and at the same time, the primers and probes of the internal reference gene ACTB also need to be added. The probe for the detected target region is a Taqman probe, the reporter group at the 5' end is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5' end of the ACTB probe is VIC, and the quenching group at the 3' end is BHQ1.
[0171] Table 2. Composition of each component in the PCR reaction system
[0172]
[0173]
[0174] Table 3. PCR reaction conditions
[0175]
[0176] Negative and positive controls: When detecting different regions of the target gene separately, negative and positive controls should be detected simultaneously. The negative control is purified water. The positive control is prepared as follows: the sequence corresponding to the amplified region of ACTB after complete bisulfite conversion is artificially synthesized and cloned into a vector to form a synthetic plasmid. The sequences corresponding to the fully methylated GYPC gene regions 1-8 after bisulfite conversion are artificially synthesized and cloned into vectors to form synthetic plasmids. The positive control for GYPC gene regions 1-8 is 10... 3 Copies / µL of artificially synthesized ACTB plasmid and 10 3 The artificially synthesized plasmids for regions 1-8 were mixed 1:1, with the positive control for region 1 being 10 copies / µL. 3 Copies / µL of artificially synthesized ACTB plasmid and 10 3 The artificially synthesized plasmid of region 1 was mixed 1:1 with copies / µL.
[0177] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1-2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.
[0178] Quality control: The negative control should show no amplification, the positive control should show a clear exponential growth phase, and the Ct value of the positive control should be between 26 and 30. The Ct value of the internal reference gene in the sample to be tested should be ≤35. If the negative control, positive control, and internal reference gene all meet the above requirements, the experiment is considered valid, and the next step of sample result determination can be carried out. Otherwise, the experiment is invalid and must be repeated.
[0179] 4. PCR Result Analysis
[0180] Results analysis and interpretation methods: For tissue samples, when the Ct value of a certain detection area on the sample is ≤38, it is considered that methylation has been detected in that area of the sample; if the Ct value of a certain detection area on the sample is >38, it is considered that the sample is methylation negative in that detection area. For plasma samples, ROC (receiver operating characteristic curve) analysis was performed on gastric cancer patient samples and healthy human samples based on the Ct value, and the sensitivity, specificity and AUC value at the maximum Youden's index were recorded.
[0181] Experimental Example 1
[0182] Cancer tissue samples from 58 gastric cancer patients and corresponding adjacent normal tissue samples were collected from a hospital in Wuhan. All samples were formalin-soaked and paraffin-embedded. The collection process was approved by the ethics committee, all volunteers signed informed consent forms, and all samples were anonymized. Genomic extraction and bisulfite conversion were performed on the samples according to the method described in Example 9. PCR amplification was then performed on regions 1-8 using the primer pairs and probes listed in Table 1 to detect the methylation status of each sample in each region. In this example, sensitivity was defined as the proportion of methylated positive samples with positive pathological results, and specificity as the proportion of methylated negative samples with negative pathological results. The PCR results are shown in Table 4.
[0183] Table 4. Sensitivity and specificity of GYPC gene regions 1-8 in tissue samples
[0184]
[0185] Table 4 shows that the detection efficacy of GYPC gene regions 1-8 differs between gastric cancer tissue samples and adjacent normal tissue samples. Overall, GYPC gene regions 1-8 exhibit a sensitivity exceeding 60% in gastric cancer tissue samples and a specificity exceeding 62% in adjacent normal tissue samples. Furthermore, GYPC gene regions 2 (Chr2:126656237-126656378) and 7 (Chr2:126656329-126656235) show significantly higher sensitivity and specificity in tissue samples than other regions. These two regions demonstrate a sensitivity greater than 81% in gastric cancer tissue samples and a specificity greater than 81% in adjacent normal tissue samples. Therefore, the GYPC gene regions Chr2:126656237-126656378 offer better detection results.
[0186] Experimental Example 2
[0187] Plasma samples were collected from patients diagnosed with gastric cancer by tissue biopsy and from healthy individuals at a hospital in Wuhan. Five mL of plasma was collected from each individual, resulting in 85 plasma samples from gastric cancer patients and 104 from healthy individuals. All sample collection processes were approved by the ethics committee, all volunteers signed informed consent forms, and all samples were anonymized. Plasma cfDNA extraction and bisulfite conversion were performed according to the method provided in Example 9. Quantitative PCR experiments targeting GYPC gene regions 1-8 were conducted using the specific primer and probe combinations from Examples 1-8. ROC analysis was performed based on the obtained Ct values. The sensitivity, specificity, and AUC values for gastric cancer patients were statistically analyzed using the methylation level of each region, as shown in Table 5. Figure 1 As shown.
[0188] Table 5. Sensitivity, specificity, and AUC values of GYPC gene regions 1-8 in plasma samples.
[0189] Area 1 64.7% 78.8% 0.721 Area 2 80.0% 88.5% 0.844 Area 3 74.1% 81.7% 0.784 Area 4 72.9% 81.7% 0.769 Area 5 76.5% 79.8% 0.785 Area 6 70.6% 82.7% 0.756 Area 7 84.7% 82.7% 0.847 Area 8 67.1% 80.8% 0.757
[0190] As shown in Table 5, although the detection results varied, GYPC gene regions 1-8 could effectively distinguish between gastric cancer plasma samples and healthy plasma samples. The AUC values for each region were all above 0.72, with a sensitivity of over 64% and a specificity of over 78%. Notably, GYPC gene regions 2 and 7 showed significantly higher AUC values than other regions, both exceeding 0.84. Furthermore, in plasma samples, these two regions demonstrated a sensitivity of ≥80% and a specificity of over 80% for gastric cancer detection. In summary, consistent with tissue samples, the GYPC gene regions Chr2:126656237-126656378 showed better detection results than the entire CpG island.
[0191] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0192] The above-described embodiments are merely illustrative of several implementation methods of the present invention, facilitating a detailed and specific understanding of the technical solutions of the present invention. However, they should not be construed as limiting the scope of protection of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Furthermore, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various alterations or modifications to the present invention, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided by the present invention through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this invention patent should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims. sequence list <110> Wuhan Aimeisen Life Technology Co., Ltd. <120> Application of reagents for detecting methylation levels in the CpG island region of the GYPC gene <160> 35 <170> SIPOSequenceListing 1.0 <210> 1 <211> 16 <212> DNA <213> Artificial Sequence <400> 1 aacggttcgc gcggga 16 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tcaacccgaa caaaaaccgc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 ggtttttgtt cgggttgacg 20 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 ccctaactac tacgaaccgc g 21 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 gagttacggt tacggacgtt ttg 23 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <400> 6 atcgcgcaac ccaaacg 17 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 acgcgtttcg gatttttacg 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 cgaacgacac gccctaaaa 19 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 tcgggcgata cgttttgg 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 acgactccaa ccccgattc 19 <210> 11 <211> twenty two <212> DNA <213> Artificial Sequence <400> 11 cgtttttttc gtttggaggt tc 22 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <400> 12 taaaaaccgc gacccgc 17 <210> 13 <211> twenty one <212> DNA <213> Artificial Sequence <400> 13 ttacggcggg tatttatcga g 21 <210> 14 <211> twenty two <212> DNA <213> Artificial Sequence <400> 14 gcgatctcta cccgaactaa cg 22 <210> 15 <211> 16 <212> DNA <213> Artificial Sequence <400> 15 ttcgggggag ggtcgc 16 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <400> 16 ccgcgcgaaa aaaatataac c 21 <210> 17 <211> twenty three <212> DNA <213> Artificial Sequence <400> 17 cgagggttag gagttcggga gcg 23 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 tttcggtgag tattcgtcgt gggga 25 <210> 19 <211> twenty three <212> DNA <213> Artificial Sequence <400> 19 cggttcgtgt cgggttttta ggc 23 <210> 20 <211> twenty three <212> DNA <213> Artificial Sequence <400> 20 cgcgtttcga gttggagaag tcg 23 <210> twenty one <211> 18 <212> DNA <213> Artificial Sequence <400> twenty one gcgcgtggag gttgcgcg 18 <210> twenty two <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty two ggtacggatc gggatattag ggcg 24 <210> twenty three <211> 25 <212> DNA <213> Artificial Sequence <400> twenty three gtcgtgttgt tggggttttt cgtcg 25 <210> twenty four <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty four ttttgatttt cggcggcgag ag 22 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <400> 25 aaggtggttg ggtggttgtt ttg 23 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <400> 26 aataacaccc ccaccctgc 19 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <400> 27 ggagtggttt ttgggtttg 19 <210> 28 <211> 134 <212> DNA <21ggtctctgcc cgggctgacg cccaggaatg tggtcgacga gaagccccaa cagcacggcg 60 tggcctctca gcctcggtga gtacccgccg tggggaaggg tcctggggac ccactggagg 120 ccgcggcccg cagcagccag gg 142 <210> 30 <211> 119 <212> DNA <213> Homo sapiens <400> 30 gagccacggc cacggacgcc ctggtgtccc ggtccgtgcc gggcctccag gcggaggagg 60 cgtccgctgg gctcagatcc ccgactccag ccccggttcc ccggcgcctg ggctgcgcg 119 <210> 31 <211> 83 <212> DNA <213> Homo sapiens <400> 31 cgcgtcccgg acccctacgc gcagcctcca cgcgctccga gctggagaag ccgccagccc 60 gccctcccag ggcgtgtcgc ccg 83 <210> 32 <211> 133 <212> DNA <213> Homo sapiens <400> 32 cgggcgacac gccctgggag ggcgggctgg cggcttctcc agctcggagc gcgtggaggc 60 tgcgcgtagg ggtccgggac gcgggacagg gactccgcgc agcccaggcg ccggggaacc 120 ggggctggag tcg 133 <210> 33 <211> 93 <212> DNA <213> Homo sapiens <400> 33 cgcctcctcc gcctggaggc ccggcacgga ccgggacacc agggcgtccg tggccgtggc 60 tcggcccctg gctgctgcgg gccgcggcct cca 93 <210> 34 <211> 95 <212> DNA <213> Homo sapiens <400> 34 ccacggcggg tactcaccga ggctgagagg ccacgccgtg ctgttggggc ttctcgtcga 60 ccacattcct gggcgtcagc ccgggcagag accgc 95 <210> 35 <211> 81 <212> DNA <213> Homo sapiens <400> 35 ccgggggagg gtcgcgctcc cgggctcctg accctcggcg gcgagaggaa gcggcacctg 60<000067><0>ggtcacactc ctcccgcgcg g 81
Claims
1. Application of reagents for detecting methylation levels in the CpG island region of the GYPC gene in the preparation of gastric cancer diagnostic kits; With reference to GRCh38.p13, the CpG island region of the GYPC gene contains Chr2:126656121-126656595; The CpG island region of the GYPC gene is selected from one or more of regions 1 to 8 as defined below: Region 1: Chr2:126656121-126656254, positive chain; Region 2: Chr2:126656237-126656378, positive chain; Region 3: Chr2:126656382-126656500, positive chain; Region 4: Chr2: 126656513-126656595, positive chain; Region 5: Chr2: 126656595-126656463, negative chain; Region 6: Chr2: 126656443-126656351, negative chain; Region 7: Chr2: 126656329-126656235, negative chain; Region 8: Chr2: 126656205-126656125, negative chain; The reagent comprises detection primer pairs for detecting one or more regions of the CpG island region 1 to region 8 of the GYPC gene and detection probes corresponding to the detection primer pairs; The detection primer pair and the corresponding detection probe include one or more of the following combinations: The detection primer pair shown in SEQ ID No. 1-2 and the detection probe shown in SEQ ID No. 17 correspond to region 1. The detection primer pair shown in SEQ ID No. 3-4 and the detection probe shown in SEQ ID No. 18 correspond to region 2. The detection primer pair shown in SEQ ID No. 5-6 and the detection probe shown in SEQ ID No. 19 correspond to region 3. The detection primer pair shown in SEQ ID No. 7-8 and the detection probe shown in SEQ ID No. 20 correspond to region 4. The detection primer pair shown in SEQ ID No. 9-10 and the detection probe shown in SEQ ID No. 21 correspond to region 5. The detection primer pair shown in SEQ ID No. 11-12 and the detection probe shown in SEQ ID No. 22 correspond to region 6. The detection primer pair shown in SEQ ID No. 13-14 and the detection probe shown in SEQ ID No. 23 correspond to region 7. The detection primer pair shown in SEQ ID No. 15-16 and the detection probe shown in SEQ ID No. 24 correspond to region 8.
2. The application according to claim 1, characterized in that, The reagent is used to detect the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray method, or methylation-specific high-resolution melting curve method.
3. The application according to claim 1, characterized in that, The reagent further comprises a primer pair for detecting an internal reference gene and a corresponding control probe for the primer pair. The internal reference gene includes the ACTB gene. The primer pair for detecting the ACTB gene includes the primers shown in SEQ ID No. 25-26, and the corresponding control probe is shown in SEQ ID No.
27.
4. The application according to claim 3, characterized in that, The detection probe and the control probe are labeled with fluorescent reporter groups and fluorescent quencher groups.
5. The application according to claim 4, characterized in that, The fluorescent reporter group is selected from one or more of FAM, HEX, VIC, CY5, ROX, Texas Red, JOE, or Quasar 705.
6. The application according to claim 4, characterized in that, The fluorescence quenching group is selected from one or more of MGB, BHQ1, BHQ2 or BHQ3.
7. The application according to any one of claims 1 to 3, characterized in that, The reagent also includes one or more of the following: DNA extraction reagents or reagents for converting unmethylated cytosine bases into uracil.
8. The application according to claim 7, characterized in that, The reagent used to convert unmethylated cytosine bases to uracil is a bisulfite.
9. The application according to any one of claims 1 to 3, characterized in that, The samples tested are blood, plasma, tissue, or tissue lysate.
10. A diagnostic kit for gastric cancer, characterized in that, The reagent comprises the reagents defined in any one of claims 1 to 9, and further comprises amplification buffer, dNTPs, DNA polymerase, or Mg 2+ One or more of them.