Genetic engineering application of b. chinensis bcERF070 gene
Patent Information
- Application Number
- CN202210440534.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-25
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2042-04-25
AI Technical Summary
[0048]Vc对人体及植物本身都具有非常重要的作用,本发明通过基因工程探究不结球白菜体内的Vc合成通路,对不结球白菜进行遗传改良。
Smart Images

Figure CN116987701B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and biotechnology, specifically relating to the application of the BcERF070 gene in regulating the vitamin C content of non-heading Chinese cabbage. Background Technology
[0002] Vitamin C (Vc), also known as L-ascorbic acid (AsA), plays a crucial role in plants' antioxidant systems, photosynthetic protection, and growth regulation, and provides us with a rich and convenient source of Vc. Research on Vc synthesis in plants is ongoing, and increasing AsA content and exploring gene function through genetic engineering is a current research hotspot.
[0003] Non-heading Chinese cabbage belongs to the Brassica genus of the Brassicaceae family. Conventional breeding methods are limited by the scarcity of germplasm resources, making them difficult to implement. However, plant genetic engineering technology can break through the boundaries between species and transfer useful exogenous genes, providing a new approach for the improvement of Brassica crops. Commonly used genetic transformation methods for Brassica plants include Agrobacterium-mediated transformation, gene gun transformation, and electroporation transformation, among which Agrobacterium-mediated transformation is the most widely used and the most mature method. Agrobacterium-mediated transgenic technology involves using Agrobacterium tumefaciens and Agrobacterium rhizogenes, containing Ti and Ri plasmids respectively, to carry the target gene. Utilizing the characteristic of Agrobacterium to induce crown galls or hairy roots in plant wounds, the target gene carried by the T-DNA on the plasmid is inserted into the plant genome. Then, through tissue culture technology, transgenic plants carrying the target gene are regenerated. In 1988, Zhang et al. discovered that the regeneration of Brassica crops is closely related to genotype. In 1990, Boulter discovered in his genetic transformation research on Brassica napus that Agrobacterium tumefaciens had a higher transformation frequency than Agrobacterium rhizogenes. Since then, research on the genetic transformation system of Brassica vegetables has made continuous progress and accumulated a wealth of research materials.
[0004] The ability to obtain mutants through genetic engineering to verify gene function, regulate VC content in non-heading Chinese cabbage, and thus create new germplasm of non-heading Chinese cabbage is of great practical significance. Summary of the Invention
[0005] This study verified the important role of this gene in the vitamin C synthesis pathway and successfully obtained gene-edited mutant plants. Compared with wild-type plants, the gene-edited plants exhibited base substitutions in the BcERF070 gene sequence, resulting in a decrease in vitamin C content. This provides a theoretical and practical basis for future genetic engineering efforts to advance the flowering time of non-heading Chinese cabbage, shorten the breeding cycle, and create new vegetable germplasm.
[0006] The first objective of this invention is to provide the genetic engineering application of the BcERF070 gene in non-heading Chinese cabbage. Knocking out the BcERF070 gene can reduce the vitamin C content in non-heading Chinese cabbage.
[0007] The second objective of this invention is to provide the genetic engineering application of the BcERF070 gene in non-heading Chinese cabbage. Knocking out the BcERF070 gene can advance the flowering time of non-heading Chinese cabbage.
[0008] Furthermore, in the aforementioned applications, the nucleotide sequence of the BcERF070 gene is as shown in SEQ ID NO.1: ATGAAGCGAATCGTGAGGATATCATTCACCGACGTGGAGGCCACCGATTCTTCCAGCAGCGAAGACGATCAGACGAACACCGAATCACCGTCGCCACGAAAAGGGAAGAGGTTCGTCAAGGAGATCGTCATCGACCCATCCGATTCCGCCGAGGTGAGAAAGACGCGGTTTAAGATCAGGATTCCGGCGAGGCTTACGAAGAAGTTCCGAG GTGTGAGGCAGAGGCCGTGG GGGAAATGGGCGGCTGAGATCAGGTGCGGTAAAGCTCACGGTGGAATTCGCAACGGGGGACCTGTTCGTCTTTGGCTTGGGACATTCGAAACCGCCGAGGAAGCTGCTTTGGCTTACGACAAGGCCGCGATTCGGCTTATTGGGCCTCACGCGCCGATCAATTTCGGCCCAGAATCTCCGGCTGTGAAGCAAGATTCCGTTGCGGGGGACTGA
[0009] Furthermore, in the aforementioned application, the knockout of the BcERF070 gene involves introducing the BcERF070 gene CRISPR / Cas9 vector into non-heading Chinese cabbage, resulting in a change in the BcERF070 gene sequence and rendering it ineffective.
[0010] In a specific embodiment, knocking out the BcERF070 gene specifically includes the following steps:
[0011] (1) Construction of the BcERF070 gene CRISPR vector
[0012] The sgRNA was designed using the online website http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence BcERF070 shown in SEQ ID NO.1 was input into the website, and a series of 20bp sequences were obtained. The sgRNA was designed as: GGTGAGGCAGAGGCCGTGG (SEQ ID NO.2), where 5'-NGG-3' is PAM (where N represents any base).
[0013] In the BcERF070 gene nucleotide sequence shown in SEQ ID NO.1 above, the underlined part is the sgRNA shown in SEQ ID NO.2, and the bolded part is PAM.
[0014] Using the first twenty bases of the PAM structure as the front primer and the reverse complement as the back primer, sgRNA primers were designed, from 5' to 3':
[0015] sgRNA-1-F:GATTGTGTGAGGCAGAGGCCGTGG(SEQ ID NO.3)
[0016] sgRNA-1-R:AAACCCACGGCCTCTGCCTCACAC(SEQ ID NO.4)
[0017] 5 μl sgRNA-1-F + 5 μl sgRNA-1-R direct annealing;
[0018] Procedure: Step 1, 95℃, 3 min; Step 2, 95℃, 1 min; Step 3, return to Step 2, decrease by 1℃ each time, repeat 40 times; Step 4, 55℃, 30 min; Step 5, 55℃, 1 min; Step 6, return to Step 5, decrease by 1℃ each time, repeat 30 times; Finally, save at 4℃.
[0019] The annealing product was ligated into a Bpi 1-digested PMD18-T plasmid (containing psgR-Cas9-At, provided by Zhejiang University). The system consisted of 2 μl of annealing product, 2 μl of vector, 2 μl of 5× buffer, 1 μl of T4 ligase, and 3 μl of H2O. The ligation product was transformed into E. coli. The PMD18-T plasmid containing the fragment was extracted, digested with enzymes (Kpn1 and HindIII), and ligated into pCAMBIA1301 digested with Kpn1 and HindIII. The ligation product was transformed into E. coli. Sequencing confirmed that the reading frame of the coding region in the expression vector was correct, thus obtaining the CRISPR vector.
[0020] (2) Plant expression vector plasmid transformation of Agrobacterium tumefaciens
[0021] The CRISPR vector obtained in (1) was added to competent Agrobacterium, mixed, and then placed in an ice bath for 10 min, followed by liquid nitrogen flash freezing for 5 min. The mixture was then quickly transferred to a 37°C water bath for 5 min, then placed in an ice bath for 5 min. 900 μL of fresh LB liquid medium was added, and the mixture was cultured at 28°C and 250 rpm for 2–3 h with shaking. The mixture was then centrifuged at 6000 rpm for 5 min, and about 100 μL of the supernatant was collected and resuspended. The suspension was then spread on LB solid medium containing 50 mg / L kanamycin and 20 mg / L rifampin. The suspension was cultured in the dark at 28°C for 2–3 days until a single colony grew on the plate. After PCR identification, Agrobacterium GV3101 carrying the CRISPR / Cas9 gene editing vector was obtained.
[0022] (3) Agrobacterium-mediated transformation of non-heading Chinese cabbage
[0023] ① Obtaining sterile seedlings: Shake the seeds with 75% alcohol (prepared by mixing anhydrous ethanol and sterile water in a volume ratio of 3:1) for 2 minutes, then sterilize them with sodium hypochlorite (mix 1 mL of 5.6% sodium hypochlorite solution with 9 mL of sterile water) for 15 minutes. After rinsing with sterile water, blot dry with filter paper and sow on germination medium. Place in a light incubator for 5-7 days until the cotyledons of the seedlings are fully expanded.
[0024] ② Obtain sterile explants: Cut the petiole and hypocotyl from step ① and lay them flat on the pre-culture medium as explants. Incubate in a light incubator for 3 days.
[0025] ③ Co-culture of explants with Agrobacterium: The Agrobacterium OD obtained in ② 600 Adjust the concentration to 0.2, shake at 250 rpm for 3 hours at 28℃ on a shaker, infect explants for 8 minutes, absorb excess Agrobacterium liquid with sterile filter paper, place on co-culture medium (with sterile filter paper underneath), and incubate in the dark in a light incubator for 3 days.
[0026] ④ Obtaining plants: Transfer the co-cultured explants to differentiation medium and culture them in a light incubator for 20-30 days. Then, transfer individual buds to screening medium for screening culture. After about 20 days, select green adventitious buds and transfer them to rooting medium. After about 20 days, harden off the seedlings and transplant them after the roots are strong.
[0027] ⑤ Detection of transgenic plants: Root fluorescence detection using stereomicroscopy or Sanger sequencing.
[0028] Step ① Germination medium conditions: 1 / 2 MS, agar 7 g / L, sucrose 30 g / L, pH 5.8, no hormones added.
[0029] Step ① Select alcohol and sodium hypochlorite as disinfectant. The alcohol concentration is 75%, which can be prepared by the following method: anhydrous ethanol and sterile water are mixed in a volume ratio of 3:1. The sodium hypochlorite solution has an effective chlorine content of 0.56%, which can be prepared by the following method: take 1 mL of 5.6% sodium hypochlorite solution and mix it with 9 mL of sterile water.
[0030] In step ①, the sodium hypochlorite disinfection time is 15 minutes, and after disinfection, it is rinsed 5 times with sterile water for 10 seconds each time.
[0031] After sowing in step ①, the seedlings are cultured in a photocatalytic box for 5 days, at which point the cotyledons of the seedlings have fully unfolded.
[0032] The explant materials selected in step ② are cotyledons with petioles and hypocotyls. The hypocotyl is 0.5 cm long. Cotyledons with petioles of 1-2 mm and hypocotyls of about 5 mm are more likely to generate callus and differentiate into shoots.
[0033] After obtaining the explants in step ②, the culture time in the light incubator is 3 days. This process helps the wound to generate callus cells and reduces the chance of browning after co-culture.
[0034] The pre-culture medium in step ② is prepared as follows: MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L thidiazuron (TDZ), 0.25 mg / L naphthaleneacetic acid (NAA), 7.5 mg / L AgNO3, with a pH of 5.8.
[0035] In step ③ of this invention, the Agrobacterium obtained in step ② is first centrifuged at 4000 rpm for 10 min, the supernatant is removed, and the Agrobacterium suspension is resuspended.
[0036] In step ③ of this invention, the Agrobacterium suspension is a 1 / 10 MS liquid culture medium, prepared by using 0.474 g / L MS medium, 3 g / L sucrose, and pH 5.2.
[0037] In step ③ of this invention, acetylsuccinone (As) is added to the Agrobacterium suspension before use, with a final concentration of 100 mmol.
[0038] In step ③ of this invention, Agrobacterium OD 600 The concentration was 0.2, and then the mixture was shaken at 250 rpm for 3 hours at 28°C. The explant infection time was 8 minutes. At this time, the transformation efficiency was high and the explants were not damaged too much.
[0039] In step ③ of this invention, sterile filter paper is used when applying the culture medium.
[0040] In step ③ of this invention, the culture time is 3 days and it is carried out under dark conditions, which can effectively control the growth of Agrobacterium.
[0041] The culture medium in step ③ of this invention is prepared as follows: MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L TDZ, 0.25 mg / L NAA, 7.5 mg / L AgNO3, with a pH of 5.2.
[0042] In step ④ of this invention, the differentiation time is 20-30 days, and the subculture and rooting culture are each about 20 days.
[0043] The differentiation medium in step ④ of this invention is prepared as follows: MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L TDZ, 0.25 mg / L NAA, 5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L Termedin, 0.2 mM VC, with a pH of 5.8. This medium is simple and effective, and callus and buds can be formed after one differentiation culture, with less vitrification and browning.
[0044] The screening culture medium in step ④ of this invention has the following composition: MS medium, 7 g / L agar, 30 g / L sucrose, 2 mg / L 6-BA, 0.1 mg / L NAA, 7.5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L termethin, 0.2 mM VC, 5 mg / L Hygromycin, and pH 5.8.
[0045] The rooting medium in step ④ of this invention is prepared as follows: MS medium, 7 g / L agar, 30 g / L sucrose, 0.2 mg / L NAA, 7.5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L Tim, with a pH of 5.8.
[0046] In steps ① to ④ of this invention, the light incubator environment is (25±5℃) 16h light exposure 8h darkness, with an illuminance of 5000lx.
[0047] Beneficial effects
[0048] Vitamin C plays a very important role in both the human body and plants. This invention explores the vitamin C synthesis pathway in non-heading Chinese cabbage through genetic engineering and genetically improves non-heading Chinese cabbage.
[0049] This invention utilizes gene editing technology to achieve base substitution in the BcERF070 gene within plants, reducing the vitamin C content in non-heading Chinese cabbage and consequently advancing its flowering time, thus shortening the breeding cycle. The method is highly operable, has a short experimental cycle, and targets a single trait. Compared to the non-transgenic control, the transgenic plants obtained after the BcERF070 gene mutation showed a 37.5% decrease in vitamin C content, verifying the important role of the BcERF070 gene in the plant vitamin C synthesis pathway. This invention, through genetic engineering technology, regulates the vitamin C content of non-heading Chinese cabbage, providing new ideas and technical support for creating new germplasm and genetic improvement of Chinese cabbage, and has significant practical implications. Attached Figure Description
[0050] Figure 1 To encourage budding of tissue culture explants.
[0051] Figure 2 Screening for hygromycin-resistant buds.
[0052] Figure 3 This refers to the transplanting of plants resistant to hygromycin.
[0053] Figure 4 These are the PCR sequencing results of the transgenic plants.
[0054] Figure 5 The results show the vitamin C content determination of transgenic Suzhou green plants.
[0055] Figure 6 The flowering status of the regenerated material 20 days after transplanting. Detailed Implementation
[0056] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0057] Example 1. Construction of CRISPR vector for BcERF070 gene
[0058] sgRNA was designed using the online website http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence BcERF070 shown in SEQ ID NO.1 was input into the website, resulting in a series of 20bp sequences. The sgRNA was designed with PAM from 5'-NGG-3'. The first twenty bases of the PAM structure were selected as the front primer, and the reverse complementary base as the back primer. The sgRNA primers were designed from 5'-3' as follows:
[0059] sgRNA-1-F:GATTGTGTGAGGCAGAGGCCGTGG(SEQ ID NO.3)
[0060] sgRNA-1-R:AAACCCACGGCCTCTGCCTCACAC(SEQ ID NO.4)
[0061] Direct annealing with 5μl F + 5μl R;
[0062] Procedure: Step 1, 95℃, 3 min; Step 2, 95℃, 1 min; Step 3, return to Step 2, decrease by 1℃ each time, repeat 40 times; Step 4, 55℃, 30 min; Step 5, 55℃, 1 min; Step 6, return to Step 5, decrease by 1℃ each time, repeat 30 times; Finally, save at 4℃.
[0063] The annealing product was ligated into the Bpi 1-digested PMD18-T plasmid (Amp+ resistant) (containing psgR-Cas9-At, provided by Zhejiang University). The system consisted of 2 μl of annealing product, 2 μl of vector, 2 μl of 5× buffer, 1 μl of T4 ligase, and 3 μl of H2O. The ligation product was transformed into *E. coli*. The PMD18-T plasmid containing the fragment was extracted, digested with enzymes (Kpn1 and HindIII), and ligated into pCAMBIA1301 (Kana resistant) digested with Kpn1 and HindIII. The ligation product was transformed into *E. coli*. Sequencing confirmed that the coding region reading frame in the expression vector was correct, yielding a CRISPR / Cas9 vector, denoted as the CRISPR vector. Example 2. Transformation of plant expression vector plasmid into *Agrobacterium*.
[0064] The CRISPR / Cas9 vector obtained in Example 1 was added to competent Agrobacterium, mixed well, and incubated on ice for 10 min, followed by flash freezing in liquid nitrogen for 5 min. It was then quickly transferred to a 37°C water bath for 5 min, incubated on ice for 5 min, and then 900 μL of fresh LB liquid medium was added. The culture was incubated at 28°C with shaking at 250 rpm for 2–3 h. After centrifugation at 6000 rpm for 5 min, approximately 100 μL of the supernatant was collected and resuspended. This resuspended culture was then plated on LB solid medium containing 50 mg / L kanamycin and 20 mg / L rifampin, and incubated in the dark at 28°C for 2–3 days until single colonies appeared on the plates. PCR identification yielded Agrobacterium GV3101 carrying the CRISPR / Cas9 vector. All of the above procedures must be performed aseptically in a clean bench.
[0065] Example 3. Agrobacterium-mediated transformation of Suzhou Qing
[0066] 1. Obtaining sterile seedlings: Shake the seeds with 75% alcohol (prepared by mixing anhydrous ethanol and sterile water in a volume ratio of 3:1) for 2 minutes, then sterilize them with sodium hypochlorite (mix 1 mL of 5.6% sodium hypochlorite solution with 9 mL of sterile water) for 15 minutes. Rinse the seeds with sterile water 5 times for 10 seconds each time, then blot dry with filter paper and sow them into germination medium. Place them in a light incubator for 5 days until the cotyledons of the seedlings are fully expanded.
[0067] The germination medium was 1 / 2 MS, with 7 g / L agar, 30 g / L sucrose, and a pH of 5.8, without the addition of hormones.
[0068] 2. Obtaining sterile explants: Cotyledons and hypocotyls with petioles were cut from the obtained seedlings and used as explants. Each hypocotyl segment was 5 mm long, and each cotyledon with a petiole of 1–2 mm was used. These were laid flat on pre-medium and cultured in a light incubator for 3 days. The pre-medium consisted of MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L thidiazuron (TDZ), 0.25 mg / L naphthaleneacetic acid (NAA), and 7.5 mg / L αgNO3, with a pH of 5.8.
[0069] 3. Co-culture of explants and Agrobacterium: The Agrobacterium obtained in step ② was first centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the explants were resuspended in Agrobacterium suspension. The Agrobacterium suspension was prepared using 1 / 10 MS liquid medium (0.474 g / L MS medium, 3 g / L sucrose, pH 5.2) with a final concentration of 100 mmol of acetylsuccinone. The Agrobacterium OD... 600 Adjust the pH to 0.2, shake at 250 rpm for 3 hours at 28℃, infect explants for 8 minutes, blot off excess Agrobacterium solution with sterile filter paper, place on co-culture medium (with sterile filter paper underneath), and incubate in the dark in a light incubator for 3 days. The co-culture medium composition is: MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L TDZ, 0.25 mg / L NAA, 7.5 mg / L AgNO3, pH 5.2.
[0070] 4. Obtaining plants: Transfer the co-cultured explants to differentiation medium and culture in a light incubator for 20-30 days until the explants sprout. Figure 1 Single buds were transferred to a selection medium for selection culture, and green adventitious buds were selected after about 20 days. Figure 2 ) Transferred to rooting medium, after about 20 days when the root system is strong, hardened off and transplanted to obtain T0 generation plants ( Figure 3The differentiation medium consisted of: MS medium, 7 g / L agar, 30 g / L sucrose, 3 mg / L TDZ, 0.25 mg / L NAA, 5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L Termedin, 0.2 mM VC, pH 5.8; the selection medium consisted of: MS medium, 7 g / L agar, 30 g / L sucrose, 2 mg / L 6-BA, 0.1 mg / L NAA, 7.5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L Termedin, 0.2 mM VC, 5 mg / L Hygromycin, pH 5.8; the rooting medium consisted of: MS medium, 7 g / L agar, 30 g / L sucrose, 0.2 mg / L NAA, 7.5 mg / L AgNO3, 160 mg / L Carb, 160 mg / L TDZ, 0.25 mg / L NAA, 0.25 mg / L AgNO3, 160 mg / L Carb, 0.25 mg / L TDZ, 0.25 mg / L NAA, 0.25 mg / L AgNO3, 0.25 ... Tim, pH 5.8.
[0071] Example 4: PCR identification of transgenic plants
[0072] Genomic DNA was extracted from the new leaves of 5 hygromycin-resistant plants obtained in Example 3. The BcERF070 gene was cloned and detected by PCR. Wild-type plants were used as positive control templates, and water was used as negative control templates. The primers used (5' to 3') were:
[0073] F:ATGAAGCGAATCGTGAGGAT(SEQ ID NO.5)
[0074] R:TCAGTCCCCCGCAACGGAAT(SEQ ID NO.6)
[0075] The PCR reaction program was as follows: pre-denaturation at 94℃ for 30s; denaturation at 98℃ for 10s; annealing at 53℃ (Tm) for 30s; extension at 72℃ for 1 min for 30s, 34 cycles; further extension at 72℃ for 1 min; storage at 10℃. The PCR results were sent for sequencing. After the results were returned, they were compared with the BcERF070 gene sequence shown in SEQ ID NO.1 to check for base deletions or substitutions. #45 and #51 showed base substitutions in the target fragment compared to the BcERF070 gene sequence in the sgRNA shown in SEQ ID NO.2. Figure 4 The strains #45 and #51 were identified as positive transgenic plants.
[0076] Example 5: Determination of Vitamin C Content in Transgenic Suzhou Green Plants
[0077] Using leaves from the non-transgenic negative control (ck) and the transgenic plants (#45 and #51) obtained in Example 5 at the same time period as materials, the AsA content in the plants was determined by high performance liquid chromatography (HPLC). Specific method: 0.2 g of plant leaves were weighed, added to 1.5 ml of 0.1% oxalic acid, ground, transferred to a 2 ml centrifuge tube, and centrifuged at 12000 rpm for 15 min at 4℃. The supernatant was used for analysis. Chromatographic conditions were: mobile phase 0.1% acetic acid, flow rate 1 ml / min, injection 10 μl, column temperature 30℃, and detection wavelength 245 nm. Compared with the non-transgenic control, the vitamin C content in the obtained transgenic plants decreased by 37.5% (…). Figure 5 ).
[0078] Vitamin C standard curve preparation: After filtration, 2.5 μl, 5 μl, 7.5 μl, 10 μl, 12.5 μl, and 15 μl of 100 ml / L ascorbic acid standard solution were loaded onto the sample. A standard curve was plotted with peak area as the ordinate and standard concentration as the abscissa.
[0079] Example 6: Statistics on flowering
[0080] The flowering status of three control seedlings (without editing) and two transgenic plants (gene-edited plants) obtained in Example 5 was observed and recorded. The results showed that about 20 days after transplanting, all gene-edited plants (gene-edited plants 1 and 2) developed flower buds, with one even flowering prematurely (gene-edited plant 2). In contrast, the control group did not bolt or flower. The gene-edited plants showed premature bolting and flowering compared to the control group. Figure 6 ); 40 days after transplanting, the flowering rate of the control group (3 plants total) was 33.3%, while all gene-edited plants showed flowering; all control plants flowered approximately two months after transplanting. This indicates that base substitution in the BcERF070 gene can advance the flowering time of non-heading Chinese cabbage.
[0081] This invention verifies the important role of the ERF070 gene in the plant vitamin C synthesis pathway and obtains ERF070 transgenic plants. It provides data support for verifying the function of genes in non-heading Chinese cabbage in regulating flowering time, and has important practical significance. sequence list <110> Nanjing Agricultural University <120> Genetic engineering applications of the BcERF070 gene in non-heading Chinese cabbage <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 444 <212> DNA <213> Non-heading Chinese Cabbage (Brassica campestris ssp. chinensis Makino) <400> 1 atgaagcgaa tcgtgaggat atcattcacc gacgtggagg ccaccgattc ttccagcagc 60 gaagacgatc agacgaacac cgaatcaccg tcgccacgaa aagggaagag gttcgtcaag 120 gagatcgtca tcgacccatc cgattccgcc gaggtgagaa agacgcggtt taagatcagg 180 attccggcga ggcttacgaa gaagttccga ggtgtgaggc agaggccgtg ggggaaatgg 240 gcggctgaga tcaggtgcgg taaagctcac ggtggaattc gcaacggggg acctgttcgt 300 ctttggcttg ggacattcga aaccgccgag gaagctgctt tggcttacga caaggccgcg 360 attcggctta ttgggcctca cgcgccgatc aatttcggcc cagaatctcc ggctgtgaag 420 caagattccg ttgcggggga ctga 444 <210> 2 <211> 20 <212> DNA <213> Non-heading Chinese Cabbage (Brassica campestris ssp. chinensis Makino) <400> 2 gtgtgaggca gaggccgtgg 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <400> 3 gattgtgtga ggcagaggcc gtgg 24 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 aaacccacgg cctctgcctc acac 24 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 atgaagcgaa tcgtgaggat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tcagtccccc gcaacggaat 20
Claims
1. Non-heading cabbage BcERF070 The genetic engineering applications of genes are characterized by, mutation BcERF070 Genes that advance the flowering time of non-heading Chinese cabbage, as described above. BcERF070 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mutation is a T mutation at position 213 of the nucleotide sequence shown in SEQ ID NO.1 to A and a G mutation at position 231 to T.