Application of got2 gene in controlling tobacco whitefly under high temperature stress

Abstract

The application relates to the technical field of agricultural insects and pest control, and provides application of a GOT2 gene in high-temperature stress for controlling Bemisia tabaci. The nucleotide sequence of the GOT2 gene is shown in SEQ ID NO. 1; the GOT2 gene is silenced to control the Bemisia tabaci; a method for silencing the GOT2 gene is to use VIGS to silence the GOT2 gene; the VIGS is a 2mDNA1 vector. Silencing the GOT2 gene of the Bemisia tabaci is very unfavorable for the Bemisia tabaci to adapt to a high-temperature environment, based on which, a measure of silencing a related gene can be taken to strengthen the prevention and control of the Bemisia tabaci, and a new thought method is provided for effective management of the Bemisia tabaci.

Description

Technical Field

[0001] This invention relates to the field of agricultural insect and pest control technology, and in particular provides the application of the GOT2 gene in the control of whiteflies under high temperature stress. Background Technology

[0002] The whitefly (Bemisia tabaci, Hemiptera, Aleyrodidae) is one of the most important pests in agriculture worldwide, widely distributed across various crops. It has numerous host crops and a long period of damage. Phenylalanine is crucial for insect growth and development. On one hand, phenylalanine is a raw material for insect protein synthesis; on the other hand, it participates in many morphogenesis and reproductive processes. For example, during the formation of the new cuticle, phenylalanine and tyrosine undergo a series of oxidation processes to form N-acetyldopamine, which cross-links with body wall proteins, causing them to harden and darken. In the case of the whitefly (cryptotypes MEAM1 and MED), its symbiotic bacteria (the primary symbiotic Portiera and the secondary symbiotic Hamiltonella) carry most of the genes involved in phenylalanine synthesis, and the whitefly carries the key gene GOT2, which is involved in the terminal reactions of the phenylalanine and tyrosine synthesis pathways.

[0003] With the continuous improvement of technological research methods, molecular biology techniques are playing an increasingly important role in pest and disease control, enhancing control capabilities and levels while overcoming the drawbacks of traditional methods. Virus-induced gene silencing (VIGS) is a major achievement in the development of reverse genetics RNAi technology. Compared with traditional gene function analysis methods, VIGS can silence and analyze the function of target genes in the current generation of infected plants; it can function under different genetic backgrounds and has advantages such as simple operation, low cost, and long silencing period. Because the viruses transmitted by whiteflies have a wide range of infection, they have become a research hotspot for gene silencing vectors. The 2mDNA1 silencing vector is a vector modified from a satellite molecule of a whitefly-transmitted geminivirus. This virus can systematically infect tomatoes and specifically express itself in the phloem. VIGS technology can effectively silence insect target genes, inhibiting the rapid growth of pest populations and achieving pest control. Summary of the Invention

[0004] The purpose of this invention is to provide an application of the GOT2 gene for the prevention and control of whiteflies under high temperature stress. By taking measures to silence related genes, the control of whiteflies is strengthened, providing a new approach and method for the effective management of whiteflies.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides the application of the GOT2 gene in the control of whiteflies under high temperature stress, and the nucleotide sequence of the GOT2 gene is shown in SEQ ID NO.1.

[0007] Preferably, whiteflies are controlled by silencing the GOT2 gene.

[0008] Preferably, the method for silencing the GOT2 gene is to use VIGS to silence the GOT2 gene.

[0009] Preferably, the vector used in the VIGS is a 2mDNA1 silencing vector.

[0010] Preferably, the method for silencing the GOT2 gene using the 2mDNA1 silencing vector includes the following steps:

[0011] (1) The GOT2 gene was ligated to the 2mDNA1 silencing expression vector to obtain the 2mDNA1-GOT2 silencing expression vector;

[0012] (2) The 2mDNA1-GOT2 silencing expression vector was introduced into Escherichia coli DH5α for cloning, and then transformed into EHA105 Agrobacterium competent cells to obtain Agrobacterium containing the 2mDNA1-GOT2 silencing expression vector.

[0013] (3) Infect plants with the Agrobacterium containing the 2mDNA1-GOT2 silencing expression vector to obtain plants carrying the 2mDNA1-GOT2 silencing expression vector;

[0014] (4) Plant the plants carrying the 2mDNA1-GOT2 silencing expression vector around healthy plants for the whiteflies to feed on, so as to silence the GOT2 gene in the whiteflies.

[0015] Preferably, the temperature of the high-temperature stress is 36–40°C.

[0016] Temperature is a crucial factor influencing the geographical distribution and dispersal of insects. Suitable temperatures are essential for the normal growth and development of insects; excessively high or low temperatures can negatively impact their development. Studies have shown that whiteflies exhibit strong adaptability to high-temperature stress; however, short-term exposure to high temperatures can reduce the survival rate of whiteflies at different instars and the proportion of females in the F1 generation. Plant-mediated silencing of the GOT2 gene in whiteflies is highly detrimental to their adaptation to high-temperature environments. Therefore, silencing related genes can be used to enhance the control of whiteflies, providing a new approach for effective whitefly management. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 To detect the gene expression of GOT2 in whiteflies after feeding on 2m-VIGS tomatoes in Experiment Example 1;

[0019] Figure 2 The response of whiteflies that fed on 2m-VIGS tomatoes in Experiment Example 1 to different durations of high temperature (38°C);

[0020] Figure 3 The response of the tobacco whitefly to high temperature (38℃) and normal temperature (25℃) after feeding on 2m-VIGS tomatoes for 5 days in Experiment Example 1. Detailed Implementation

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Example 1

[0023] 1. Constructing a 2mDNA1-GOT2 silencing expression vector

[0024] 1.1 Total RNA was extracted using the Trizol method, and cDNA was prepared using the All in One First Strand cDNA Synthesis Kit (purchased from Bimake (USA)). After cloning the full-length GOT2 gene of the whitefly target, the PCR product was purified using the Wizard SV Geland PCR Clean-up System (purchased from Promega) to obtain the purified PCR product of the target GOT2 gene fragment (SEQ ID NO: 1).

[0025] The PCR purification product of the target GOT2 gene fragment and the 2mDNA1 silencing vector (the 2mDNA1 plasmid was kindly provided by Professor Zhou Xueping of Zhejiang University, with Y35A plasmid as the auxiliary component) were double-digested with BamHI and XbaI, respectively. The reaction system for the double digestion is shown in Table 1 below. This yielded the target gene GOT2 fragment containing two sticky ends of BamHI and XbaI, and the 2mDNA1 vector fragment. Using T4 DNA Ligase (purchased from Promega), the GOT2 target gene fragment containing BamHI and XbaI sticky ends and the 2mDNA1 vector fragment were ligated according to the T4 DNA Ligase instructions at a volume ratio of 5:1.5. The mixture was incubated overnight at 4°C. The ligation system for the target gene fragment and the vector fragment is shown in Table 2 below, resulting in the 2mDNA1-GOT2 silencing expression vector.

[0026] Table 1. Reaction system for double enzyme digestion

[0027] DNA 100ng 200ng 10×Buffer 1μL BamHI and XbaI 1μL <![CDATA[ddH2O]]> Up to 10μL

[0028] Table 2. Target fragment to vector fragment conjugation system

[0029]

[0030] 1.2 The 2mDNA1-GOT2 silencing expression vector was introduced into Escherichia coli DH5α for cloning. The specific steps are as follows:

[0031] Take a tube of E. coli DH5α competent cells (purchased from Takara) stored at -80℃, thaw it on ice, and then in a sterile 2mL centrifuge tube in a laminar flow hood, add 10μL of 2mDNA1-GOT2 silencing expression vector and 50μL of E. coli DH5α competent cells, gently tap to mix, and incubate on ice for 20min. Perform heat transfer. Heat shock at 42℃ for 80s, then quickly cool on ice for 5min; add 940μL of LB liquid medium (antibiotic-free), and incubate at 37℃ and 200rpm in a shaker for 1h; centrifuge at 8,000rpm for 1min, leaving 200μL of precipitate, resuspend the bacterial culture, and then take 10 and 20μL respectively and spread evenly on LB agar plates containing kanamycin (100mL medium plus X-Gal (20μL) and IPTG (10μL)), and incubate upside down in a 37℃ incubator overnight. Use a sterile small pipette tip to pick up a single white colony and place it in LB-Kana liquid medium. Incubate at 37°C and 230 rpm on a shaker.

[0032] The strain was verified by PCR using primers v-GOT2-F1: GCTTAGACGGTTCTCCCAAGTGTTCG (SEQ ID NO: 2) and v-GOT2-R1: CGGGATCCGCACAAGTGCTGGGTTCAT (SEQ ID NO: 3). The strain contained the 2mDNA1-GOT2 silencing expression vector. It was cultured in large quantities in E. coli DH5α and replicated. The 2mDNA1-GOT2 recombinant plasmid was extracted from the bacterial cells using a plasmid miniprep kit (purchased from Tiangen). The concentration of the recombinant plasmid was found to be 56 ng / μL, which was then used for the next step of electroporation.

[0033] 1.3 The 2mDNA1-GOT2 silencing expression vector was electroporated into EHA105 Agrobacterium competent cells. The specific operation steps are as follows:

[0034] Take 10 μL of the 2mDNA1-GOT2 recombinant plasmid obtained in step 1.2 above and add it to 200 μL of EHA105 Agrobacterium competent cells (this step is performed in a clean bench). Mix well and transfer to a pre-cleaned and pre-cooled electroporation cuvette. Cover and place on ice for 10 min. Prepare the electroporation apparatus (BIO-RAD), adjust the voltage to 2400V, the pulse to 25μF, and the resistance to 400Ω. Wipe the surface of the electroporation cuvette dry with lens paper, especially the electrodes. Place the electroporation cuvette into the slot of the electroporator and press the electroporation button until the electroporation is completed and a smooth curve of successful electroporation appears. Remove the electroporation cuvette and place it in a clean bench at room temperature for 2 min. Add 800 μL of antibiotic-free YEP liquid medium and aspirate several times to ensure even distribution of bacteria for easy transfer to antibiotic-free culture medium. The bacteria were placed in 2 mL centrifuge tubes and incubated at 28°C for 1 hour. After the competent Agrobacterium regained its activity, the culture was shaken at 200 rpm for 4 hours. After centrifugation at 8000 rpm for 3 minutes, 800 μL of supernatant culture medium was discarded, leaving 200 μL of bacterial cells. The cells were thoroughly resuspended and mixed. Based on the moisture content of YEP solid medium (containing X-GaL (20 μL), IPTG (10 μL, kanamycin sulfate Kana final concentration 100 μg / mL, and rifampicin Rif final concentration 50 μg / mL) per 100 mL of medium, blue-white screening was performed. An appropriate amount of bacterial solution was spread evenly (the surface of the plate should be as dry as possible after spreading to facilitate the growth of single colonies. If single colonies do not grow, the antibiotic concentration can be appropriately reduced and the plate can be re-spread and cultured). The plate was incubated at 28°C inverted in the dark for 60 hours.

[0035] Agrobacterium was obtained containing the 2mDNA1-GOT2 silencing expression vector; it was verified using primers v-GOT2-F1:GCTCTAGACGGTTCTCCCAAGTGTTCG (SEQ ID NO: 2) and v-GOT2-R1:CGGGATCCGCACAAGTGCTGGGTTCAT (SEQ ID NO: 3).

[0036] 1.4. Construction of a mDNA1-mediated gene silencing system in whiteflies

[0037] VIGS tomatoes (Tomato Solanum lycopersicum, variety L-402, bred by the Horticulture Research Institute of Liaoning Academy of Agricultural Sciences) were obtained by Agrobacterium infection. The specific method is as follows:

[0038] A. Agrobacterium EHA105 strain containing the 2mDNA1-GOT2 silencing expression vector and the 2mDNA1 empty vector from 1.3 were inoculated into 10 mL of YEP liquid medium containing Kana (100 μg / mL) and Rif (50 μg / mL) at a volume ratio of 1:100, and cultured at 28℃ and 230 rpm for about 16 h to the logarithmic growth phase.

[0039] B. Centrifuge at 8000 rpm for 10 min, and discard all supernatant;

[0040] C. Resuspend the bacterial culture in acetylsuccione solution to OD. 600 In 1.2;

[0041] D. Place the bacterial suspension in a 28℃ incubator and let it stand for 3 hours. Mix 2mDNA1 and Y35A bacterial suspension at a 1:1 ratio (Y35A is used as an auxiliary plasmid, and a 1:1 mixture is more conducive to Agrobacterium infection). After thorough mixing, use it to inoculate tomatoes with 4 true leaves.

[0042] E. When inoculating, use a sterile 1mL disposable syringe to inject the phloem at the base of the stem of the test tomato (4 true leaves). At the same time, use a needle with bacterial solution to make several strokes on the back of the upper tender leaves and apply bacterial solution to the wound. Inoculate 0.5mL per plant.

[0043] F. Fourteen days after inoculation, conventional PCR was performed using 2mDNA1 specific primers. Positive plants could be used for subsequent experiments.

[0044] 2mDNA1-specific primers:

[0045] 2mDNA1F (SEQ ID NO: 4): GTATGAGCCTTTAATGGCC;

[0046] 2mDNA1R (SEQ ID NO: 5): GAGACTCTTCCTCTTGCC.

[0047] Y35A specific primers:

[0048] Y1F1 (SEQ ID NO: 6): CGTAGGCCTGTGGATAAACCTCAAGAT;

[0049] Y6R2 (SEQ ID NO: 7): CTGAAGCGTTCTGAATCACACCA.

[0050] (3) Infect the plants with Agrobacterium containing the 2mDNA1-GOT2 silencing expression vector to obtain plants carrying the 2mDNA1-GOT2 silencing expression vector (i.e., 2mDNA1-GOT2 tomatoes).

[0051] Experimental Example 1

[0052] Detection of related gene expression after consuming 2mDNA1-GOT2 tomatoes

[0053] Whiteflies that had just emerged 3 days prior were fed on 2mDNA1-GOT2 tomatoes for 7 days (control was 2m-control, treatment was 2m-GOT2). Total RNA was extracted from 10 females per biological replicate, with 5 biological replicates. Before reverse transcription, the RNA content of each system was calculated to be consistent with that of the control and treatment (the RNA content of each system was mostly 250-500 ng). The expression of relevant genes was detected by qRT-PCR.

[0054] The gene expression of a 3-day-old whitefly that fed on VIGS tomatoes for 7 days is as follows: Figure 1 As shown, compared with the control 2m-control, the gene expression of GOT2 was downregulated by 72% and 92% after whiteflies fed on 2m-GOT2 tomatoes for 3 days and 7 days, respectively (3d: P<0.001; 37d: P<0.05).

[0055] 3. Response of whiteflies to different durations of high temperature (38℃) stress after feeding on 2m-GOT2 tomatoes

[0056] Whiteflies that had just emerged 3 days prior were fed on 2m-GOT2 tomatoes for 3 days, then transferred to a climate incubator (still on the same 2m-GOT2 tomatoes) with two sets of parameters:

[0057] 38℃, 14 hours of sunlight, 60-70% humidity;

[0058] 38℃, dark for 10 hours, humidity 60-70%.

[0059] Whitefly mortality rates were recorded after 1, 3, 5, and 7 days of exposure to 38℃ stress. Ten insects were used in each treatment, with 12 biological replicates. Significant differences in whitefly mortality rates were analyzed. Furthermore, the responses of whiteflies to high temperature (38℃) and normal temperature (25℃) after 5 days of feeding on 2m-GOT2 tomatoes were examined and compared. Ten insects were used in each treatment, with 12 biological replicates. Significant differences in whitefly mortality rates were analyzed.

[0060] The GOT2 gene in whiteflies was silenced using a plant-mediated method, and the subjects were subjected to 38℃ stress for 1, 3, 5, and 7 days. The results are as follows: Figure 2 As shown, under high temperature stress, the mortality rate of gene-silenced whiteflies was significantly higher than that of the control group. The mortality rates of the control group at 1d, 3d, 5d, and 7d were 29.2%, 62.5%, 85.0%, and 100%, respectively; while the mortality rates of the treatment group at 1d, 3d, 5d, and 7d were 48.3%, 80.0%, 95.0%, and 100%, respectively (P < 0.05).

[0061] The GOT2 gene in whiteflies was silenced using a plant-mediated method, and the responses of whiteflies that fed on 2m-VIGS tomatoes for 5 days to high temperature (38℃) and normal temperature (25℃) were examined. The results are as follows: Figure 3 As shown, after 5 days of stress at 38℃, the mortality rates in the control group and the treatment group were 85.0% and 95.0%, respectively; at room temperature (25℃), the mortality rates were 29% and 50%, respectively.

[0062] Silencing the GOT2 gene in whiteflies through plant-mediated methods is highly detrimental to their adaptation to high-temperature environments. Based on this, silencing related genes can be used to strengthen the control of whiteflies, providing a new approach for the effective management of whiteflies.

[0063] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of silencing the GOT2 gene in improving the ability of tomatoes to control whiteflies under high temperature stress, characterized in that, The nucleotide sequence of the GOT2 gene is shown in SEQ ID NO.1; The temperature of the high-temperature stress is 38°C.

2. The application as described in claim 1, characterized in that, The method for silencing the GOT2 gene is to use VIGS to silence the GOT2 gene.

3. The application as described in claim 2, characterized in that, The method for silencing the GOT2 gene includes the following steps: (1) The GOT2 gene was ligated to the 2mDNA1 silencing expression vector to obtain the 2mDNA1-GOT2 silencing expression vector; (2) The 2mDNA1-GOT2 silencing expression vector was introduced into Escherichia coli DH5α for cloning, and then transformed into EHA105 Agrobacterium competent cells to obtain Agrobacterium containing the 2mDNA1-GOT2 silencing expression vector. (3) Infect plants with Agrobacterium containing the 2mDNA1-GOT2 silencing expression vector to obtain plants carrying the 2mDNA1-GOT2 silencing expression vector; (4) Plant the plants carrying the 2mDNA1-GOT2 silencing expression vector around healthy plants for the whiteflies to feed on, so as to silence the GOT2 gene in the whiteflies.

Images