Use of a circular RNA in the preparation of a breast cancer diagnosis and prognosis evaluation product

Abstract

The application discloses a circular RNA used as breast cancer diagnosis and / or prognosis evaluation, and the circular RNA is hsa_circ_0005379. The expression of hsa_circ_0005379 is positively correlated with tumor size, lymph node metastasis, HER2 positive expression, Ki-67 high expression and later tumor stage. The breast cancer diagnosis and prognosis effect evaluation can be realized by detecting the expression amount of hsa_circ_0005379.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a circular RNA in the preparation of products for breast cancer diagnosis and prognosis assessment. Background Technology

[0002] Breast cancer is the most common malignant tumor in women, and its incidence has been rising rapidly in recent years. Early diagnosis, surgery, and adjuvant therapy are crucial for improving the prognosis of breast cancer patients, but most patients are diagnosed at an advanced stage, leading to a poor prognosis. Therefore, early diagnosis of breast cancer is essential for developing early treatment strategies and reducing mortality.

[0003] Circular RNAs (circRNAs) are closed, single-stranded circular transcripts without a 5' cap or 3' tail. Increasing evidence suggests that circRNAs are closely related to the occurrence and development of various cancers. circRNAs are conserved across different species and exhibit tissue and developmental stage expression specificity. Furthermore, because circRNAs are insensitive to nucleases and resistant to RNase degradation, they are relatively stable, offering greater potential as biomarkers. circRNAs have been reported to be widely distributed across species and play a crucial role in tumorigenesis and cancer progression. However, research on the role of circRNAs as potential biomarkers in breast cancer is limited. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to provide an application of circular RNA in the preparation of products for breast cancer diagnosis and prognostic assessment.

[0005] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a circular RNA for use as a diagnostic and / or prognostic assessment tool for breast cancer, said circular RNA being hsa_circ_0005379.

[0006] In a second aspect, the present invention provides the application of a circular RNA in the preparation of a breast cancer diagnostic and prognostic assessment product, wherein the breast cancer diagnostic and prognostic assessment product can detect the expression level of a circular RNA in a test tissue sample, wherein the circular RNA is hsa_circ_0005379.

[0007] A third aspect of the present invention provides the use of a reagent of circular RNA in the preparation of screening agents for molecular markers of breast cancer, wherein the circular RNA is hsa_circ_0005379.

[0008] In a fourth aspect, the present invention provides a diagnostic kit for breast cancer, the kit containing a detection system for detecting hsa_circ_0005379 in breast cancer tissue.

[0009] In a fifth aspect, the present invention provides the use of a circular RNA in the preparation of a drug for treating breast cancer, wherein the circular RNA is hsa_circ_0005379.

[0010] In a sixth aspect, the present invention provides a method for screening drugs for treating breast cancer, comprising detecting the expression level of hsa_circ_0005379 in breast cancer tissue after drug administration.

[0011] The superior effects of this invention are as follows: Whole transcriptome sequencing and real-time quantitative PCR validation both confirmed that hsa_circ_0005379 expression was upregulated in breast cancer tissue compared to adjacent normal tissue. Receiver operating characteristic (ROC) curve analysis showed that hsa_circ_0005379 could significantly distinguish breast cancer tissue from adjacent normal tissue, with an area under the curve of 0.8926. Furthermore, hsa_circ_0005379 expression was positively correlated with tumor size, lymph node metastasis, HER2-positive expression, Ki-67 high expression, and later stage. Compared with other molecular subtypes, hsa_circ_0005379 expression was significantly upregulated in HER2-overexpressing breast cancer. Attached Figure Description

[0012] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments of this application and their descriptions are used to explain this application and do not constitute an undue limitation of this application.

[0013] Figure 1 This is a diagram showing the screening results of differentially expressed circRNAs in breast cancer tissue and adjacent normal tissue using whole transcriptome sequencing technology in an embodiment of the present invention. Figure 2 This is a schematic diagram of the real-time quantitative PCR results of hsa_circ_0005379 in breast cancer tissue and adjacent normal tissue in an embodiment of the present invention; Figure 3 This is the receiver operating characteristic curve (ROC) of hsa_circ_0005379 in this embodiment of the invention; Figure 4 This is a graph showing the relationship between hsa_circ_0005379 expression level and tumor diameter in an embodiment of the present invention; Figure 5 This is a graph showing the relationship between the expression level of hsa_circ_0005379 and lymph node metastasis in an embodiment of the present invention; Figure 6This is a graph showing the relationship between hsa_circ_0005379 expression level and HER2 positive expression in an embodiment of the present invention; Figure 7 This is a graph showing the relationship between the expression levels of hsa_circ_0005379 and Ki-67 in an embodiment of the present invention. Figure 8 This is a graph showing the relationship between the expression level of hsa_circ_0005379 and the pathological N stage in an embodiment of the present invention. Figure 9 This is a graph showing the relationship between the expression level of hsa_circ_0005379 and Luminal type A breast cancer in an embodiment of the present invention. Detailed Implementation

[0014] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application; unless otherwise specified, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0015] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application; as used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise; furthermore, it should be understood that when the terms “comprising” and / or “including” are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0016] Specifically, the present invention is achieved through the following technical solution: In a first typical embodiment of the present invention, a circular RNA is provided for use as a diagnostic and / or prognostic assessment tool for breast cancer, wherein the circular RNA is hsa_circ_0005379.

[0017] The sequence of hsa_circ_0005379 is as follows: see SEQ ID NO.1.

[0018] When hsa_circ_0005379 is used as a diagnostic marker for breast cancer, the expression level of hsa_circ_0005379 in the patient's tissue sample can be detected to determine whether the patient has breast cancer and the degree of malignancy.

[0019] When hsa_circ_0005379 is used as a prognostic biomarker for breast cancer, the expression level of hsa_circ_0005379 in the patient's tissue sample can be detected, and the prognosis can be assessed by comparing the difference in hsa_circ_0005379 expression levels before and after treatment.

[0020] A second typical embodiment of the present invention provides the application of circular RNA in the preparation of breast cancer diagnostic and prognostic assessment products, wherein the breast cancer diagnostic and prognostic assessment products can detect the expression level of circular RNA in the test tissue sample, and the circular RNA is hsa_circ_0005379.

[0021] In one or more embodiments, the diagnostic breast cancer product includes an upstream primer and a downstream primer for detecting hsa_circ_0005379; the sequence of the upstream primer for hsa_circ_0005379 is: TTGGAGAACTGCCCCAAG; the sequence of the downstream primer for hsa_circ_0005379 is: CGGGTGGTGATCCTGGTA.

[0022] In one or more embodiments, the diagnostic breast cancer product includes an internal reference primer; the internal reference primer is GAPDH; the GAPDH includes an upstream primer and a downstream primer; the sequence of the upstream primer of the GAPDH is: GGCCTCCAAGGAGTAAGACC; the sequence of the downstream primer of the GAPDH is: AGGGGAGATTCAGTGTGGTG.

[0023] In one or more embodiments, the diagnostic breast cancer product includes a detection reaction system, which comprises a reverse transcription RNA reaction system and a real-time quantitative polymerase chain reaction (RT-PCR) system. The reverse transcription RNA reaction system includes at least a reverse transcription buffer solution, reverse transcriptase, and nuclease-free purified water. The real-time quantitative polymerase chain reaction (RT-PCR) system includes at least SYBR Green real-time PCR premixed buffer and ribonuclease-free double-distilled water.

[0024] A third typical embodiment of the present invention provides the application of a circular RNA reagent in the preparation of screening molecular markers for breast cancer, wherein the circular RNA is hsa_circ_0005379.

[0025] A fourth typical embodiment of the present invention provides a detection kit for breast cancer diagnosis, wherein the detection kit contains a detection system for detecting hsa_circ_0005379 in breast cancer tissue.

[0026] In one or more embodiments, the diagnostic breast cancer product includes a detection reaction system, which comprises a reverse transcription RNA reaction system and a real-time quantitative polymerase chain reaction (RT-PCR) system. The reverse transcription RNA reaction system includes at least a reverse transcription buffer, reverse transcriptase, nuclease-free purified water, and reverse transcription primers. The real-time quantitative polymerase chain reaction (RT-PCR) system includes at least SYBR Green real-time PCR premix, nuclease-free double-distilled water, and upstream and downstream primers for detecting hsa_circ_0005379.

[0027] The fifth typical embodiment of the present invention provides the application of a circular RNA in the preparation of a drug for treating breast cancer, wherein the circular RNA is hsa_circ_0005379.

[0028] The sixth typical embodiment of the present invention provides a method for screening drugs for treating breast cancer, including detecting the expression level of hsa_circ_0005379 in breast cancer tissue after drug administration.

[0029] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0030] Example (1) Clinical samples A total of 14 pairs of paired breast cancer tissue and adjacent normal tissue, as well as 126 cases of breast cancer tissue, were collected at Qilu Hospital of Shandong University. All breast cancer tissue and adjacent normal tissue were obtained during surgery. Fresh breast cancer tissue and adjacent normal tissue were rapidly cryopreserved in liquid nitrogen after surgery. Written informed consent was obtained from all patients. This study was approved by the Ethics Committee of Qilu Hospital of Shandong University.

[0031] (2) Whole transcriptome sequencing Whole-transcriptome sequencing was performed using three pairs of paired breast cancer and adjacent normal tissues. The whole-transcriptome sequencing service was provided by Cloudseed Biotechnology Co., Ltd. Circular RNAs were detected and identified using DCC software. Data were normalized using EdgeR software, and differentially expressed circRNAs were analyzed. circRNAs with a p-value <0.05 and a fold change >2 were considered significantly differentially expressed candidate circRNAs.

[0032] (3) RNA extraction 1) After removing 30-50 mg of tissue specimen stored in liquid nitrogen, quickly transfer it to an EP tube, add 700 μL of RNA-easy Isolation Reagent, and thoroughly mince the tissue with tissue scissors until it becomes a paste (with no visible particles). Add 280 ml of RNase-free dd H2O to the above lysis buffer, mix by inverting, let stand at room temperature for 5 min, and centrifuge at 12,000 rpm (room temperature) for 15 min.

[0033] 2) Remove the centrifuge tube. At this point, the solution will separate into an upper aqueous phase (containing RNA) and a dark lower precipitate (containing proteins, DNA, polysaccharides, and other impurities). Carefully aspirate the upper aqueous phase into a new centrifuge tube.

[0034] 3) Add an equal volume of isopropanol, invert the container to mix, and let stand for 10 minutes.

[0035] 4) Centrifuge at 12,000 rpm (room temperature) for 10 minutes. A white precipitate can usually be seen. Carefully discard the supernatant.

[0036] 5) Add 1000 μL of 75% ethanol (prepared with RNase-free dd H2O) to the EP tube, gently tap the bottom of the tube to suspend the precipitate, and invert the tube several times.

[0037] 6) Centrifuge at 8,000 rpm (room temperature) for 3 minutes, discard the supernatant, and air dry at room temperature. Note: Do not over-dry, otherwise the RNA sample will be difficult to dissolve.

[0038] 7) Add an appropriate amount of RNase-free dd H2O to the EP tube to dissolve the precipitate, and vortex at room temperature for 3 minutes to fully dissolve the RNA precipitate.

[0039] 8) Measure the concentration and purity of RNA. First, zero the instrument using RNase-free ddH2O. Then, take 1 μL of the dissolved RNA and measure and record the RNA concentration using a micro-spectrophotometer. An OD260 / OD280 ratio between 1.8 and 2.2 indicates high purity. Store the RNA at -80°C when not in use.

[0040] (4) Reverse transcription RNA 1) RNA denaturation After incubating the RNA at 65°C for 5 minutes, immediately place it on ice to cool.

[0041] 2) Preparation of reaction solution

[0042] 3) Reverse transcription reaction The reverse transcription reaction was carried out at 37°C for 15 minutes. The enzyme was then inactivated at 98°C for 5 minutes. After the reaction, the product was stored at -20°C.

[0043] (5) Real-time quantitative polymerase chain reaction (qRT-PCR) 1) Melt and mix all the solutions required for the PCR reaction and place them on ice.

[0044] 2) Prepare the PCR reaction system

[0045] Gently tap the bottom of the tube to mix the solution, then briefly centrifuge at 5000 rpm.

[0046] 3) Sample loading: Add 9 µL of the mixture to each well of the PCR plate. Then add 1 µL of the corresponding cDNA. Carefully seal with Sealing Film and briefly centrifuge to mix. Place the prepared PCR plate on ice before setting the PCR program.

[0047] 4) Place the PCR plate on a Realtime PCR instrument for PCR reaction. All parameters were measured according to the following procedure: 95℃, 30s; 40 PCR cycles (95℃, 5s; 55℃, 15s; 72℃, 15s (collect fluorescence)).

[0048] 5) Melting curve analysis: GAPDH was used as an internal control to normalize circRNA expression, and 2... -△Ct Calculation by method.

[0049]

[0050] (6) Statistical analysis Statistical analysis was performed using GraphPad Prism software. T-tests or nonparametric tests were used to compare differences between groups. One-way ANOVA was used to compare the differences in hsa_circ_0005379 expression levels among the four clinical molecular subtypes of breast cancer. Chi-square tests or Fisher's exact test were used to analyze the relationship between hsa_circ_0005379 expression and clinicopathological variables. Receiver operating characteristic (ROC) curve analysis was performed using GraphPad Prism. A p-value < 0.05 was considered statistically significant.

[0051] Whole transcriptome sequencing was used to screen differentially expressed circRNAs in three pairs of paired breast cancer tissues and adjacent normal tissues. The results showed that 30 upregulated circRNAs and 17 downregulated circRNAs were found in breast cancer tissues compared to adjacent normal tissues. Figure 1Among them, hsa_circ_0005379 was one of the most significantly upregulated circRNAs. Real-time quantitative PCR was then performed on 11 pairs of paired breast cancer tissues and adjacent normal tissues, and the results showed that hsa_circ_0005379 expression was upregulated (…). Figure 2 (P<0.05). Receiver operating characteristic (ROC) curve analysis showed that hsa_circ_0005379 could accurately distinguish breast cancer tissue from adjacent normal tissue, with an area under the ROC curve of 0.8926 (P<0.05). Figure 3 (P=0.02, AUC=0.8926).

[0052] The expression of hsa_circ_0005379 was detected in 126 breast cancer tissue samples, and the correlation between hsa_circ_0005379 expression and clinicopathological features was assessed. Data showed that hsa_circ_0005379 expression was correlated with tumor size (…). Figure 4 (P<0.01), lymph node metastasis ( Figure 5 P<0.05), HER2 positive expression ( Figure 6 P<0.05), Ki-67 high expression ( Figure 7 (P<0.05) and later tumor stage ( Figure 8 The expression of hsa_circ_0005379 was positively correlated with HER2-overexpressing breast cancer (P<0.001). Compared with other clinical molecular subtypes of breast cancer, hsa_circ_0005379 was highly expressed in HER2-overexpressing breast cancer. Figure 9 (P<0.05). Based on the median expression level of hsa_circ_0005379 in breast cancer tissues, patients were divided into a high-expression group and a low-expression group of hsa_circ_0005379. Chi-square test showed that hsa_circ_0005379 expression was positively correlated with tumor size (T stage) and tumor stage, i.e., the larger the tumor and the later the stage, the higher the hsa_circ_0005379 expression (Table 1). Considering that large tumor, lymph node metastasis, HER2 positivity, high Ki-67, and late stage are all poor prognostic factors, it is suggested that breast cancer patients with high hsa_circ_0005379 expression have a poor prognosis.

[0053] Table 1. Correlation between hsa_circ_0005379 expression and clinicopathological features in breast cancer patients

[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of a circular RNA in the preparation of breast cancer diagnostic products, characterized in that, The breast cancer diagnostic product can detect the expression level of circular RNA in the tissue sample to be tested, and the circular RNA is hsa_circ_0005379.

2. The application as described in claim 1, characterized in that, The diagnostic breast cancer product includes an upstream primer and a downstream primer for detecting hsa_circ_0005379; the sequence of the upstream primer for hsa_circ_0005379 is: TTGGAGAACTGCCCCAAG; the sequence of the downstream primer for hsa_circ_0005379 is: CGGGTGGTGATCCTGGTA.

3. The application as described in claim 1, characterized in that, The diagnostic product for breast cancer includes an internal reference primer; the internal reference primer is GAPDH; the GAPDH includes an upstream primer and a downstream primer; the sequence of the upstream primer of the GAPDH is: GGCCTCCAAGGAGTAAGACC; the sequence of the downstream primer of the GAPDH is: AGGGGAGATTCAGTGTGGTG.

4. The application as described in claim 1, characterized in that, The breast cancer diagnostic product includes a detection reaction system, which comprises a reverse transcription RNA reaction system and a real-time quantitative polymerase chain reaction system.

5. The application as described in claim 4, characterized in that, The reverse transcription RNA reaction system includes at least a reverse transcription buffer solution, reverse transcriptase, and nuclease-free pure water.

6. The application as described in claim 4, characterized in that, The real-time quantitative polymerase chain reaction system includes at least SYBR Green real-time PCR premix and ribonuclease-free double-distilled water.

7. The application of a circular RNA reagent in the preparation of screening agents for molecular markers of breast cancer, characterized in that, The circular RNA is hsa_circ_0005379.

Images