Mycobacterium obuase wml and its use in the degradation of organic pollutants

Abstract

The application discloses Mycobacterium obuense WML and application thereof in degradation of organic pollutants. The Mycobacterium obuense WML is taken from sludge of a sewage plant, has a high degradation effect on organic pollutants such as dimethylpentane, can completely convert the pollutants into harmless substances such as CO2 and H2O, and thus has a wide application prospect in biological purification of industrial waste gas and waste water. The Mycobacterium obuense WML can completely degrade dimethylpentane into inorganic substances (CO2 and H2O) and cell biomass, realizes complete mineralization, and has a removal rate of up to 90% on dimethylpentane within 264 mg / L.

Description

(I) Technical Field

[0001] This invention relates to a Mycobacterium obanescens WML and its application in the degradation of organic pollutants such as dimethylpentane. (II) Background Technology

[0002] Dimethylpentane, also known as isohexane, is an organic compound with the chemical formula C6H. 14 It is a colorless and transparent liquid, insoluble in water, but soluble in most organic solvents such as ethanol, ether, and benzene. It is mainly used as a solvent, organic synthesis intermediate, and chemical reagent.

[0003] Although dimethylpentane is classified as low in toxicity, it has anesthetic and irritant properties. Inhalation of dimethylpentane can cause dizziness, nausea, loss of appetite, euphoria, and unsteady gait, and may even lead to loss of consciousness and stupor. It is mildly irritating to the skin. Long-term exposure can cause neurasthenia syndrome, and a few people may experience mild neutropenia and indigestion.

[0004] Therefore, it is necessary to study the efficient degradation of dimethylpentane in the environment for human health. Through literature search, we found reports on mycobacteria using phenanthrene or n-hexane as the sole carbon source to achieve efficient degradation of phenanthrene or n-hexane, but we did not find reports on mycobacteria using dimethylpentane as the sole carbon source to achieve efficient degradation. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a *Mycobacterium obagnes* WML and its application in the degradation of organic pollutants. *Mycobacterium obagnes* WML can degrade organic pollutants such as dimethylpentane using them as the sole carbon source, exhibiting particularly high efficiency and strong removal capacity for dimethylpentane. Furthermore, it grows in a mild environment and is easily cultured on a large scale. The discovery of this degrading bacterium is of great significance for the efficient purification of alkane pollutants in industrial wastewater and waste gas.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a novel dimethylpentane-degrading bacterium, Mycolicibacterium aubagnense WML, deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCCNO: M 2023815, deposit date: May 24, 2023, address: Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of Mycobacterium obanescens WML of this invention are: white, disc-shaped colonies, non-spore-forming, and non-flagellated; neat edges, opaque, easy to pick up, and the bacterial growth along the streaks; Gram-positive.

[0009] This invention also provides an application of Mycobacterium obanescens WML in the degradation of organic pollutants. Specifically, the application involves adding the bacterial suspension obtained by expanding the culture of Mycobacterium obanescens WML or the wet bacterial cells after centrifugation to an inorganic salt culture medium containing organic pollutants at pH 4-9, and culturing it at 25-35℃ and 140-180 rpm to achieve the degradation of organic pollutants.

[0010] Furthermore, the organic pollutants include dimethylpentane, n-octane, ethyl acetate, and butyl acetate.

[0011] Furthermore, in the inorganic salt culture medium, the amount of wet bacterial cells added, based on the dry weight of the bacterial cells, is 20-60 mg / L, preferably 50 mg / L; the amount of bacterial solution added is based on OD... 600 The value is 0.01-0.5, preferably 0.02.

[0012] Furthermore, the initial concentration of organic pollutants in the inorganic salt culture medium is 50-264 mg / L, preferably 66 mg / L.

[0013] Furthermore, the inorganic salt culture medium comprises: K₂HPO₄·3H₂O 0.942 g / L, KH₂PO₄ 0.234 g / L, NaNO₃ 1.7 g / L, NH₄Cl 0.98 g / L, MgCl₂·6H₂O 0.2033 g / L, CaCl₂·2H₂O 0.011 g / L, FeCl₃ 0.0162 g / L, and a trace element stock solution of 5 ml / L, with deionized water as the solvent and pH 7.0; wherein the trace element stock solution comprises: CuSO₄·5H₂O 0.02 g / L, FeSO₄·7H₂O 1.0 g / L, MnSO₄·4H₂O 0.1 g / L, NaMoO₄·2H₂O 0.02 g / L, CoCl₂·6H₂O 0.02 g / L, H₃BO₃ 0.014 g / L, ZnSO4·7H2O 0.10 g / L, solvent is deionized water.

[0014] Furthermore, the wet bacterial cells are prepared according to the following steps:

[0015] (1) Slant culture: Mycobacterium obanesus WML was inoculated into LB slant solid medium and cultured at 30℃ for 48-72h to obtain slant cells. The final concentration of the LB solid medium was: NaCl 10g / L, tryptone 10g / L, yeast extract 5g / L, agar 18-20g / L, deionized water as solvent, and natural pH value.

[0016] (2) Expanded culture: Using an inoculation loop, pick up the slant cells obtained in step (1) and inoculate them into LB liquid medium. Incubate at 30°C for 48–72 h to obtain OD. 600The bacterial culture solution with a concentration of 0.1-0.2 was centrifuged, the precipitate was collected and washed with inorganic salt culture medium to obtain wet bacterial cells; the final concentration composition of the LB liquid culture medium was: NaCl 10g / L, peptone 10g / L, yeast extract 5g / L, deionized water as solvent, and natural pH value.

[0017] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0018] The Mycobacterium obanescens WML provided by this invention is taken from sewage sludge from wastewater treatment plants. It has a high efficiency in degrading organic pollutants such as dimethylpentane and can convert pollutants into harmless substances such as CO2 and H2O relatively completely. Therefore, it has broad application prospects in the biological purification of industrial waste gas and wastewater.

[0019] The Mycobacterium obanescens WML described in this invention can completely degrade dimethylpentane into inorganic substances (CO2, H2O) and cell biomass, achieving complete mineralization, and the removal rate of dimethylpentane up to 264 mg / L is as high as 90%. (iv) Description of the attached drawings

[0020] Figure 1 This is a photograph of the colony morphology of strain WML on LB medium.

[0021] Figure 2 This is a transmission electron microscope image of strain WML.

[0022] Figure 3 This is a phylogenetic tree diagram of strain ML.

[0023] Figure 4 The degradation curves of strain WML for different concentrations of dimethylpentane are shown.

[0024] Figure 5 The degradation rate of strain WML for 66 mg / L dimethylpentane at different pH values ​​is given.

[0025] Figure 6 The degradation rate of 66 mg / L dimethylpentane by strain WML at different pH values ​​over 40 h is given. (V) Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0027] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0028] The inorganic salt culture medium consisted of: K₂HPO₄·3H₂O 0.942 g / L, KH₂PO₄ 0.234 g / L, NaNO₃ 1.7 g / L, NH₄Cl 0.98 g / L, MgCl₂·6H₂O 0.2033 g / L, CaCl₂·2H₂O 0.011 g / L, FeCl₃ 0.0162 g / L, and a trace element stock solution of 5 ml / L. The solvent was deionized water, and the pH was 7.0. The trace element stock solution consisted of: CuSO₄·5H₂O 0.02 g / L, FeSO₄·7H₂O 1.0 g / L, MnSO₄·4H₂O 0.1 g / L, NaMoO₄·2H₂O 0.02 g / L, CoCl₂·6H₂O 0.02 g / L, and H₃BO₃. 0.014 g / L, ZnSO4·7H2O 0.10 g / L, solvent is deionized water.

[0029] The final concentration of the LB solid culture medium is as follows: NaCl 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, agar 18-20 g / L, deionized water as solvent, and natural pH value.

[0030] The final concentration of the LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast extract 5g / L, with deionized water as the solvent and a natural pH value.

[0031] Example 1: Isolation, purification and identification of strain WML.

[0032] 1. Isolation and purification of strain WML.

[0033] Strain WML is a Gram-positive bacterium domesticated and isolated from activated sludge. The specific steps are as follows:

[0034] Add 50 ml of inorganic salt culture medium to a 300 ml shake flask, along with 10 ml of activated sludge collected from a wastewater treatment plant and dimethylpentane at a final concentration of 30 mg / L. Incubate at 30°C for enrichment. When the dimethylpentane concentration reaches 50% of the initial concentration, take 5 mL of the enriched solution and add it to 50 mL of fresh inorganic salt culture medium. Add the same amount of dimethylpentane (to bring the concentration to 30 mg / L). Repeat this enrichment process 5 times. Dilute the final enriched solution 1500 times with sterile water and streak it onto LB solid medium. Incubate at 30°C. Select single colonies and streak them onto LB solid medium. Incubate at 30°C for 24 hours. See the colony morphology photographs below. Figure 1 Single colonies were added to an inorganic salt culture medium, and dimethylpentane at a final concentration of 30 mg / L was added as the sole carbon and energy source. The mixture was incubated at 30°C for 24 hours to obtain the target strain WML. Its morphology was determined using transmission electron microscopy. Figure 2 ).

[0035] Method for determining the concentration of dimethylpentane: Chromatographic column: HP-INNOWax Polyethylene Glycol (30m × 320μm × 0.50μm); Column temperature: 90℃, Column pressure: 5.21psi, Column flow rate: 0.9mL·min -1 Inlet temperature 210℃, split ratio 20:1; carrier gas: nitrogen; carrier gas flow rate: 20.0 mL / min -1 Pressure: 5.21 psi; Detector: Flame Ionization Detector (FID), 200 °C, Hydrogen Flow Rate: 40 mL / min -1 Air flow rate: 450 mL / min -1 Tail purge: 45 mL / min -1 Injection volume: 0.8 mL.

[0036] 2. Identification of strain WML

[0037] (1) Characteristics of strain WML: When strain WML was inoculated onto LB solid medium and cultured at 30℃ for 48 h, the colonies were observed to be white, disc-shaped, with neat edges, opaque, and easy to pick up. Figure 1 Transmission electron microscopy revealed that the bacteria were elliptical rods, non-flagellated, measuring 5 × 40 μm, and Gram-positive. Figure 2 ).

[0038] (2) 16S rRNA sequence analysis

[0039] DNA from strain WML was extracted and purified using the Ezup column-based bacterial genomic DNA extraction kit and stored at 4°C. The purified DNA was amplified by PCR using universal primers for bacteria: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR program was set as follows: 94°C pre-denaturation for 4 min, followed by 94°C denaturation for 45 s, 55°C annealing for 45 s, and 72°C extension for 1 min, for 30 cycles, and a final 72°C repair extension for 10 min. The PCR product was purified and recovered, and then sequenced (Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The 16S rRNA sequencing results were uploaded to NCBI, obtaining accession number QQ978208. The sequence was also compared with gene sequences in the NCBI database using BLAST. It was found to belong to the genus *Mycolicibacterium*, and showed 99% homology with *Mycobacterium mucogenicum* strain ATCC and *Mycolicibacterium aubagnensestrain* U8. From the results, 10 representative *Mycolicibacterium* strains were selected, and a phylogenetic tree was constructed using MEGA 7.0 software based on 16S rRNA gene sequence homology. Figure 3 By comparing genetic distance and 16S rRNA sequences, strain WML was identified as Mycolicibacterium aubagnense and named Mycolicibacterium aubagnense WML. It is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M 2023815, deposit date: May 24, 2023, address: Wuhan University, Wuhan, China, 430072.

[0040] Example 2: Obtaining wet cells of Mycobacterium obanescens WML

[0041] 1. Slant culture:

[0042] Mycobacterium obanescens WML was inoculated into LB liquid medium and cultured at 30°C and 160 rpm for 48–72 h. The activated bacteria were then streaked onto solid LB plates and incubated at 30°C. Single colonies were taken and streaked again to test the purity of the bacteria. The bacteria were then stored in LB slant tubes at 4°C using standard procedures.

[0043] 2. Expand training

[0044] The slant culture from step 1 was inoculated into LB liquid medium and cultured at 30°C and 160 rpm for 48–72 h to obtain an expanded culture solution. The culture was centrifuged, the precipitate was collected and washed with inorganic salt culture solution to obtain wet culture cells.

[0045] Example 3: Degradation performance of Mycobacterium obanescens WML on different concentrations of dimethylpentane.

[0046] The inorganic salt culture medium was dispensed into 300 mL shake flasks (50 mL per flask) and sterilized at 110 °C for 40 min. After sterilization, the flasks were left at room temperature for 2 days to confirm the absence of bacterial growth. Wet bacterial cells obtained in Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight). Dimethylpentane was then added as the sole carbon source to achieve final concentrations of 52.8, 105.6, 58.4, 211.2, and 264 mg / L. The shake flasks were sealed and incubated at 30 °C and 160 rpm on a shaker. A blank control without bacteria was also included. The residual dimethylpentane concentration in the shake flasks was measured periodically, and the removal rate curves of strain WML over time with different initial dimethylpentane concentrations were plotted. The results are shown in [Figure number missing]. Figure 4 As shown in the figure. The results indicate that strain WML can rapidly degrade all added substrates when the concentration of dimethylpentane is below 264 mg / L.

[0047] Example 4: Degradation performance of Mycobacterium obanescens WML on 66 mg / L dimethylpentane under different initial pH conditions.

[0048] The inorganic salt culture medium was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0) using 1 mol / L NaOH or 1 mol / L H2SO4 aqueous solution. Bacterial suspensions prepared according to the method in Example 2 were inoculated under the condition that the initial dimethylpentane concentration was 66 mg / L. The initial bacterial suspension concentrations in each parallel sample were expressed as OD0. 600 All values ​​were 0.02. After sealing, the shake flasks were incubated at 30°C and 160 rpm in a constant-temperature shaker, with a blank control without bacteria. The concentration of residual dimethylpentane in the shake flasks was measured every 8 hours using the method described in Example 1. Curves of dimethylpentane removal rate of the strain under different pH conditions over time were plotted, as well as the degradation rate of 66 mg / L dimethylpentane at different pH conditions over 40 hours. The results are shown in [Figure Number]. Figure 5 and Figure 6 As shown in the figure. The results indicate that strain WML can degrade dimethylpentane at all pH values, with the best degradation effect observed at pH 4 and 5.

[0049] Example 5: Degradation ability of Mycobacterium obanescens WML for different carbon source substrates

[0050] In practical applications, dimethylpentane is not the only organic pollutant present; industrial waste gas generally contains a variety of volatile organic compounds. Therefore, it is necessary to study the degradation effect of Mycobacterium obannee WML on other substrates. Using the experimental procedures of Example 3, with an initial cell dry weight of 20 mg / L, at pH 7.0 and a temperature of 30°C, it was found that this strain has varying degrees of degradation ability for ethyl acetate, n-octane, and butyl acetate, as shown in Table 1. Strain WML was able to remove 100%, 100%, and 80% of 36 mg / L ethyl acetate, 28.12 mg / L n-octane, and 35.2 mg / L butyl acetate within 48 h, 72 h, and 48 h, respectively.

[0051] Table 1. Degradation capacity of bacteria WML for different carbon source substrates

[0052] n-Octane 28.12 72 100％ Ethyl acetate 36 48 100％ Butyl acetate 35.2 48 80％

[0053] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the scope of protection of the present invention. Any modifications and refinements made by those skilled in the art without departing from the concept and scope of the present invention shall fall within the scope of protection of the present invention.

Claims

1. A type of Mycobacterium obanae ( Mycolicibacterium aubagnense WML, deposited at the China Center for Type Culture Collection, accession number: CCTCC NO:M 2023815, deposit date: May 24, 2023, address: Wuhan University, Wuhan, China, 430072, China.

2. The application of Mycobacterium obanescens WML as described in claim 1 in the degradation of organic pollutants, characterized in that, The organic pollutants are isohexane, n-octane, ethyl acetate, and butyl acetate.

3. The application as described in claim 2, characterized in that, The application involves adding the bacterial suspension or wet bacterial cells obtained after centrifuging Mycobacterium obanescens WML through expanded culture to an inorganic salt culture medium containing organic pollutants at pH 4-7, and culturing it at 25-35℃ and 140-180 rpm to achieve the degradation of organic pollutants.

4. The application as described in claim 3, characterized in that, The initial concentration of isohexane in the inorganic salt culture medium is 50-264 mg / L.

5. The application as described in claim 3, characterized in that, In the inorganic salt culture medium, the amount of wet bacterial cells added is 20-60 mg / L based on the dry weight of the bacterial cells.

6. The application as described in claim 3, characterized in that, The wet bacterial cells were prepared according to the following steps: (1) Slant culture: Mycobacterium obanesus WML was inoculated into LB slant solid medium and cultured at 30℃ for 48~72h to obtain slant cells. The final concentration composition of the LB solid medium was: NaCl 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, agar 18~20 g / L, deionized water as solvent, and natural pH value. (2) Expanded culture: Use an inoculation loop to pick up the slant cells obtained in step (1) and inoculate them into LB liquid medium. Incubate at 30°C for 48-72 h to obtain OD. 600 The bacterial culture solution with a concentration of 0.1~0.2 was centrifuged, the precipitate was collected and washed with inorganic salt culture medium to obtain wet bacterial cells; the final concentration composition of the LB liquid culture medium was: NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, deionized water as solvent, and natural pH value.

Images