A SNP molecular marker related to growth traits of largemouth bass "youyu 3", detection primer and application thereof

Abstract

The application discloses a SNP molecular marker related to growth traits of large-mouth bass 'Youyu No.3', a detection primer and application thereof. The sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the SNP molecular marker is a C / C genotype or a G / G genotype at the 301st base position of the sequence shown as SEQ ID NO. 1, or a T / T genotype or a C / C genotype at the 302nd base position. According to the method provided in the application, the growth speed of offspring of the large-mouth bass can be rapidly detected, and the breeding cycle of the excellent large-mouth bass strain is shortened, so that the application has great potential application value.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding of aquatic animals, specifically involving an SNP molecular marker associated with the growth traits of the largemouth bass “Youlu 3”, detection primers and their applications. Background Technology

[0002] Largemouth bass (Micropterus salmoides), commonly known as California bass, originated in North America. Due to its rapid growth and delicious flavor, it was introduced to my country in 1983 as a premium aquatic product. In 2021, its national aquaculture production exceeded 700,000 tons, making it an important freshwater economic fish in my country. Currently, largemouth bass farming in my country faces problems such as germplasm degradation, frequent diseases, and a shortage of superior seedlings. Therefore, breeding superior varieties is of great significance to the healthy development of the largemouth bass farming industry.

[0003] Youlu No. 3 was developed using a population of Northern Largemouth Bass introduced from the United States in 2012 and the "Youlu No. 1" Largemouth Bass as its base population. Targeting growth rate and ease of adaptation to formulated feed, it was bred through four generations using population selection techniques. When fed formulated feed, the growth rate (weight) of one-year-old "Youlu No. 3" Largemouth Bass was on average 17.1% higher than that of the introduced population, and 33.92%-38.82% higher.

[0004] Molecular design breeding is a modern and efficient method of genetic breeding that reveals the functional genes and their molecular markers that control phenotypes, enabling targeted breeding of target germplasm. SNPs (Single Nucleotide Polymorphisms) are the most widely used and latest molecular markers. Using molecular markers for the selection of backup parents can more quickly improve the economic traits of offspring. Summary of the Invention

[0005] This invention aims to provide a SNP molecular marker, detection primer, molecular function, and application of growth trait association in largemouth bass “Youlu 3”.

[0006] The first objective of this invention is to provide a SNP molecular marker associated with the growth traits of the largemouth bass “Youlu 3”, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the SNP molecular marker is: a G / G genotype or a C / C genotype at the 301st base position of the sequence shown in SEQ ID NO.1; or a T / T genotype or a C / C genotype at the 302nd base position.

[0007] Preferably, individuals with the C / C genotype at position 301 have a significantly higher growth rate than individuals with the G / G genotype under the same rearing conditions; individuals with the T / T genotype at position 302 have a significantly higher growth rate than individuals with the C / C genotype under the same rearing conditions.

[0008] A second objective of this invention is to provide a detection primer pair for the above-mentioned SNP molecular marker, comprising:

[0009] Upstream primer g.MsSNP-F: 5'-TCTACCAGTATGCGTTATT-3';

[0010] Downstream primer g.MsSNP-R: 5'-TCTGTTTGTGGAGTAGCG-3'.

[0011] A third objective of this invention is to provide a detection kit comprising the detection primer pair of the aforementioned SNP molecular marker.

[0012] The fourth objective of this invention is to provide the application of the above-mentioned SNP molecular markers, the above-mentioned SNP molecular marker detection primer pairs, or the above-mentioned kits in the breeding of largemouth bass “Youlu 3”.

[0013] The fifth objective of this invention is to provide the application of the above-mentioned SNP molecular markers, the above-mentioned SNP molecular marker detection primer pairs, or the above-mentioned kits in detecting the growth rate of largemouth bass “Youlu 3”.

[0014] The sixth objective of this invention is to provide a method for detecting the growth rate of largemouth bass “Youlu No. 3”, which includes the following steps: extracting genomic DNA from the largemouth bass “Youlu No. 3” to be tested; using the genomic DNA as a template, performing PCR amplification with the above-mentioned SNP molecular marker detection primer pair; sequencing; determining the genotype of the SNP molecular marker based on the sequencing results, and then determining the growth rate of the largemouth bass “Youlu No. 3” to be tested.

[0015] Preferably, the process of determining the genotype of the SNP molecular marker based on the sequencing results and then judging the growth rate of the largemouth bass "Youlu No. 3" to be tested is as follows: individuals with the C / C genotype at position 301 have a significantly higher growth rate than individuals with the G / G genotype under the same breeding conditions; individuals with the T / T genotype at position 302 have a significantly higher growth rate than individuals with the C / C genotype under the same breeding conditions.

[0016] Preferably, the largemouth bass to be tested, "Youlu No. 3", is a largemouth bass that has been farmed for more than 1.5 months.

[0017] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 4 minutes, 95℃ denaturation for 30 seconds, 52℃-57℃ annealing for 20 seconds, 72℃ extension for 1 minute, 35 cycles, and a final extension at 72℃ for 10 minutes.

[0018] Advantages of this invention:

[0019] Rapid growth is a key economic trait of the largemouth bass 'Youlu No. 3'. In the breeding of superior largemouth bass, the SNP molecular markers and methods of this invention can be used to screen potential parent populations and eliminate slow-growing individuals early, which will help to rapidly enhance the growth rate of the offspring. The method provided by this invention is beneficial for rapidly increasing the growth rate of largemouth bass offspring, shortening the breeding cycle of superior shrimp strains, and has significant potential application value.

[0020] The SNP molecular markers, detection primers, molecular functions, and application methods of the largemouth bass disclosed in this invention are unpredictable by currently known conventional knowledge or methods. The SNP molecular markers of this invention can be used to detect the growth traits of the largemouth bass "Youlu No. 3". According to the method provided by this invention, faster-growing reserve parents can be screened, which is conducive to rapidly improving the growth rate of the offspring of the largemouth bass "Youlu No. 3" and shortening the breeding cycle of fast-growing largemouth bass strains. Detailed Implementation

[0021] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0022] Example 1:

[0023] The largemouth bass 'Youlu No. 3' used for analysis was a full-sib family from Foshan Sanshui Baijin Aquatic Seedling Co., Ltd., with fry cultured starting 4 days after hatching. Using conventional culture methods and under identical conditions for 1.5 months, 72 individuals were randomly selected for weight measurement. After harvesting the caudal fins, genomic DNA was extracted from the largemouth bass 'Youlu No. 3' using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biotech Co., Ltd.).

[0024] Using the detection primers disclosed in this invention (F: 5'-TCTACCAGTATGCGTTATT-3'; R: 5'-TCTGTTTGTGGAGTAGCG-3'), PCR detection of SNP markers was performed on 74 largemouth bass individuals "Youlu No. 3". The reaction system is shown in Table 1. The reaction program was: 95℃ pre-denaturation for 4 minutes, (95℃ denaturation for 30 seconds, 60℃ annealing for 20 seconds, 72℃ extension for 1 minute) × 35 cycles, and finally 72℃ extension for 10 minutes.

[0025] Table 1 PCR detection reaction system

[0026]

[0027] The PCR products were sequenced, and the SNP-tagged sequences are shown in SEQ ID NO.1. Statistical analysis of individual genotypes revealed that individuals with the C / C genotype at position 301 grew significantly faster than individuals with the G / G genotype under the same culture conditions; individuals with the T / T genotype at position 302 grew significantly faster than individuals with the C / C genotype under the same culture conditions (Table 2).

[0028] Table 2. Association analysis of SNP sites and growth traits in largemouth bass 'Youlu 3'

[0029]

[0030] SEQ ID NO.1

[0031] GCACGGCATTCAAGACGATCTCGTTGGATAGTTCAGAATATTTCCTGGTTAAAATCTTAACAGCACAATAAATGGTACTTTTGCTGAAAAGGTGGAGGAAGATTTCATGTTGAAGTCCAACTGAAGGC GTTACCTGTCAATCATCTGTTGTGCAGCCTTCTTTAAATCTTTAAAATGACATCTGTCTTAAGCAAATTCTTATAAAAACGTGCCAACAAATAAGCACAGCAAAGCTGTGAGGAAAAGCATTACATGATA TTTTCTGTACTGTAGCAACACAGCCGGACCATACAACAGCTCTTCTGAGTGCAGTGTGAAAGGTCAGCTGAAAGAATAAACATGCTCGTATTTTTCTTCAAGTCTTAGCAATCAGTGCACGAAAA AGTTGTCCGAAGACTAAAAGTTGGAAGGGTTGCAGATGATGTTGTGGAAATCTTTTAACACCTCCCTTCAGAATCCCTGCAATGTCAAAGAATCACCCAGTTTATGAAACGCTACTCACCAAACAGAA

Claims

1. Application of SNP molecular markers, SNP molecular marker detection primer pairs, or kits containing SNP molecular marker detection primer pairs in the breeding of the fast-growing strain of largemouth bass "Youlu No. 3"; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The allele mutation at position 301 of the sequence shown in SEQ ID NO.1 is G or C. Individuals with the C / C genotype at position 301 have a significantly higher growth rate than individuals with the G / G genotype under the same breeding conditions. Or the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the allele mutation at position 302 of the sequence shown in SEQ ID NO.1 is T or C; individuals with the T / T genotype at position 302 grow significantly faster than individuals with the C / C genotype under the same breeding conditions; The detection primer pairs for the SNP molecular markers include: Upstream primer g. MsSNP-F: 5'-TCTACCAGTATGCGTTATT-3'; Downstream primer g. MsSNP-R: 5'-TCTGTTTGTGGAGTAGCG-3'.

2. Application of SNP molecular markers, SNP molecular marker detection primer pairs, or kits containing SNP molecular marker detection primer pairs in detecting the growth rate of largemouth bass "Youlu 3". The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The allele mutation at position 301 of the sequence shown in SEQ ID NO.1 is G or C. Individuals with the C / C genotype at position 301 have a significantly higher growth rate than individuals with the G / G genotype under the same breeding conditions. Or the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the allele mutation at position 302 of the sequence shown in SEQ ID NO.1 is T or C; individuals with the T / T genotype at position 302 grow significantly faster than individuals with the C / C genotype under the same breeding conditions; The detection primer pairs for the SNP molecular markers include: Upstream primer g. MsSNP-F: 5'-TCTACCAGTATGCGTTATT-3'; Downstream primer g. MsSNP-R: 5'-TCTGTTTGTGGAGTAGCG-3'.

3. A method for detecting the growth rate of largemouth bass "Youlu No. 3", characterized in that, The steps include: extracting genomic DNA from the largemouth bass "Youlu 3" to be tested; using the genomic DNA as a template, performing PCR amplification with SNP molecular marker detection primer pairs; and sequencing. Based on the sequencing results, the genotype of the SNP molecular marker was determined, and then the growth rate of the largemouth bass "Youlu No. 3" was judged. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The allele mutation at position 301 of the sequence shown in SEQ ID NO.1 is G or C. Individuals with the C / C genotype at position 301 have a significantly higher growth rate than individuals with the G / G genotype under the same breeding conditions. Or the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the allele mutation at position 302 of the sequence shown in SEQ ID NO.1 is T or C; individuals with the T / T genotype at position 302 grow significantly faster than individuals with the C / C genotype under the same breeding conditions; The detection primer pair for the SNP molecular marker is as follows: upstream primer g. MsSNP-F: 5'-TCTACCAGTATGCGTTATT-3'; downstream primer g. MsSNP-R: 5'-TCTGTTTGTGGAGTAGCG-3'.

4. The method according to claim 3, characterized in that, The largemouth bass to be tested, "Youlu No. 3", is a largemouth bass that has been farmed for more than 1.5 months.

5. The method according to claim 3, characterized in that, The PCR amplification procedure is as follows: 95℃ pre-denaturation for 4 minutes, 95℃ denaturation for 30 seconds, 52℃-57℃ annealing for 20 seconds, 72℃ extension for 1 minute, 35 cycles, and a final extension at 72℃ for 10 minutes.

Images