Vvmyb308 gene and application thereof

Abstract

The application provides a grape fruit color regulation gene VvMYB308 and application thereof in regulating color of grape varieties, wherein the nucleotide sequence of the grape fruit color regulation gene VvMYB308 is SEQ ID NO. 3. A VvMYB308 transcription factor gene related to inhibiting anthocyanin synthesis is cloned, expression of the gene in grape callus is analyzed, and a key motif C2 of the anthocyanin inhibiting effect of the gene is obtained. Discovery and function confirmation of the gene have important significance for cultivating grape varieties with different colors.

Description

Technical Field

[0001] This application belongs to the field of genetics and molecular biology breeding technology. Specifically, this application provides a grape fruit color regulation gene VvMYB308 and its application. Background Technology

[0002] Grapes, belonging to the genus *Vitis* of the family Vitaceae, are of significant economic value. Fruit color is a crucial trait influencing the economic value of grapes, and it is determined by anthocyanins accumulated in the grape skin. MYBA1 and MYBA2 activate genes in the anthocyanin synthesis pathway, leading to the accumulation of anthocyanins in the grape skin and ultimately resulting in colored grapes. These colored grapes exhibit a rich variety of color variations, from light to dark, demonstrating typical quantitative trait characteristics. To further elucidate the molecular mechanism of grape fruit color formation, we selected a potential anthocyanin synthesis repressor, VvMYB308, from previous transcriptome data, conducted transgenic verification, and analyzed its mechanism of inhibiting anthocyanin synthesis. Summary of the Invention

[0003] On the one hand, this application provides a grape fruit color regulation gene VvMYB308, the nucleotide sequence of which is SEQ ID NO.3.

[0004] Furthermore, the amino acid sequence encoded by the gene is SEQ ID NO.4.

[0005] On the other hand, this application provides the application of the grape fruit color regulating gene VvMYB308 in regulating the color of grape varieties.

[0006] Furthermore, in the application, the grape fruit color regulating gene VvMYB308 is overexpressed to reduce the anthocyanin content in grape fruits.

[0007] Furthermore, the grape fruit color regulatory gene VvMYB308 was overexpressed using the pCXSN overexpression vector.

[0008] Furthermore, the nucleotide sequence of the grape fruit color regulation gene VvMYB308 has more than 90% sequence identity with SEQ ID NO.3, and includes the C2 motif shown in SEQ ID NO.10.

[0009] Furthermore, the nucleotide sequence of the grape fruit color regulating gene VvMYB308 is SEQ ID NO.3.

[0010] On the other hand, this application provides the application of the above-mentioned methods in grape breeding.

[0011] On the other hand, this application provides a grape breeding kit containing an overexpression vector into which the grape fruit color regulating gene VvMYB308 is inserted.

[0012] Furthermore, the kit is used to reduce the anthocyanin content in grape berries.

[0013] This invention provides a MYB transcription factor related to the inhibition of anthocyanin synthesis in grapes, its encoding gene, and its applications. The MYB transcription factor for inhibiting anthocyanin synthesis in grapes is derived from the grape variety Muscat and named VvMYB308. The coding sequence of VvMYB308 consists of 873 base pairs; it encodes 290 amino acids and contains R2 and R3 domains, belonging to a typical R2R3-MYB transcription factor.

[0014] Using any vector capable of guiding the expression of exogenous genes in plants, the encoding gene of VvMYB308 provided by this invention is introduced into plant cells, thereby inhibiting anthocyanin biosynthesis. When constructing plant expression vectors using the gene of this invention, any enhancing or inducible promoter can be added before its transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the vectors used can be processed, such as by adding plant-selective markers (GUS gene, luciferase gene, etc.) or antibiotic resistance markers (gentamicin, kanamycin, etc.). The expression vector carrying VvMYB308 of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The transformed host can be either a monocotyledonous plant or a dicotyledonous plant.

[0015] This invention cloned a VvMYB308 transcription factor gene associated with the inhibition of grape anthocyanin synthesis, and analyzed the expression of this gene in grape callus tissue, which is of great significance for breeding grape varieties with different colors. Attached Figure Description

[0016] Figure 1 Phylogenetic and sequence analysis of VvMYB308;

[0017] Figure 2 Experimental results related to the negative regulation of anthocyanin biosynthesis in grape callus by VvMYB308;

[0018] Figure 3 Experimental results related to the mechanism of VvMYB308 negatively regulating anthocyanin biosynthesis. Detailed Implementation

[0019] Material: Callus tissue from "Cabernet Sauvignon" grape fruits.

[0020] Example 1: Cloning of the grape VvMYB308 gene

[0021] Extraction of total RNA from grapes

[0022] The Quick-RNA Extraction Kit (Hua Yueyang, Beijing, China) was used to extract total RNA from the skins of healthy, disease-free grapes and reverse transcribe it into cDNA. Based on the characteristics of the VvMYB308 gene, characteristic upstream and downstream primers were designed (F: ATGGGTAGATCTCCCTGCTGTG (SEQ ID NO.1) / R: TCATGAATCCAAGGCCGTGT (SEQ ID NO.2)).

[0023] The VvMYB308 gene was cloned using grape peel cDNA as a template. The PCR reaction volume was 50 μL, including 2 μL template, 1.5 μL each of F and R primers, 25 μL PCR Mix, and 20 μL dd H2O. The reaction program was: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 56℃ annealing for 15 s, 72℃ extension for 1 min, 32 cycles; 72℃ extension for 5 min; the target fragment was recovered using a gel extraction kit.

[0024] Sequencing to verify the grape VvMYB308 gene

[0025] The target gene obtained from gel recovery was ligated into the pCE2-TA Blunt-Zero vector. The ligation product was transformed into competent E. coli cells. Single colonies of competent E. coli were selected and subjected to first-generation sequencing using universal primers M13F and M13R to verify the results. The VvMYB308 gene sequence was finally obtained.

[0026]

[0027] Example 2: Phylogenetic and Sequence Analysis of VvMYB308

[0028] Phylogenetic trees of R2R3-MYB TFs associated with VvMYB308 in grapes and other species were constructed using maximum likelihood phylogenetic trees constructed with Mega software (v11.0.10) and 1000 guide replicates. VvMYB308 is marked with a solid black circle.

[0029] The amino acid sequences of VvMYB308 were compared with those of other known flavonoid-related R2R3-MYB inhibitors. Residuals are highlighted in black, and some are shown in pink or blue. C1 and C2 motifs at the C-terminus are indicated by boxes. The following GenBank numbers were used (in parentheses): Arabidopsis thaliana AtMYB4 (AT4G38620), AtMYB6 (AT4G09460), AtMYB7 (AT2G16720), AtMYB32 (AT4G34990); grape VvMYBA1 (AB097923), VvMYBPA2 (EU919682), VvMYBPA1 (AM259485), VvMYBC2-L1 (JX050227), VvMYBC2-L3 (KM046932), VvMYB4a (EF113078), VvMYB4b (F J792820), VvMYB4-like (XP_002273328), VvMYB308 (XM_019220875); Peach PpMYB18 (KT159234), PpMYB10.1 (XM_007216468); Apple MdMYB10 (DQ267897), MdMYB16 (HM122617); Strawberry FaMYB1 (AF401220); Persimmon DkMYB4 (AB503701); Snapdragon AmMYB308 (P81393) and Corn ZmMYB31 (NP_001105949).

[0030] Sequence information: The coding sequence of VvMYB308 contains 870 bp, encoding 290 amino acids. In phylogenetic analysis with MYBTFs, VvMYB308 is closely related to R2R3-MYB repressors such as AmMYB308, MdMYB16, VvMYB4a, and VvMYB4b. Figure 1 a). The structure of VvMYB308 is similar to other R2R3-MYB repressors. They contain a bHLH binding domain at the N-terminus and a conserved C1 motif and a C2 motif at the C-terminus. Figure 1 (b) These results suggest that VvMYB308 may be a candidate inhibitor of flavonoid biosynthesis, which can regulate the accumulation of flavonoids in berries along with other MYB factors.

[0031] ELI INLHSFFGNKWSLIAGR (bHLH-binding motif amino acid sequence, SEQ ID NO.5);

[0032] GAGCTCATCATCAACCTCCACAGCTTCTTTGGAAACAAATGGTCTCTCATTGCGGGGAGATTACCG (bHLH binding motif nucleotide sequence, SEQ ID NO.6);

[0033] LYSRGIDPQTHRPLS (C1 motif amino acid sequence, SEQ ID NO.7);

[0034] CTCTACAGCCGGGGAATCGACCCCCAAACTCACCGCCCCCTCAGC (C1 motif nucleotide sequence, SEQ ID NO. 8);

[0035] PQLNLELSIGLP (C2 motif amino acid sequence, SEQ ID NO.9);

[0036] CCACAACTTAACCTTGAGCTCTCCATAGGCCTTCCT (C2 motif nucleotide sequence, SEQ ID NO.10).

[0037] Example 3: Functional Verification of the VvMYB308 Gene in Grape

[0038] The bHLH binding sequence, C1 motif, and C2 motif of VvMYB308 were removed using overlap PCR and named MYBRbH, MYBRC1, and MYBRC2, respectively. These sequences were inserted into the pCXSN vector. The ligation product was transformed into competent E. coli cells, and single clones were selected for first-generation sequencing. Vectors with correct sequencing were expressed and introduced into Agrobacterium strain GV3101 using a freeze-thaw method. Genetic transformation was then performed on an appropriate amount of callus tissue.

[0039] Successfully transformed positive callus tissue was subcultured on subculture medium to induce anthocyanin accumulation on anthocyanin-inducing medium. The subculture medium was solid B5 medium supplemented with 30 g / L sucrose, 2.5 g / L acid-hydrolyzed casein, 3.0 g / L phytogel, 0.1 mg / L α-naphthaleneacetic acid, and 0.2 mg / L kinetin, with a pH of 5.9–6.0. ​​Culture conditions included 24 hours in the dark at 25°C, with subculture every 25 days. The anthocyanin-inducing medium consisted of solid nitrogen-deficient medium (B5 medium containing 3 mM nitrate), supplemented with 80 g / L sucrose, 2.5 g / L acid-hydrolyzed casein, 3.0 g / L phytogel, 0.01 mg / L α-naphthaleneacetic acid, and 0.2 mg / L kinetin, with a pH of 5.9–6.0. ​​Anthocyanin induction culture conditions included 25°C and a 16 / 8-h light / dark cycle.

[0040] Total anthocyanins were extracted using the Micro Plant Anthocyanin Assay Kit (Solarbio, Beijing, China). Anthocyanins were extracted from 0.1 g of sample using the extraction buffer, and the absorbance of the anthocyanin extract was measured at 530 nm and 700 nm in buffers at pH 1.0 and 4.5, respectively. At pH 1, the absorbance values ​​at 530 nm and 700 nm were denoted as A1 and A1'; at pH 4.5, the absorbance values ​​at 530 nm and 700 nm were denoted as A2 and A2'. ΔA = (A1 - A1') - (A2 - A2'). Total anthocyanin content = [ΔA ÷ (ε × d) × 10]. 3 [×F]×V÷W. (F: dilution factor, 10; d: optical diameter of cuvette, 1cm; W: sample mass, g; ε: molar extinction coefficient of anthocyanins, 2.69×10⁻⁶) 4 mL / mmol / cm; V: total volume of extract, 1 mL; 10 3 Unit conversion factor, 1 mmol = 10 3 μmol;).

[0041] Total RNA was extracted using the Quick-RNA Extraction Kit (Hua Yueyang, Beijing, China). qRT-PCR was performed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), with the following amplification program: 95℃ for 30 s, then 95℃ for 10 s and 60℃ for 30 s, for 40 cycles. Normalization was performed using UBIQUITIN1 as an internal reference gene. 2 (-ΔΔCt) The method calculates the relative expression level of genes.

[0042] Using Matchmaker TM Yeast two-hybrid (Y2H) assays were performed using the Gold yeast one-hybrid system (Clontech). The VvMYC1 gene was inserted into the pGBKT7 vector. VvMYB308 was inserted into the pGADT7 vector. Both plasmids were then co-transformed into Y2H yeast strains, and the yeast cells were grown on SD medium (SD / -Leu / -Trp, DDO) lacking Leu and Trp. Positive clones were identified by PCR and further grown on SD medium lacking Ade, His, Leu, Trp, and Leu. pGADT7-T+pGBKT7-p53 served as a positive control, and pGADT7-T7+pGBKT7-Lam served as a negative control.

[0043] The bHLH binding domain, C1 motif, and C2 motif of VvMYB308 were removed using overlap PCR and named MYBRbH, MYBRC1, and MYBRC2, respectively. Figure 2 a). Four coding sequences of VvMYB308 were inserted into the pCXSN vector and transformed into grape callus tissue. Figure 2 c). These calluses were cultured on anthocyanin-inducing medium for 14 days with a photoperiod of 16 / 8 hours. WT calluses were red and contained a large amount of anthocyanins, while transgenic calluses overexpressing VvMYB308 were white, indicating that VvMYB308 inhibited anthocyanin biosynthesis in grape calluses. Transgenic calluses overexpressing MYBRbH, MYBRC1, and MYBRC2 were red, but their anthocyanin content was lower than that of WT. The transgenic calluses overexpressing MYBRC2 had the highest anthocyanin content among the four transgenic calluses. Figure 2 (b, 2d). These results indicate that the inhibitory activity of VvMYB308 originates from the bHLH binding domain, C1 motif, and C2 motif, with the C2 motif playing a crucial role in conferring inhibitory activity to VvMYB308.

[0044] A dual-luciferase reporter assay was performed to amplify the promoter region upstream of the start codon of VvUFGT (1.8 kb) from Muscat grapes and insert it into the multiple cloning site of the vector pGreenII 0800-LUC. The agrobacterium strain GV3101 containing the pSoup helper plasmid was transformed using a freeze-thaw method and cultured at 28°C for 2 days. The mixed bacterial culture was resuspended in 10 ml of buffer containing 10 mM MgCl2, 200 μM acetylsylgenone, and 10 mM MES (pH = 5.7) and incubated statically at 28°C for 2 h before injection. The agrobacterium buffer containing the gene expression vector was mixed proportionally. The mixed buffer was injected into the young leaves of 4-week-old tobacco seedlings. Three days after injection, the ratio of LUC to Ren activity was measured using a dual-luciferase kit (Vazyme, Nanjing, China).

[0045] Transient overexpression experiments in tobacco leaves showed that VvMYB308 inhibited the activation of anthocyanin biosynthesis by VvMYBA1 and VvMYC1. Figure 3 a). To verify whether VvMYB308 inhibits anthocyanin biosynthesis by affecting VvMYC1, the inhibitory effect of VvMYB308 on VvUFGT at different doses of VvMYC1 was determined using a dual-luciferase assay. When the dose ratios of VvMYB308, VvMYBA1, and VvMYC1 were 6:6:0.1 and 6:6:0.2, the activity of the VvUFGT promoter was inhibited; however, when the dose of VvMYC1 increased to 6:6:0.3 and 6:6:0.4, the promoter activity of VvUFGT was no longer affected by VvMYB308. Figure 3d). Therefore, at low VvMYC1 levels, VvMYB308 can inhibit VvUFGT expression by competitively binding to VvMYC1. Furthermore, different mutants of VvMYB308 exhibit varying inhibitory effects on the VvUFGT promoter activity. MYB308RC2, lacking the C2 motif, cannot inhibit the relative activity of the VvUFGT promoter, indicating that the inhibitory activity of VvMYB308 primarily originates from the C2 motif (…). Figure 3 e).

Claims

1. Genes VvMYB308 Application of the gene in regulating the color of grape callus VvMYB308 The nucleotide sequence is SEQ ID NO.3; the gene is overexpressed in the application. VvMYB308 To reduce the anthocyanin content in grape callus tissue.

2. The application according to claim 1, wherein the gene is overexpressed using a pCXSN overexpression vector. VvMYB308 .

Images