An InDel molecular marker associated with primary birth weight reproductive traits in Haimen goats and its application

Abstract

This invention discloses an InDel molecular marker associated with birth weight and reproductive traits in Haimen goats and its applications, belonging to the fields of biotechnology and livestock breeding. The InDel molecular marker is named LGR4 61bp InDel. Using Haimen goat blood genomic DNA as a template, this invention determines genotypes through PCR and agarose gel electrophoresis. Genotype II shows a significant association with birth weight in Haimen goat lambs and can serve as an effective molecular marker for improving reproductive traits in Haimen goats. The detection method of this invention is simple, rapid, accurate, and inexpensive, which can improve the breeding efficiency of Haimen goats and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and livestock breeding, and relates to an InDel molecular marker related to the primary birth weight reproductive trait of Haimen goats and its application. Background Technology

[0002] Superior breeds are the cornerstone of modern animal husbandry, playing a vital role in improving animal economic traits and enhancing the production efficiency of the livestock industry. Traditional breeding methods primarily focus on phenotypic analysis and selection, which is slow, costly, and inefficient. Molecular marker-assisted breeding (MART) techniques can overcome these shortcomings. MART detects target genes by identifying DNA molecular markers, thereby achieving the goal of selecting for specific traits. Insertion-deletion (InDel) markers are among the most common molecular markers, referring to the insertion or deletion of a certain number of nucleotides in the genome. They are widely distributed in eukaryotic genomes, exhibit good stability and accuracy, and are easy to detect, playing a crucial role in MART.

[0003] Haimen goat is a local Jiangsu goat breed known for its superior hide, wool, and meat, and is one of my country's 138 national-level protected livestock and poultry genetic resources. With the improvement of people's living standards in my country, the demand for mutton and related products is constantly increasing. Birth weight is a crucial indicator of ewe reproductive performance, directly impacting the economic benefits of sheep farms. Birth weight is controlled by multiple minor genes, and the discovery and utilization of molecular markers related to it are still relatively limited. Therefore, screening molecular markers associated with high goat fertility plays a vital role in improving ewe reproductive performance, and is also extremely important for accelerating the development of the mutton sheep industry, increasing farmers' income, and improving the meat consumption structure of residents.

[0004] LGR4, also known as GPR48, is a member of the leucine-rich repeat G protein-coupled receptor family (LGRs) and a key target gene of the Wnt / β-catenin signaling pathway. It exhibits a strong affinity for its ligand, R-spondin, and their binding enhances the transduction efficiency of the Wnt signaling pathway (Liu, 2016). Numerous studies have shown that LGR4 is involved in embryonic development, mammary gland development, stem cell activity, hair follicle growth, gallbladder and bone formation, and plays a crucial role in reproductive regulation. LGR4 deficiency can lead to the arrest of germ cells during meiosis I and subsequent apoptosis.

[0005] Studies on LGR4 polymorphisms have primarily focused on human physiological phenotypes and disease research. LGR4 mutations affect Wnt / β-catenin signaling, leading to developmental defects in GnRH neurons and ultimately causing a delayed puberty phenotype. Styrkarsdottir et al. found that the LGR4 c.376C>T mutation is closely associated with low bone mineral density and osteoporotic fractures (Styrkarsdottir et al., 2013). In addition, this mutation site is also associated with electrolyte imbalance, delayed menarche, decreased testosterone levels, and an increased risk of squamous cell carcinoma of the skin and biliary tract cancers. However, LGR4 polymorphisms have not yet been reported in livestock. Summary of the Invention

[0006] In order to overcome the shortcomings of existing technologies in the breeding of reproductive traits in Haimen goats, the present invention aims to provide an InDel molecular marker related to the reproductive traits of Haimen goats and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention claims protection for the use of InDel molecular markers associated with reproductive traits of Haimen goats, or substances for detecting InDel molecular markers associated with reproductive traits of Haimen goats, in the screening and / or breeding of Haimen goats for reproductive traits:

[0009] The InDel molecular marker associated with the reproductive traits of Haimen goats is LGR4 61bp InDel, which is located at chromosome 15, 24846528bp, and is a 61bp deletion: GAAGTAGTCCATGTAAGCTATCAGAAAAGGCTTTATGGAAGAGGTGAAGTGTTTCAAAA TTA→G.

[0010] Furthermore, the reproductive trait mentioned is the birth weight of the lamb.

[0011] Furthermore, the screening and / or breeding of reproductive traits of Haimen goats involves using the aforementioned LGR4 61bp InDel molecular marker to identify the birth weight trait of Haimen goat lambs.

[0012] Furthermore, the screening and / or breeding of reproductive traits in Haimen goats also includes using the LGR4 61bpInDel molecular marker to regulate the birth weight of Haimen goat lambs.

[0013] Furthermore, the substance contains (or is) PCR primers for amplifying Haimen goat genomic DNA fragments containing the InDel molecular marker.

[0014] In a specific embodiment of the present invention, the PCR primers comprise an upstream primer F1 and a downstream primer R1:

[0015] Upstream primer F1: 5'-AAGGCAGTAAGTAAGCACCAG-3';

[0016] Downstream primer R1: 5'-TGTTTCCATTGTTTCCCCATA-3'.

[0017] Furthermore, using the genomic DNA of the blood of the Haimen goat to be tested as a template, PCR amplification was performed using the above-mentioned PCR primers. The genotype of the InDel molecular marker was determined based on the agarose gel electrophoresis results of the PCR amplification products. Individuals with the II genotype were retained, while individuals with the DD genotype were eliminated, thereby increasing the birth weight of Haimen goat lambs generation by generation.

[0018] Different LGR4 61bp InDel genotypes significantly affected the first-parity birth weight of Haimen goats, and had a highly significant effect on the second-parity birth weight and average birth weight. The first-parity lambs born to ewes with genotype II had a highly significantly higher birth weight than the offspring of individuals with genotype DD, and the second-parity lambs had a highly significantly higher birth weight than the offspring of individuals with genotype DD and ID, and the average birth weight was significantly higher than that of the offspring of individuals with genotype ID.

[0019] In a specific embodiment of the present invention, the determination of the LGR4 61bp InDel genotype is as follows: a single band at 172bp indicates the DD genotype, a single band at 233bp indicates the II genotype, and a band at both 172bp and 233bp indicates the ID genotype.

[0020] Secondly, this invention claims a genetic breeding improvement method for reproductive traits of Haimen goats, which uses the genomic DNA of the blood of the Haimen goat to be tested as a template, performs PCR amplification using the above-mentioned PCR primers, determines the genotype of the InDel molecular marker based on the agarose gel electrophoresis results of the PCR amplification products, retains individuals with genotype II, eliminates individuals with genotype DD, and increases the birth weight of Haimen goats generation by generation.

[0021] Furthermore, in the above method, different genotypes of LGR4 61bp InDel have a significant impact on the first birth weight of Haimen goats, and a highly significant impact on the second birth weight and average birth weight. The first birth weight of lambs born to ewes with genotype II is significantly higher than that of the offspring of individuals with genotype DD, and the first birth weight of lambs born to ewes with genotype II is significantly higher than that of the offspring of individuals with genotype DD and ID, and the average birth weight is significantly higher than that of the offspring of individuals with genotype ID.

[0022] In a specific embodiment of the present invention, genotype is determined by agarose gel electrophoresis results. The agarose gel electrophoresis uses a 2% (w / w) agarose gel.

[0023] In a specific embodiment of the present invention, the determination of the LGR4 61bp InDel genotype is as follows: a single band at 172bp indicates the DD genotype, a single band at 233bp indicates the II genotype, and a band at both 172bp and 233bp indicates the ID genotype.

[0024] In a specific embodiment of the present invention, the PCR amplification reaction system is 20 μL, comprising: 10 μL of 2×Taq PlusMaster Mix II; 0.8 μL each of forward and reverse primers; 1 μL of template DNA; and 7.4 μL of deionized water. The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 20 s, and 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 5 min; and storage at 4℃ after PCR.

[0025] In a specific embodiment of the present invention, selecting individuals with genotype II as parents in Haimen goat breeding can increase the birth weight of the first litter, the birth weight of the second litter, and the average birth weight. The birth weight of lambs from the first litter born to ewes with genotype II is 0.25 kg higher than that of lambs with genotype DD and 0.05 kg higher than that of lambs with genotype ID. The birth weight of lambs from the second litter born to ewes with genotype II is 0.24 kg higher than that of lambs with genotype DD and 0.13 kg higher than that of lambs with genotype ID. The average birth weight of lambs from ewes with genotype II is 0.12 kg higher than that of lambs with genotype DD and 0.10 kg higher than that of lambs with genotype ID.

[0026] The InDel molecular markers mentioned above that are related to the reproductive traits of Haimen goats are also within the scope of protection of this invention.

[0027] The aforementioned substances used to detect the InDel molecular markers associated with the reproductive traits of Haimen goats are also within the scope of protection of this invention.

[0028] Furthermore, the substance is a PCR primer for amplifying a Haimen goat genomic DNA fragment containing the InDel molecular marker, or a kit containing the PCR primer. The specific nucleotide sequence of the PCR primer is as described above.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention marks the first discovery of an effective InDel molecular marker in the LGR4 gene that influences the birth weight of Haimen goats. Using the kit provided by this invention, the genotype of the molecular marker is detected by PCR amplification and agarose gel electrophoresis. The method is simple, rapid, accurate, and inexpensive. Using the molecular marker of this invention to screen Haimen goats, retaining individuals with the II genotype for genetic selection and culling individuals with the DD genotype, can improve the reproductive performance of Haimen goats, accelerate the breeding progress of Haimen goats, and has high application value. Attached Figure Description

[0031] Figure 1 The results of 2% agarose gel electrophoresis of the mixed-pool PCR amplification product of LGR4 61bp InDel site (primer P1) are shown, where M represents DL2000 Plus DNA Marker and 1 represents LGR4 61bp InDel.

[0032] Figure 2 The results of 2% agarose gel electrophoresis of the PCR amplification product of LGR4 61bp InDel (primer P1) are shown, where M represents DL2000 Plus DNAMarker.

[0033] Figure 3 This is a sequencing image of the homozygous PCR amplification product of the LGR4 61bp InDel site (primer P1); the part marked by box II represents the 61bp insert sequence. Detailed Implementation

[0034] The technical solution of the present invention will be further described in detail below with reference to the embodiments and related drawings. However, it is worth noting that the embodiments of the present invention are not limited thereto, and those skilled in the art can implement them in other different forms without departing from the spirit and purpose of the present invention.

[0035] Example 1: Genotyping and Identification of the InDel Molecular Marker in the LGR4 Gene of Haimen Goat

[0036] 1. Collection of experimental animals and samples

[0037] The Haimen goats used in this experiment were sourced from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd., totaling 1305 individuals. All goats were healthy and raised under identical conditions and environments. 10 mL of blood was collected from the jugular vein of each pregnant ewe, placed in an anticoagulant tube containing EDTA, and stored at -20°C. Phenotypic information, including birth weight, of the lambs born to the ewes was collected for subsequent association analysis experiments.

[0038] 2. Main Instruments

[0039] Pipettes (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortex mixer (Dalong), digital display constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis apparatus (Beijing Liuyi, DYY-6C), fully automated digital gel imaging system (Tanon, Tanon-4100).

[0040] 3. Main reagents

[0041] TIANGEN Blood Genomic DNA Extraction Kit (Centrifuge Column), 50×TAE (Solarbio), Agarose (BIOWEST), 2×Taq Plus Master MixⅡ (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed Nucleic Acid Gel Dye (TSINGKE, TSJ003), DL2000 Plus DNA Marker (Vazyme, MD102-02).

[0042] 4. Methods

[0043] 4.1 Extraction of genomic DNA from goat blood

[0044] Five hours in advance, remove the goat blood from the -20°C freezer and place it in a 4°C freezer to thaw. Once the blood is completely thawed, extract DNA from the whole blood according to the instructions of the TIANGEN Blood Genomic DNA Extraction Kit.

[0045] DNA concentration and quality were determined using a micro-spectrophotometer. The OD260 / 280 ratio should be between 1.80 and 2.00, and the OD260 / 230 ratio should be between 1.80 and 2.20. Qualified DNA samples were stored at -20°C.

[0046] 4.2 Primer Design for Candidate InDel Sites

[0047] LGR4-related InDel loci were located using the Ensembl database (https: / / asia.ensembl.org / index.html), and genotyping primers were designed using Primer Premier 5 software. Primer information is shown in Table 1.

[0048] Table 1. Primer sequences for LGR4 InDel genotyping

[0049]

[0050] 4.3 Polymorphism of candidate InDel sites and primer verification

[0051] 4.3.1 Mixing Pool Preparation

[0052] Thirty DNA samples were randomly selected from 1305 samples from Haimen goats. 1 μL of each sample was added to the same 1.5 mL centrifuge tube to create a DNA pool for subsequent verification of candidate InDel site polymorphisms and primers. Another 30 DNA samples were randomly selected, and the above procedure was repeated to create two DNA pools.

[0053] 4.3.2 Mixed-pool PCR amplification

[0054] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0055] (2) PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 5 min; after PCR, store at 4℃.

[0056] 4.3.3 Agarose gel electrophoresis of mixed-cell PCR products

[0057] (1) Preparation of 2% agarose gel: Measure 1g of agarose and 50mL of 1×TAE and pour them into an Erlenmeyer flask. Heat in a microwave oven on high for 3 minutes until the solution is clear and transparent; otherwise, extend the heating time appropriately. After standing until the solution is no longer hot to the touch, add 5μL of nucleic acid dye, mix thoroughly, pour onto a plate, and wait for solidification.

[0058] (2) After the agarose gel solidifies, the sample loading operation is performed. The PCR product loading volume is 6 μL and the DNA marker loading volume is 4 μL. Gently place the agarose gel into the electrophoresis tank containing 1×TAE (the 1×TAE liquid level should cover the gel surface), and perform electrophoresis at 140V for 35 min.

[0059] (3) After electrophoresis, the gel was transferred to a fully automated digital gel imaging system for observation.

[0060] The mixed-pool DNA was subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the LGR4 61bp InDel site has a clear target band at both the 233bp and 172bp positions, indicating good primer specificity. Furthermore, the LGR4 61bp InDel exhibits polymorphism in the Haimen goat population, which can be used for subsequent genotyping.

[0061] 4.4 Genotyping

[0062] 4.4.1 Sample PCR amplification

[0063] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0064] (2) PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 5 min; after PCR, store at 4℃.

[0065] 4.4.2 Agarose gel electrophoresis of sample PCR products

[0066] (1) Preparation of 2% agarose gel: Measure 1g of agarose and 50mL of 1×TAE and pour them into an Erlenmeyer flask. Heat in a microwave oven on high for 3 minutes until the solution is clear and transparent; otherwise, extend the heating time appropriately. After standing until the solution is no longer hot to the touch, add 5μL of nucleic acid dye, mix thoroughly, pour onto a plate, and wait for solidification.

[0067] (2) After the agarose gel solidifies, the sample loading operation is performed. The PCR product loading volume is 6 μL and the DNA marker loading volume is 4 μL. Gently place the agarose gel into the electrophoresis tank containing 1×TAE (the 1×TAE liquid level should cover the gel surface), and perform electrophoresis at 140V for 35 min.

[0068] (3) After electrophoresis, the gel was transferred to a fully automated digital gel imaging system for observation. Genotypes were distinguished according to the position of the bands. The smaller homozygous fragment was named deletion / deletion type (DD), the larger homozygous fragment was named insertion / insertion type (II), and the heterozygous fragment was named insertion / deletion type (ID).

[0069] The results of PCR amplification of the LGR4 61bp InDel site (primer P1) on 2% agarose gel electrophoresis are as follows: Figure 2 As shown, M represents DL2000 Plus DNA Marker. A single band at 172bp indicates the DD genotype, a single band at 233bp indicates the II genotype, and a band at both 172bp and 233bp indicates the ID genotype.

[0070] 4.4.3 Sequencing of PCR products from samples

[0071] Three DNA samples were randomly selected from both DD and II genotypes for PCR reaction in a total volume of 40 μL.

[0072] (1) PCR amplification system (40 μL): 2×Taq Plus MasterMix Ⅱ 20 μL; 1.6 μL each of upstream and downstream primers; 2 μL of template DNA; 14.8 μL of deionized water.

[0073] (2) PCR amplification procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 20 s, extension at 72°C for 30 s, for a total of 30 cycles; final extension at 72°C for 5 min; store the amplification product at 4°C after PCR completion.

[0074] The primer P1 and the obtained crude PCR amplification product were sent to Tsingke Biotechnology for sequencing, and the sequencing results were compared and analyzed using SnapGene software.

[0075] The sequencing result of the LGR4 61bp InDel is shown in Figure 3 , wherein the part marked by the II box indicates the 61bp insertion sequence, which is consistent with the result of agarose gel electrophoresis.

[0076] The above results show that performing PCR amplification on genomic DNA of Haimen goats using primer P1, and interpreting genotypes based on the positions of agarose gel electrophoresis bands, can achieve rapid and accurate typing and identification of the LGR4 61bp InDel locus in Haimen goats.

[0077] Example 2 Statistical analysis of the polymorphism of InDel loci in the LGR4 gene and its relationship with high-prolificacy traits of Haimen goats

[0078] 1. Statistics of population genetic parameters for the LGR4 61bp InDel locus

[0079] Genotyping was performed on 1305 Haimen goats according to the primers and methods designed in Example 1, and population genetic parameters of the two loci were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective number of alleles, polymorphism information content, and Hardy-Weinberg equilibrium P-value.

[0080] The results are shown in Table 2. The LGR4 61bp InDel has three genotypes DD, ID and II in Haimen goats, among which genotype II is the dominant genotype and allele I is the dominant allele. This locus is moderately polymorphic (0.25<PIC<0.5) and in Hardy-Weinberg equilibrium (P>0.05).

[0081] Table 2 Population genetic parameters of the LGR4 gene

[0082]

[0083] 2. Association between LGR4 61bp InDel and high fertility trait in Haimen goats

[0084] Using SAS (8.0) software and the GLM program, least squares statistical analysis was performed to analyze the association between different LGR4 61bpInDel genotypes and the birth weight of Haimen goat lambs.

[0085] Using genotype, season, sex, location, and parity as fixed effects, the model is: Y ijklmn =μ+G i +S j +X k +C l +P m +e ijklmn In the formula, Y ijklmn The phenotypic value of the birth weight trait in individual lambs; μ is the population mean; G i Genotype effect; S j This is a seasonal effect; X k For gender effect; C l This is the field effect; P m This is due to parity effect; e ijklmn This is random error.

[0086] 2.1 Analysis of variance on the effect of different genotypes, seasons, sexes, farm locations, and parities on the primary birth weight trait of LGR4 61bp InDel

[0087] The results are shown in Table 3. Different genotypes of LGR4 61bp InDel significantly affected the first-parity birth weight of Haimen goats, and had a highly significant effect on the second-parity birth weight and average birth weight. Different seasons had a highly significant effect on birth weight. Different sexes had a highly significant effect on the first-parity birth weight, third-parity birth weight, fourth-parity birth weight, and average birth weight, and a significant effect on the second-parity birth weight. Different farm areas had a significant effect on the third-parity birth weight and a highly significant effect on the average birth weight. Different parities had a highly significant effect on the average birth weight.

[0088] Table 3. F-values ​​of ANOVA on the primary birth weight trait for LGR4 61bp InDel under different genotypes, seasons, sexes, farm locations, and parities.

[0089]

[0090] Note: *: significant difference (P < 0.05), **: extremely significant difference (P < 0.01).

[0091] 2.2 Correlation analysis between LGR4 61bp InDel and birth weight of Haimen goats

[0092] Fixed effects other than genotype effects that were not significantly associated with individual phenotypic values ​​were removed. An association analysis of LGR4 61bpInDel with birth weight of Haimen goats was performed, and the results are expressed as "least square mean ± standard error".

[0093] The results are shown in Table 4. The first-parity lambs born to ewes with the LGR4 61bp InDel site II genotype had significantly higher birth weights than the offspring of individuals with the DD genotype. The second-parity lambs had significantly higher birth weights than the offspring of individuals with both the DD and ID genotypes. The average birth weight was significantly higher than that of the offspring of individuals with the ID genotype.

[0094] Table 4. Association results between the LGR4 61bp InDel site and the birth weight of Haimen goat lambs.

[0095]

[0096] Note: Different uppercase letters indicate highly significant differences (P < 0.01), and different lowercase letters indicate significant differences (P < 0.05).

[0097] Example 3: Method for improving the reproductive traits of Haimen goats

[0098] The main methods for improving the reproductive traits of Haimen goats include the following steps:

[0099] 1. Collect blood samples from the Haimen goats to be tested and extract genomic DNA from the blood.

[0100] 2. Using primer P1 as described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by agarose gel electrophoresis based on the position of the bands.

[0101] in:

[0102] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.8 μL each; template DNA 1 μL; deionized water 7.4 μL.

[0103] (2) PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 5 min; after PCR, store at 4℃.

[0104] (3) Agarose gel electrophoresis: gel concentration was 2%; PCR product loading volume was 6 μL, DNA Marker loading volume was 4 μL; electrophoresis conditions were 140V for 35 min.

[0105] (4) Genotype determination: smaller homozygous fragments of the product are deletion / deletion type (DD), larger homozygous fragments of the product are insertion / insertion type (II), and heterozygous fragments are insertion / deletion type (ID).

[0106] 3. The LGR4 61bp InDel II genotype can serve as an effective molecular marker for improving reproductive traits in Haimen goats.

[0107] Selecting individuals with genotype II as parents in Haimen goat breeding can increase the birth weight of the first litter, the birth weight of the second litter, and the average birth weight. The birth weight of lambs from ewes with genotype II is 0.25 kg higher than that of lambs with genotype DD and 0.05 kg higher than that of lambs with genotype ID. The birth weight of lambs from ewes with genotype II is 0.24 kg higher than that of lambs with genotype DD and 0.13 kg higher than that of lambs with genotype ID. The average birth weight of lambs from ewes with genotype II is 0.12 kg higher than that of lambs with genotype DD and 0.10 kg higher than that of lambs with genotype ID.

[0108] By using the molecular markers of this invention to screen Haimen goats, retaining individuals with the II genotype for genetic selection, and eliminating individuals with the DD genotype, the breeding goal of improving the reproductive performance of Haimen goats can be achieved.

Claims

1. Application of PCR primers for detecting InDel molecular markers associated with reproductive traits in Haimen goats in screening for reproductive traits or breeding Haimen goats with high reproductive traits: The InDel molecular markers associated with the reproductive traits of Haimen goats are LGR4 61 bp InDel, the aforementioned LGR4 The 61bp InDel is located at chromosome 15, 24846528 bp, and is a 61bp deletion: GAAGTAGTCCATGTAAGCTATCAGAAAAGGCTTTATGGAAGAGGTGAAGTGTTTCAAAATTA mutated to G; the reproductive trait described is lamb birth weight. LGR4 Different genotypes of the 61 bp InDel significantly affected the first-parity birth weight of Haimen goats and had a highly significant effect on the second-parity birth weight and average birth weight. The first-parity lambs born to ewes with genotype II had a highly significantly higher birth weight than the offspring of individuals with genotype DD, and the second-parity lambs had a highly significantly higher birth weight than the offspring of individuals with genotypes DD and ID, and a highly significantly higher average birth weight than the offspring of individuals with genotype ID. The genotype of the InDel molecular marker was determined based on the agarose gel electrophoresis results of the PCR amplification products. LGR4 Determination of the 61 bp InDel genotype: A single band at 172 bp indicates the DD genotype, a single band at 233 bp indicates the II genotype, and a band at both 172 bp and 233 bp indicates the ID genotype. The PCR primers comprise an upstream primer F1 and a downstream primer R1: Upstream primer F1: 5'-AAGGCAGTAAGTAAGCACCAG-3'; Downstream primer R1: 5'-TGTTTCCATTGTTTCCCCATA-3'.

2. The application according to claim 1, characterized in that, Using the genomic DNA of the blood of the Haimen goat to be tested as a template, PCR amplification was performed using the PCR primers described above. The genotype of the InDel molecular marker was determined based on the agarose gel electrophoresis results of the PCR amplification products. Individuals with genotype II are retained, while individuals with genotype DD are eliminated, thereby increasing the birth weight of Haimen goat lambs generation by generation.

3. A method for genetic breeding improvement of reproductive traits in Haimen goats, characterized in that: Using the genomic DNA of the blood of the Haimen goat to be tested as a template, PCR amplification was performed using the PCR primers described in claim 1, and the genotype of the InDel molecular marker described in claim 1 was determined based on the agarose gel electrophoresis results of the PCR amplification products. Individuals with genotype II are retained, while individuals with genotype DD are eliminated, thereby increasing the birth weight of Haimen goats generation by generation; LGR4 Determination of the 61 bp InDel genotype: A single band at 172 bp indicates the DD genotype, a single band at 233 bp indicates the II genotype, and a band at both 172 bp and 233 bp indicates the ID genotype; the reproductive trait mentioned is the birth weight of lambs. LGR4 Different genotypes of 61 bp InDel significantly affected the first birth weight of Haimen goats and had a highly significant effect on the second birth weight and average birth weight. The first birth weight of lambs born to ewes with genotype II was significantly higher than that of the offspring of individuals with genotype DD. The first birth weight of lambs born to ewes with genotype II was significantly higher than that of the offspring of individuals with genotype DD and genotype ID. The average birth weight of lambs born to ewes with genotype ID was also significantly higher than that of the offspring of individuals with genotype ID.

Images