A double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus and application thereof

Abstract

This invention relates to a double-antibody sandwich ELISA kit for detecting egg drop syndrome virus (EDSV) and its application. The double-antibody sandwich ELISA kit includes: an ELISA plate coated with mouse anti-EDSV fiber protein monoclonal antibody 5G4, HRP-labeled mouse anti-EDSV fiber protein monoclonal antibody 6G6, and further includes blocking buffer, dilution buffer, washing buffer, chromogenic buffer, and stop solution. The minimum virus detection limit of this kit is 10-1. 2.9 TCID 50 The antibody concentration is [value missing] / mL and does not react with NDV, IBDV, IBV, and FAdV-4. The intra- and inter-assay repeatability coefficient of variation is less than 10%. Compared with the RT-PCR method, the concordance rate of the double-antibody sandwich ELISA kit is 93.33%. The EDSV antigen double-antibody sandwich ELISA detection method of the present invention has good sensitivity, specificity, and repeatability and can be used for the detection of EDSV.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a double-antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus and its application. Background Technology

[0002] Egg drop syndrome virus (EDSV) causes laying hens to lay soft-shelled, thin-shelled, or shell-less eggs, resulting in a severe drop in egg production and causing significant economic losses to the poultry industry. This virus was first discovered and reported by Dutch scientist Van Eck in 1976. EDSV has now become one of the leading causes of egg production problems in chickens worldwide. Although EDSV generally appears harmless in ducks, previous studies have shown that some EDSV strains are potentially pathogenic to ducks.

[0003] Egg drop syndrome virus (EDSV) is the sole member of group III avian adenoviruses. However, due to its genome being rich in AT bases, it is classified under the genus Adenovirus. Ducks are its primary natural host, hence EDSV is also known as duck adenovirus 1 (Dad V-1). EDSV exhibits typical adenovirus morphology. Pentagons, hexagons, and fibrin are the three main structural proteins of adenoviruses. 240 hexagons constitute the 20 faces of the adenovirus. The hexagonal protein exists as a trimer, with three hexagons forming a hexagonal structure. The 12 vertices of the icosahedron are composed of a complex formed by non-covalently linked pentagonal and fibrin proteins. The pentagonal protein forms a pentagonal matrix in pentamer form, while the fibrin exists as a trimer, extending outwards to form spikes. The fibrin consists of an N-terminal tail region, a stalk region composed of multiple triplet β-helical repeats, and a C-terminal globular head region. Studies have shown that fiber proteins are associated with EDSV invasion of host cells. In addition, fiber can most efficiently induce the body to produce virus-neutralizing antibodies, making it the most effective protective antigen and an ideal target for serological testing.

[0004] Currently, diagnostic detection technologies for EDSV both domestically and internationally mainly rely on hemagglutination or hemagglutination inhibition and nucleic acid diagnostic techniques. Enzyme-linked immunosorbent assay (ELISA), due to its advantages of ease of operation, high specificity, and high sensitivity, has been widely used in the detection of human and animal diseases. Therefore, it is necessary to develop an ELISA kit for detecting egg drop syndrome virus. Summary of the Invention

[0005] The purpose of this invention is to provide a double-antibody sandwich ELISA kit based on two monoclonal antibodies, 5G4 and 6G6, of the Fiber protein of the egg drop syndrome virus.

[0006] A detection method for chicken egg drop syndrome virus using a double-antibody sandwich ELISA kit is also provided.

[0007] The technical solution of this invention:

[0008] A double-antibody sandwich ELISA kit for detecting egg drop syndrome virus (EDSV) includes blocking buffer, diluent, washing buffer, chromogenic buffer, and stop solution. The ELISA plate is coated with mouse anti-EDSV fiber protein monoclonal antibody 5G4 and HRP-labeled mouse anti-EDSV fiber protein monoclonal antibody 6G6.

[0009] The nucleotide sequence of the heavy chain variable region of the coated monoclonal antibody 5G4 or antibody fragment is shown in SEQ.ID NO.1, and the nucleotide sequence of the light chain variable region is shown in SEQ.ID NO.2;

[0010] The nucleotide sequence of the heavy chain variable region of the monoclonal antibody 6G6 or antibody fragment is shown in SEQ.ID NO.3, and the nucleotide sequence of the light chain variable region is shown in SEQ.ID NO.4.

[0011] The monoclonal antibody 5G4 was secreted by the hybridoma cell line 5G4 with accession number CCTCC NO:C2023213.

[0012] The monoclonal antibody 6G6 was secreted by the hybridoma cell line 6G6 with accession number CCTCC NO:C2023214.

[0013] The blocking solution was 5% skim milk, the diluent and washing solution were PBST buffer, the colorimetric solution was TMB, and the stop solution was 2M H2SO4.

[0014] The preparation method of mouse anti-EDSV Fiber protein monoclonal antibody is as follows: the EDSV Fiber gene is obtained by PCR amplification, and it is ligated with the prokaryotic expression vector pET28a to construct the recombinant plasmid pET28a-Fiber. The plasmid is transformed into Escherichia coli BL21, and the Fiber protein is obtained by IPTG induction expression. Then, the purified Fiber protein is obtained by nickel column purification. This purified Fiber protein is used as an immunogen to immunize mice and prepare multiple mouse anti-EDSV Fiber protein monoclonal antibodies.

[0015] Furthermore, the purified fiber protein was used as an antigen to immunize Balb / c mice. Mouse spleen cells were fused with myeloma cells SP2 / 0 to prepare hybridoma cells. The cell supernatant was verified by indirect ELISA and indirect immunofluorescence to screen for positive clone cell lines. After three subcloning processes, the hybridoma cell lines were injected into mice to prepare ascites. Finally, the obtained ascites was purified to obtain mouse anti-EDSV fiber protein monoclonal antibodies 5G4 and 6G6.

[0016] A method for detecting egg drop syndrome virus using a double-antibody sandwich ELISA kit includes the following steps:

[0017] (1) Coating: The purified mouse anti-EDSV Fiber protein monoclonal antibody 5G4 was diluted and coated on the microplate. It was incubated at 4°C overnight. The coating concentration of the capture antibody 5G4 was 219 ng / well.

[0018] (2) Blocking: Use 5% skim milk as the blocking solution and block the ELISA plate at 37℃ for 2 hours;

[0019] (3) Sample addition: Add the sample to be tested and incubate at 37°C for 1 hour to carry out the reaction;

[0020] (4) Add enzyme-labeled secondary antibody: Add diluted HRP-labeled mouse anti-EDSV Fiber protein detection antibody, i.e., HRP-6G6, and incubate at 37℃ for 1 hour; the dilution factor of the detection antibody HRP-6G6 is 1:6400;

[0021] (5) Color development: Add TMB substrate and develop color in the dark for 15 minutes;

[0022] (6) Termination: Add 2M H2SO4 stop solution to terminate the reaction;

[0023] (7) Reading value: OD measured by enzyme-linked immunosorbent assay (ELISA) reader 450 .

[0024] The application of the monoclonal antibodies 5G4 and 6G6 of the present invention in the reagent for detecting egg drop syndrome virus.

[0025] The application of the monoclonal antibodies 5G4 and 6G6 of the present invention in a kit for detecting egg drop syndrome virus.

[0026] The basic principle of the double-antibody sandwich ELISA method of this invention is to immobilize a quantitative capture antibody on the surface of a microplate by physical adsorption, then add the sample to be tested, and finally add a detection antibody (i.e., an enzyme-labeled second antibody). The sample is then developed using a TMB substrate, and the color intensity in the microplate is positively correlated with the concentration of the analyte. Because the double-antibody sandwich ELISA method of this invention uses two specific antibodies to bind to the target, this method has high specificity and sensitivity, and is suitable for the detection of complex sample matrices.

[0027] The beneficial effects of this invention are:

[0028] 1. This invention selects the highly conserved fiber protein of Egg Drop Syndrome Virus (EDSV) as the target antigen, and prepares a double antibody sandwich ELISA kit based on two monoclonal antibodies 5G4 and 6G6 of the EDSV fiber protein.

[0029] The ELISA kit of the present invention uses purified mouse anti-EDSV Fiber monoclonal antibody 5G4 as the capture antibody and HRP-labeled anti-EDSV Fiber monoclonal antibody 6G6 as the detection antibody. Through a series of reaction conditions and reagent optimizations, a double-antibody sandwich ELISA kit was established.

[0030] 2. The minimum detection limit for viruses in the double-antibody sandwich ELISA kit of the present invention is 10. 2.9 TCID 50 The high sensitivity and lack of reaction with NDV, IBDV, IBV and FAdV-4, along with intra- and inter-batch repeatability coefficients of variation of less than 10%, indicate that the established double-antibody sandwich ELISA kit has good reproducibility.

[0031] 3. Compared with the RT-PCR method, the double-antibody sandwich ELISA kit of the present invention has a detection concordance rate of 93.33%, which is a high accuracy.

[0032] 4. The double-antibody sandwich ELISA kit established in this invention can be used for the clinical detection of EDSV. It has high specificity and sensitivity, and is low in cost and easy to operate. It can realize the rapid detection of large batches of samples, providing a rapid detection method and monitoring means for the prevention and control of EDSV infection. Attached Figure Description

[0033] Figure 1 SDS-PAGE identification results of recombinant fiber protein

[0034] Where M: protein marker; 1: purified recombinant fiber protein;

[0035] Figure 2Affinity chromatography purification of 5G4 and 6G6 by SDS-PAGE identification results

[0036] Where M: protein marker; 1: purified 5G4; 2: purified 6G6.

[0037] Figure 3 The labeling effect of monoclonal antibody 6G6 was detected by ELISA. Detailed Implementation

[0038] The specific implementation of the present invention will be described below with reference to the embodiments.

[0039] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents used are commercially available conventional reagents; and the experimental methods involved are all conventional methods.

[0040] Example 1: Expression and purification of EDSV Fiber protein

[0041] The EDSV Fiber protein-encoding gene (GenBank accession number MK386577) was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The Fiber gene was then amplified by PCR, with a BamHI restriction site introduced upstream and an XhoI restriction site introduced downstream. The cycling parameters were: 95℃ pre-denaturation for 10 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 30 cycles, followed by a final extension at 72℃ for 10 min to obtain the PCR product. (Upstream primer: CGC) GGATCC ATGCTGAACGTGGAAACCCGTGGTGG; Downstream primer: CGC CTCGAG TATTGCGCACCAACATAGGTAAACGG). The PCR product and pET28a vector were digested with BamHI and XhoI, recovered, ligated with DNA ligase, and transformed into E. coli TOP10. After gene sequencing and identification, the recombinant plasmid pET28a-Fiber was successfully constructed. Since there is a His tag after the XhoI restriction site of the pET28a vector, a 6×His tag was introduced into the carboxyl terminus of the Fiber protein expressed by the recombinant plasmid.

[0042] The recombinant plasmid pET28a-Fiber was transformed into Escherichia coli BL21(DE3), and a single colony was picked and placed in 5 mL of Kanamycin-resistant LB agar. OD was then collected. 600When the concentration reached approximately 0.6, IPTG was added to a final concentration of 1 mmol / L to induce expression. Five hours after induction, the precipitate was collected by centrifugation at 6000 rpm for 10 min. The precipitate was resuspended in an appropriate amount of PBS and sonicated for 25 min (3 s sonication followed by a 3 s pause, for a total of 25 min). After sonication, the precipitate was centrifuged at 12000 rpm for 10 min at 4 °C, and the supernatant and precipitate were collected separately. The supernatant and precipitate were added to 5× (loading buffer), boiled for 10 min, and then analyzed by SDS-PAGE.

[0043] The loading buffer includes Tris-HCl 60mM (pH 6.8), glycerol 25%, SDS 2%, 2-mercaptoethanol 14.4mM, and 0.1% bromophenol blue.

[0044] After SDS-PAGE identification of fiber protein expression, the supernatant from the sonication lysis was used for nickel column purification. The procedure was as follows: the supernatant was passed through a nickel ion affinity column (GE Healthcare) equilibrated with lysis buffer, washed with Buffer A (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 20 mM imidazole), and then eluted with Buffer B (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 200 mM imidazole). The eluent was collected as the crude protein solution. The crude protein solution was further purified by passing it through a Superdex 200 Increase 10 / 30GL molecular sieve (GE Healthcare) and then using Buffer C (20 mM Tris-HCl pH 7.5, 150 mM NaCl). The protein peak fraction was collected, and the purity of the protein sample was determined by SDS-PAGE. See [link to relevant documentation]. Figure 1 The purified fiber protein will be used for subsequent monoclonal antibody screening.

[0045] from Figure 1 It can be seen that after purification by molecular sieve, a recombinant fiber protein with high purity was obtained, with a molecular weight of approximately 25 kDa.

[0046] Example 2: Preparation and purification of mouse anti-EDSV fiber protein monoclonal antibody

[0047] 1. Preparation of monoclonal antibodies

[0048] The recombinant fiber protein purified in step 1 was used as the antigen to immunize three 8-week-old SPF-grade female BALB / c mice. The immunization dose was 20 μg of antigen protein per mouse, injected subcutaneously at 4-6 points on the back, for a total of 4 immunizations, with an interval of 2 weeks between immunizations. For the first immunization, the recombinant fiber protein diluted with sterile PBS was mixed with an equal volume of Freund's complete adjuvant (FCA) and thoroughly emulsified. For the three booster immunizations, the recombinant fiber protein diluted with sterile PBS was mixed with an equal volume of Freund's incomplete adjuvant (FIA) and thoroughly emulsified. Seven days after the fourth immunization, the serum antibody titer was measured. If the titer was higher than 1:10000, intraperitoneal bolus immunization was performed within one week, with twice the immunization dose of antigen directly dissolved in 250 μL of PBS buffer.

[0049] Three days after intraperitoneal shock, mouse spleens were aseptically harvested and prepared into single-cell suspensions. SP2 / 0 cells in the logarithmic growth phase were treated and then mixed with spleen cells at a 1:5 ratio. The mixture was incubated with 50% PEG1500 for 1 min, and the incubation was terminated by dilution with DMEM basal medium. After low-speed centrifugation, the cells were gently resuspended and mixed in HAT medium containing 20% ​​fetal bovine serum, and then incubated at a rate of 2 × 10⁻⁶ cells / day. 7 The cells were plated into pre-prepared feeder cell plates and cultured at 37°C with 5% CO2. Ten days after cell fusion, the fused hybridoma cells formed clones and occupied a certain area of ​​the cell culture wells.

[0050] Screening for positive clones:

[0051] 1) Indirect ELISA detection method: The purified fiber protein was diluted to 0.5 μg / mL with coating buffer (0.05 M carbonate buffer, pH 9.6), and 100 μL / well was added to an ELISA plate and incubated at 37°C for 1 h. The coating buffer was discarded, and the plate was washed 4 times with PBST. 5% skim milk was added and the plate was blocked at 37°C for 1 h. The blocking buffer was discarded, and 100 μL of serially diluted hybridoma cell culture supernatant was added to each well and incubated at 37°C for 1 h. The supernatant was discarded, and the plate was washed 4 times with PBST. 100 μL of 1:1000 diluted HRP-labeled rabbit anti-mouse IgG was added to each well and the plate was incubated at 37°C for 1 h. The secondary antibody was discarded, and the plate was washed 4 times with PBST. 100 μL of TMB chromogenic solution was added and the plate was incubated at room temperature in the dark for 15 min. 50 μL of stop solution (2 M H2SO4) was added to stop the reaction, and the OD was detected by microplate reader. 450nm value.

[0052] 2) Indirect immunofluorescence (IFA) detection method: 9 × 10⁻⁶ cells per well. 4 DEF cells were seeded onto 96-well cell culture plates and cultured at 37°C in a 5% CO2 incubator until the cells covered 80% of the bottom of the wells. 200 TCID2 cells were then seeded into each well. 50EDSV was cultured for another 48 hours. Cells were fixed with 4% paraformaldehyde, then permeabilized with 0.1% Triton X-100, followed by blocking with 5% skim milk at 37°C for 1 hour. The blocking solution was discarded, and 50 μL of serially diluted hybridoma cell culture supernatant was added to each well. The cells were incubated at 37°C for 30 minutes, the solution was discarded, and the cells were washed 6 times with PBS. 50 μL of 1:1000 diluted DyLight 488-labeled rabbit anti-mouse IgG was added to each well, and the cells were incubated at 37°C for 30 minutes. The solution was discarded, and the cells were washed 6 times with PBS. 100 μL of PBS was added to each well, and the cells were observed under an inverted fluorescence microscope.

[0053] After identification by enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence assay (IFA), positive hybridoma cell clones were transferred to 24-well cell culture plates and monoclonalized by limiting dilution method to ensure that a stable hybridoma cell line secreting monoclonal antibodies was obtained. Effective positive monoclonal clones 5G4 and 6G6 were used to prepare mouse ascites fluid.

[0054] Ascites preparation: Syndrome-producing BALB / c female rats were intraperitoneally injected with sterile liquid paraffin, 0.5 mL / rat. Ten days later, monoclonal antibody hybridoma cells in the logarithmic growth phase were washed twice with sterile PBS, resuspended in PBS, and then intraperitoneally injected with 3 × 10⁻⁶ cells. 6 Hybridoma cells, 0.5 mL / mouse. After 8–12 days, when the mouse abdomen was significantly distended, ascites fluid was collected. The cells were centrifuged at 500 rpm for 10 min, and the supernatant was collected and stored at -20℃ for later use. The titers of 5G4 and 6G6 monoclonal antibodies in the ascites fluid were detected by indirect ELISA and IFA methods, respectively. The results are shown in Table 1. The indirect ELISA titers of 5G4 and 6G6 monoclonal antibodies in the ascites fluid were 2.56 × 10⁻⁶ and 2.56 × 10⁻⁶, respectively. 5 and 1.02×10 6 The IFA valences were 4000 and 8000, respectively.

[0055] Table 1. Monoclonal antibody titers in ascites fluid indirect ELISA and IFA.

[0056]

[0057] 2. Purification of mouse anti-EDSV Fiber protein monoclonal antibody

[0058] The 5G4 and 6G6 affinity chromatography purification was performed using the PIERCE NAb™ Protein G Spin Purification Kit. The purification steps were as follows: First, the protein G column was equilibrated with 5 column volumes of 20 mM sodium phosphate (pH 7.4). Ascites fluid diluted with 20 mM sodium phosphate (pH 7.4) was loaded onto the protein G column. The protein G column was washed with 10 column volumes of 20 mM sodium phosphate (pH 7.4). 100 μL of 1 M Tris-HCl (pH 9.0) was added to each collection tube before elution with 0.1 M glycine solution (pH 2.7). 900 μL of eluent was collected from each collection tube, and the tubes were immediately inverted to mix after collection. After collection, the monoclonal antibody was concentrated and then transferred to PBS buffer. The purity of the monoclonal antibody was determined by SDS-PAGE electrophoresis. Figure 2 .

[0059] from Figure 2 It can be seen that the purified 5G4 and 6G6 have only two bands, corresponding to the light chain and heavy chain of the antibody, respectively, indicating high purity.

[0060] The hybridoma cell lines 5G4 and 6G6 of this application have been deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, on July 18, 2023. The accession number for hybridoma cell line 5G4 is CCTCC NO: C2023213, and the accession number for hybridoma cell line 6G6 is CCTCC NO: C2023214.

[0061] 3. Horseradish peroxidase (HRP) labeled mouse anti-EDSV fiber protein monoclonal antibody 6G6

[0062] HRP-6G6 was prepared by labeling purified mouse anti-EDSV fiber protein monoclonal antibody 6G6 using the Abcam HRP conjugation kit. The labeling effect of the monoclonal antibody was then detected by ELISA. ELISA assay: The purified fiber protein was diluted to 0.5 μg / mL with coating buffer (0.05 mol / L carbonate buffer, pH 9.6), and 100 μL / well was added to an ELISA plate and incubated at 37°C for 1 h. The coating buffer was discarded, and the plate was washed four times with PBST. 5% skim milk was added, and the plate was blocked at 37°C for 1 h. The blocking buffer was discarded, and the plate was washed four times with PBST. 100 μL of the corresponding dilution of HRP-6G6 was added to each well, and the plate was incubated at 37°C for 1 h. HRP-6G6 was discarded, and the plate was washed four times with PBST. 100 μL of TMB chromogenic solution was added, and the plate was incubated at room temperature in the dark for 15 min. The reaction was terminated by adding 50 μL of stop solution (2M H2SO4), and the OD was measured using a microplate reader. 450nm Value. Result as follows Figure 3The HRP-6G6 titer can reach 12800, indicating that the labeling effect is good.

[0063] 4. PCR amplification and sequencing of the variable region genes of monoclonal antibodies 5G4 and 6G6

[0064] Two hybridoma cell lines secreting monoclonal antibodies 5G4 and 6G6 were cultured and allowed to grow into T25 cell culture flasks. The supernatant was discarded, and RNA was extracted using the TRizol method, followed by reverse transcription (total volume 20 μL, reaction at 37°C for 15 min, inactivation at 85°C for 5 s).

[0065] Using the primers in Table 2, the heavy chain and light chain variable regions of the monoclonal antibody were amplified by PCR in a total volume of 50 μL. The amplification program was as follows: pre-denaturation at 98℃ for 5 min; denaturation at 98℃ for 10 s, annealing at 55℃ for 10 s, extension at 68℃ for 2 min, for 30 cycles; and extension at 68℃ for 2 min. The PCR amplification products were then identified by agarose gel electrophoresis (1%). Based on the position of the target band, the target gene was recovered by gel excision. The nucleic acid sequence of the target gene, i.e., the heavy chain and light chain variable regions of the monoclonal antibody, was determined.

[0066] Table 2 Primer sequences for amplifying the variable region of monoclonal antibodies.

[0067]

[0068] Where S=C / G, W=A / T, M=A / C, R=A / G.

[0069] Example 3: Establishment of the EDSV double-antibody sandwich ELISA method

[0070] 1. Determine the optimal dilution concentrations of capture antibody and enzyme-labeled antibody.

[0071] The optimal working concentrations of the capture and detection antibodies were determined using a checkerboard method. Monoclonal antibody 5G4 was diluted with coating buffer at ratios of 7000, 3500, 1750, 875, 438, 219, 109, and 55 ng / well, and added horizontally to ELISA plates, 100 μL per well. The plates were incubated overnight at 4°C and washed four times with PBST. Then, 200 μL of 5% skim milk was added to each well, and the plates were blocked at 37°C for 1 h. The plates were then washed three times with PBST. Add virus solution or PBST dilution buffer (negative control) to ELISA plates, set up parallel wells, 100 μL per well, incubate at 37°C for 1 h, wash the plate 3 times with PBST, add serially diluted detection antibody (HRP-6G6) at 100 μL / well to a 96-well plate, incubate at 37°C for 1 h, wash the plate 5 times with PBST, add TMB chromogenic buffer, incubate at room temperature in the dark for 15 min, add 50 μL of stop solution (2M H2SO4) to terminate the reaction, and measure OD using a microplate reader. 450nm value.

[0072] The results are shown in Table 3. When the concentration of the capture antibody decreased, the positive OD... 450nm The value initially remained constant, then decreased as the concentration of the capture antibody decreased; therefore, this experiment selected positive OD. 450nm The optimal concentration of capture antibody is defined as the concentration at which the detection antibody concentration decreases significantly; when the detection antibody concentration decreases, the positive OD value... 450nm The value then decreases, negative OD 450nm The value also decreased significantly. Therefore, this experiment selected the concentration of the detection antibody corresponding to a significant decrease in positive value and a negative value below 0.1 as the optimal concentration (the value in parentheses is the negative value).

[0073] As shown in the underlined portion of Table 3, the optimal coating concentration of the capture antibody 5G4 is 219 ng / well, and the effective concentration of the detection antibody HRP 6G6 enzyme-labeled secondary antibody is 1:6400.

[0074] Table 3 Determination of optimal working concentrations of capture and detection antibodies.

[0075]

[0076] The samples outside the parentheses in the table are positive samples, i.e., viral fluid OD. 450 Values, with the values ​​in parentheses representing the negative control, i.e., the OD values ​​of the diluted PBST solution 450 value.

[0077] 2. Selection of optimal reaction conditions for double-antibody sandwich ELISA

[0078] (1) Determination of optimal coating temperature and time: ELISA plates were coated with the capture antibody at a concentration of 5G4. Coating times and temperatures were selected as follows: 37℃ for 1 h, 2 h, 3 h, and 4 h, and overnight coating at 4℃. Based on OD... 450nmThe optimal coating conditions were determined by the P / N ratio and the P / N value. The results showed that the highest P / N value was achieved with overnight coating at 4℃; therefore, this condition was determined as the optimal coating condition. The results are shown in Table 4.

[0079] Table 4. Screening of Optimal Coating Temperature and Time

[0080] P / N value 14.58 15.65 15.47 15.89 17.07

[0081] (2) Selection of blocking solutions: 5% skim milk, 10% skim milk, 3% BSA, and 5% BSA were selected as blocking solutions, and the experimental method was the same as in step (1). Based on OD... 450nm The optimal blocking solution was determined by the P / N ratio. Results showed that 5% skim milk had the highest P / N ratio when used as the blocking solution, and skim milk powder was also the most cost-effective; therefore, 5% skim milk was chosen as the blocking solution. The results are shown in Table 5.

[0082] Table 5 Screening of the optimal blocking solution

[0083] 5% skim milk 5.14 10% skim milk 4.26 3% BSA 3.81 5% BSA 4.65

[0084] (3) Selection of sealing time and temperature:

[0085] Skim milk was selected and blocked at 37°C for 1 h, 1.5 h, 2 h, 2.5 h, and 3 h, and overnight at 4°C, using the same experimental method as step (1). Based on OD... 450nm The optimal sealing conditions were determined by the P / N ratio and the P / N value. The results showed that the P / N value was highest when sealed at 37℃ for 2 hours, and it was not much different from that when sealed overnight at 4℃. Therefore, sealing at 37℃ for 2 hours was selected as the optimal sealing condition. The results are shown in Table 6.

[0086] Table 6 Screening of Optimal Closure Conditions

[0087] 37℃1h 4.12 37℃1.5h 4.56 37℃2h 5.41 37℃2.5h 5.07 37℃3h 4.87 4℃ overnight 5.23

[0088] (4) Determination of antigen incubation time: Incubation at 37℃ for 0.5h, 1h, 1.5h, and 2h was selected, using the same experimental method as step (1). Based on OD... 450nm The optimal antigen incubation time was determined by the P / N ratio and the P / N value. The results showed that the P / N value was highest at 37℃ for 1 hour, therefore, 37℃ for 1 hour was determined to be the optimal antigen incubation time. The results are shown in Table 7.

[0089] Table 7 Determination of Optimal Antigen Incubation Time

[0090] 0.5h 3.37 1h 4.51 1.5h 4.21 2h 3.98

[0091] (5) Determination of the reaction time of enzyme-labeled antibody HRP-6G6: Incubation at 37℃ for 0.5h, 1h, 1.5h, and 2h was performed, following the same experimental method as step (1). Based on OD... 450nmThe optimal incubation time for enzyme-labeled antibodies was determined by the P / N ratio and the P / N value. Results showed that the P / N value was highest at 37℃ for 1 hour; therefore, 37℃ for 1 hour was determined to be the optimal incubation time for enzyme-labeled antibodies. The results are shown in Table 8.

[0092] Table 8 Determination of the optimal incubation time for enzyme-labeled antibodies

[0093] 0.5h 3.25 1h 4.31 1.5h 3.76 2h 3.07

[0094] (6) Determination of color development time: Color development at 37℃ for 5 min, 10 min, 15 min, and 20 min was selected, using the same experimental method as step (1). Based on OD... 450nm The optimal development time of the TMB colorimetric solution was determined by the P / N ratio and the P / N value. The results showed that the P / N value was highest at 37℃ for 15 min, therefore the optimal reaction time for the TMB colorimetric solution was determined to be 15 min. The results are shown in Table 9.

[0095] Table 9 Determination of Optimal Color Development Time

[0096] 5min 3.47 10min 3.97 15min 4.21 20min 3.84

[0097] Example 4: Detection method of chicken egg drop syndrome virus using a double-antibody sandwich ELISA kit, including the following steps:

[0098] (1) Coating: The purified mouse anti-EDSV Fiber protein monoclonal antibody 5G4 was diluted and coated on the microplate. It was incubated at 4°C overnight. The coating concentration of the capture antibody 5G4 was 219 ng / well.

[0099] (2) Blocking: Use 5% skim milk as the blocking solution and block the ELISA plate at 37℃ for 2 hours;

[0100] (3) Sample addition: Add the sample to be tested and incubate at 37°C for 1 hour to carry out the reaction;

[0101] (4) Add enzyme-labeled secondary antibody: Add diluted HRP-labeled mouse anti-EDSV Fiber protein detection antibody, i.e., HRP-6G6, and incubate at 37℃ for 1 hour; the dilution factor of the detection antibody HRP-6G6 is 1:6400;

[0102] (5) Color development: Add TMB substrate and develop color in the dark for 15 minutes;

[0103] (6) Termination: Add 2M H2SO4 stop solution to terminate the reaction;

[0104] (7) Reading value: OD measured by enzyme-linked immunosorbent assay (ELISA) reader 450 .

[0105] The enzyme-labeled secondary antibody was HRP-labeled mouse anti-EDSV fiber protein monoclonal antibody 6G6, the blocking buffer was 5% skim milk, the diluent was PBST, the washing buffer was the same as the diluent, the chromogenic solution was TMB, and the stop solution was 2M H2SO4.

[0106] Diluent PBST: 0.27g KH2PO4, 1.42g Na2HPO4·12H2O, 8.0g NaCl, 0.2g KCl, and 0.5ml L (within 20 minutes) were diluted to 1L of deionized water and the pH was adjusted to 7.4.

[0107] Example 5. Performance Test

[0108] 1. Determination of critical values

[0109] Thirty-five EDSV-negative samples were tested using the double-antibody sandwich ELISA method described in Example 4, and the OD values ​​of the 35 samples were calculated. 450nm The mean (Mean) and standard deviation (SD) were calculated, and the critical value for positive and negative samples was calculated according to the formula (critical value for positive and negative samples = Mean + 3SD). The result is 0.099 + 3 × 0.031 = 0.192.

[0110] 2. Sensitivity test

[0111] Based on the selected ELISA reaction conditions, EDSV TCID 50 10 -6.4 The sensitivity of the established double-antibody sandwich ELISA kit was tested by serially diluting the virus at a ratio of 1:100 to 2:1. The OD value of the virus was measured at a ratio of 1:3200. 450nm The value is 0.234, which is greater than the critical value. Therefore, the minimum virus detection limit for this method is 10. 2.9 TCID 50 / mL.

[0112] Table 10 Sensitivity Test Results

[0113] 1:100 4.317 1:200 2.484 1:400 1.342 1:800 0.687 1:1600 0.382 1:3200 0.234 1:6400 0.132

[0114] 3. Specificity test

[0115] An optimized double-antibody sandwich ELISA method was used to detect NDV, IBDV, IBV, and FAdV-4. Each sample was tested in triplicate, with EDSV used as a positive control and PBS as a negative control. The results showed that only EDSV was positive, while the others did not react, indicating that the method of this invention can differentiate and diagnose EDSV.

[0116] Table 11 Specificity Tests

[0117]

[0118]

[0119] 4. Repeatability test

[0120] Using EDSV virus fluid from the same batch as the detection antigen and negative allantoic fluid as the negative control, 30 repeated tests were performed within and between batches. The results were based on OD... 450nm The value is used to calculate the intra-batch and inter-batch differences. Coefficient of variation (CV) = (standard deviation / mean) × 100%.

[0121] The results showed that the intra-assay coefficient of variation was 8.07% and the inter-assay coefficient of variation was 8.16%. Therefore, the coefficients of variation for the repeatability tests were all below 10%, indicating that the double-antibody sandwich ELISA method of the present invention has good repeatability.

[0122] Example 6. Comparison of the double-antibody sandwich ELISA detection method of the present invention with RT-PCR

[0123] Fifteen 10-week-old SPF chickens were selected and divided into two groups: 13 chickens were challenged with EDSV virus as the experimental group, and 2 chickens served as negative controls. The experimental group chickens were challenged with 200 μl of EDSV virus (10... 6.4 TCID 50 The liver was challenged with intramuscular injection of EDSV ( / mL) on day 5 post-challenge, and liver samples were collected. The tissue was homogenized, and a portion of the supernatant was collected and detected using the EDSV double-antibody sandwich ELISA method described in Example 4. DNA was extracted from the other portion of the sample, and the liver viral load was detected by RT-PCR. The primers were designed based on the EDSV penton gene sequence: P1: 5′-CGTTCGCCTAATGACT-3′, P2: 5′-CTGCCTTCCAACTTTC-3′. The concordance rate between the EDSV double-antibody sandwich ELISA and RT-PCR results was then calculated.

[0124] ELISA test results: 12 positive samples and 3 negative samples. RT-PCR results: 13 out of 15 samples were positive and 2 were negative. Both methods detected 12 positive and 2 negative samples, with a concordance rate of 93.33% (14 / 15) (Table 12).

[0125] Table 12 Comparison results of the double-antibody sandwich ELISA and RT-PCR methods of the present invention.

[0126]

[0127] Sequence List:

[0128] SEQ.ID NO.1

[0129] GGTGCAGGCCAGGAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGTCTCAGT

[0130] GAAGATTTCCTGCAAGGGTTCTGGCTACACATTCTCTGATTATTCTCTGCAC

[0131] TGGGTGAGGCAGAGTCATGCAAAGAGTCTTGAGTGGATTGGATTTATTAAT

[0132] ACTTACTATGGTGATACTACCTACAACCAGAAGTTCAAGGGCAAGGCCACA

[0133] ATGTCTGTAGACAAATCCTCCAGCACAGCCTATCTGGAACTTGCCAGACTG

[0134] ACATCTGAAGATTCTGCCTTCTATTACTGTTCAAGATATGCCCCTTATGGAA

[0135] ACTACGGTTTTTCTTACTGGGGCCAAGGGACCACGGTCACCTCTCCTCAASEQ.ID NO.2

[0136] GACATTGAGGCCACCCAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAG

[0137] AGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTAT

[0138] AGTTATATGCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCT

[0139] CATCTATCTTGTATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGC

[0140] AGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGA

[0141] GGATGCTGCAACCTATTACTGTCCTCACATTTCTGAGCTTAAACCTACAAAG

[0142] GGGGGACCCTGCTGGGAATCAAACGGATGGGTCTGGGACAGACTTCACCC

[0143] TCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGC

[0144] ACATTAG

[0145] SEQ.ID NO.3

[0146] GTGAAGCTGCAGGAGTCAGGGCCTGAGGTGGTGAGGCCTGGGGTCTCAGT

[0147] GAAGATTTCCTGCAAGGATTATGGCTACACATTCATTGATTATGTTATGCACT

[0148] GGATGAAGCAGAGTCATCCAAAGAGTCTAGAGTGGATTGGACTTATTAATA

[0149] CTTACAATGGTAATACAGACTACAACCAGAAGTTTAAGGGCAAGGCCACAA

[0150] TGACTGTAGACAAATCCTCCAGCACAGCCTATATGGAACTTGCCAGATTGA

[0151] CATCTGAGGATTCTGCCATCTATTACTGTGCAAGGATTTACTACGGTAGTGG

[0152] CTACCAGGCCTGGTTTGCTTACTGGGGCCAAGGGACCACGGTCACCGACT

[0153] CCTCAATT

[0154] SEQ.ID NO.4

[0155] TCAGCCCTCCAGTCTCCAGCAATCCGGTCTGCATCTCCAGGGGAGAAGGTC

[0156] ACAATGACTTGCAGGGCCACCTCAAATGTAAGTTACCTGCACTGGTACCAG

[0157] CAGAAGCCAGGATCCTCCCCCAGACCCTGGATTTATACCACTTCCAACCTG

[0158] GCTTCTGGAGTCCCTGCTCCATTCGGTGGCAGTGGGTCTGGGACCTCTTAC

[0159] TCTCTCCCAATTAGCAGAGTGGAGGGGGAAGATGCTGCCCCTTTTTACTGC

[0160] CAGCAGTGGAGTAGTAACCCACACGTTCGGAGGGGGCACCAAGCTGGAAA

[0161] TTTCAAACGG

Claims

1. A double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus, characterized by, The plate includes blocking buffer, diluent, washing buffer, chromogenic buffer, and stop solution. The plate is coated with mouse anti-EDSV fiber protein monoclonal antibody 5G4 and HRP-labeled mouse anti-EDSV fiber protein monoclonal antibody 6G6. The nucleotide sequence of the heavy chain variable region of the coated monoclonal antibody 5G4 or antibody fragment is shown in SEQ.ID NO.1, and the nucleotide sequence of the light chain variable region is shown in SEQ.ID NO.2; The nucleotide sequence of the heavy chain variable region of the monoclonal antibody 6G6 or antibody fragment is shown in SEQ.ID NO.3, and the nucleotide sequence of the light chain variable region is shown in SEQ.ID NO.

4.

2. The kit of claim 1, wherein The monoclonal antibody 5G4 was secreted by the hybridoma cell line 5G4 with accession number CCTCCNO:C2023213.

3. The double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus according to claim 1, characterized in that, The monoclonal antibody 6G6 was secreted by the hybridoma cell line 6G6 with accession number CCTCC NO:C2023214.

4. The double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus according to claim 1, characterized in that, The blocking solution was 5% skim milk, the diluent and washing solution were PBST buffer, the colorimetric solution was TMB, and the stop solution was 2M H2SO4.

5. The double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus according to claim 1, characterized in that, The preparation method of mouse anti-EDSV Fiber protein monoclonal antibody is as follows: the EDSV Fiber gene is obtained by PCR amplification, and it is ligated with the prokaryotic expression vector pET28a to construct the recombinant plasmid pET28a-Fiber. The plasmid is transformed into Escherichia coli BL21, and the Fiber protein is obtained by IPTG induction expression. Then, the purified Fiber protein is obtained by nickel column purification. The purified Fiber protein is used as an immunogen to immunize mice and prepare multiple mouse anti-EDSV Fiber protein monoclonal antibodies.

6. The double antibody sandwich ELISA kit for detecting chicken egg drop syndrome virus according to claim 5, characterized in that, The purified fiber protein was used as an antigen to immunize Balb / c mice. Mouse spleen cells were fused with myeloma cells SP2 / 0 to prepare hybridoma cells. The cell supernatant was verified by indirect ELISA and indirect immunofluorescence to screen for positive clone cell lines. After three subcloning processes, the hybridoma cell lines were injected into mice to prepare ascites. Finally, the obtained ascites was purified to obtain mouse anti-EDSV fiber protein monoclonal antibodies 5G4 and 6G6.

7. A method for detecting the double antibody sandwich ELISA kit of the chicken egg drop syndrome virus according to claim 1, characterized by, The method includes the following steps: (1) Coating: The purified mouse anti-EDSV Fiber protein monoclonal antibody 5G4 was diluted and coated onto the microplate. It was incubated overnight at 4°C. The coating concentration of the capture antibody 5G4 was 219 ng / well. (2) Blocking: Use 5% skim milk as the blocking solution and block the ELISA plate at 37℃ for 2 hours; (3) Sample addition: Add the sample to be tested and incubate at 37°C for 1 hour to carry out the reaction; (4) Add enzyme-labeled secondary antibody: Add diluted HRP-labeled mouse anti-EDSV Fiber protein detection antibody, i.e., HRP-6G6, and incubate at 37℃ for 1 hour; the dilution factor of the detection antibody HRP-6G6 is 1:6400; (5) Color development: Add TMB substrate and develop color in the dark for 15 minutes; (6) Termination: Add 2M H2SO4 stop solution to terminate the reaction; (7) Reading value: OD measured by enzyme-linked immunosorbent assay (ELISA) reader 450 .

8. The application of monoclonal antibodies 5G4 and 6G6 in a reagent for detecting egg drop syndrome virus, characterized in that, Monoclonal antibody 5G4 was secreted by hybridoma cell line 5G4 with accession number CCTCC NO:C2023213; monoclonal antibody 6G6 was secreted by hybridoma cell line 6G6 with accession number CCTCC NO:C2023214.

9. The application of monoclonal antibodies 5G4 and 6G6 in a kit for detecting egg drop syndrome virus, characterized in that, Monoclonal antibody 5G4 was secreted by hybridoma cell line 5G4 with accession number CCTCC NO:C2023213; monoclonal antibody 6G6 was secreted by hybridoma cell line 6G6 with accession number CCTCC NO:C2023214.

Images