Substituted pyrrolopyrimidines and pyrazolopyrimidines as bruton's tyrosine kinase (btk) degraders
Patent Information
- Application Number
- CN202280022626.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-02-03
- Filing Date
- 2022-02-02
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2042-02-02
AI Technical Summary
通过BCR的错误信号传导可能导致B细胞功能失调和/或自身抗体的形成,从而可能导致自身免疫和/或炎性疾病
[1013]本发明的许多特征和优点从详细说明书中是显而易见的,因此所附权利要求旨在覆盖落入本发明的真实精神和范围内的本发明的所有这些特征和优点。此外,由于本领域技术人员将容易想到许多修改和变化,所以不希望将本发明限于所示和所描述的精确结构和操作,因此可以采用所有合适的修改和等同物,其落入本发明的范围。
Smart Images

Figure CN117042769B_ABST
Abstract
Description
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 145,126, filed February 3, 2021, the entire contents of which are incorporated herein by reference. Invention Field
[0002] This invention relates to compounds that regulate Bruton's tyrosine kinase (BTK). Specifically, this invention relates to compounds that degrade BTK, pharmaceutical compositions comprising such compounds, and methods of using such compositions. Background Technology
[0003] Signaling via the B-cell receptor (BCR) generates a series of biological outputs, partly dependent on the developmental stage of the B cell. Malfunctioning signaling via the BCR can lead to B-cell dysfunction and / or the formation of autoantibodies, potentially resulting in autoimmune and / or inflammatory diseases. Therapeutic agents that deplete B cells, such as Rituxan, are effective in treating inflammatory diseases such as rheumatoid arthritis.
[0004] BTK is a Tec family non-receptor protein kinase expressed in most hematopoietic cells (such as B cells, mast cells, and macrophages), but not in T cells, natural killer cells, and plasma cells. See S Smith, CI et al., J Immunology, 152(2), 557-65 (1994). BTK is an important component of the BCR and FcR signaling pathways, and targeted inhibition of BTK is a novel approach for treating many different human diseases, including B-cell malignancies, autoimmune diseases, and inflammatory disorders. See, for example, Uckun, Fatih M. et al., Anti-Cancer Agents in Med Chem. 7(6):624-632 (2007); Shinohara et al., Cell 132(5):794-806 (2008); Pan, Z., Drug News & Perspectives, 21(7):357-362 (2008); Gilfillan et al., Immuno. Rev. 228(1):149-169 (2009); Davis RE et al., Nature, 463:88-92 (2010). BTK plays a role in B cell development and activation and is involved in multiple signaling pathways across a wide range of immune-mediated diseases. BTK activity is associated with the pathogenesis of a variety of disorders and conditions, such as B-cell-related blood cancers (e.g., non-Hodgkin's lymphoma and B-cell chronic lymphocytic leukemia) and autoimmune diseases (e.g., rheumatoid arthritis, Sjögren's syndrome, pemphigus, inflammatory bowel disease, lupus, and asthma). Summary of the Invention
[0005] In some embodiments, this disclosure relates to compounds of formula (I), or tautomers, stereoisomers, or mixtures thereof, or pharmaceutically acceptable salts, or hydrates, or deuterated derivatives:
[0006]
[0007] in:
[0008] X is CH or N;
[0009] Y is either CH or N;
[0010] A is selected from -C(O)-, -SO2-, -S(O)-, -O-, -S-, -NH-, -N(C1-C5 alkyl)- and -C(O)NH(C1-C5 alkyl)-;
[0011] B is The condition is when B is A is not -O-;
[0012] R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, dialkylamino, amino, -CN, hydroxyl, C1-C4 alkoxy and halogen;
[0013] Each R2 and R3 is independently selected from H, halogen, -CN, hydroxyl, dialkylamino, C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkyl, deuterated C1-C5 alkoxy, and C1-C5 haloalkyl;
[0014] Q is either L-W1 or L-W2;
[0015] in
[0016] L is a linker group with a length of 2 to 20 carbon atoms, wherein one or more carbon atoms are optionally and independently replaced by groups selected from the following: C(=O), O, N(R6), S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, C2-alkenyl, C2-alkynyl, cycloalkyl, heterocycloalkyl, heterocyclic, aryl or heteroaryl, wherein each is independently replaced by 0, 1, 2 or 3 R7s;
[0017] W1 is selected from
[0018]
[0019] R4 is selected from H, halogens, -CN, C1-C5 alkyl, C1-C5 alkoxy, and C1-C5 haloalkyl; and
[0020] W2 is Or it may not exist, wherein R5 is selected from H, halogen, -CN, C1-C5 alkyl, deuterated C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkoxy and C1-C5 haloalkyl;
[0021] Each R6 is independently selected from H, C1-C3 alkyl, -C(=O)-(C1-C3 alkyl), -C(=O)-O-(C1-C3 alkyl), and -C(=O)-NH-(C1-C3 alkyl), and is substituted by 0, 1, 2, or 3 R7s;
[0022] Each R7 is independently selected from halogen, hydroxyl, amino, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl, -N(R6)2 and -CN.
[0023] In some embodiments, the compound of formula (I) can be a compound of formula (IA):
[0024]
[0025] In some embodiments, the compound of formula (I) can be a compound of formula (IB):
[0026]
[0027] In some implementations, A is -O- or -C(O)-NH-CH2-.
[0028] In some embodiments, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, and halogen.
[0029] In some embodiments, R2 and R3 are each independently selected from H, -OCD3, -CD3, halogen, C1-C4 alkyl, and C1-C4 alkoxy.
[0030] In some embodiments, R4 is selected from H, halogens, -CN, and C1-C4 haloalkyl groups.
[0031] In some embodiments, R5 is selected from H, halogens, deuterated C1-C5 alkoxy groups, and C1-C5 alkoxy groups.
[0032] In some embodiments, L is a linker group with a length of 2 to 12 carbon atoms, wherein one or more carbon atoms are optionally and independently replaced by a group selected from: C(=O), O, S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, NH, NCH3, NCH2CH3, C2-alkynyl,
[0033] In some embodiments, the compound of formula (I) (e.g., formula (IA), formula (IB)) may encompass stereoisomers and mixtures of stereoisomers. In some embodiments, the compound of formula (I) may encompass racemic isomers and enantiomers.
[0034] This document also discloses a method for treating conditions regulated by Bruton's tyrosine kinase (BTK) in subjects of need, comprising administering to the subject a compound of formula (I) (e.g., formula (IA), formula (IB)) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof. In at least one embodiment, the pharmaceutical composition of this disclosure may be used (or used to manufacture a pharmaceutical for) treating cancer, immune diseases, autoimmune diseases, and inflammatory diseases in subjects of need.
[0035] In at least one embodiment, a therapeutically effective amount of the disclosed pharmaceutical composition may be administered to a subject suffering from a BTK-regulated condition. In some embodiments, the BTK-regulated condition is selected from cancer, immune diseases, autoimmune diseases, and inflammatory diseases. In some embodiments, the condition is selected from B-cell malignancies, B-cell lymphoma, diffuse large B-cell lymphoma, chronic lymphocytic leukemia, non-Hodgkin's lymphoma, mantle cell lymphoma, follicular lymphoma, hairy cell leukemia, B-cell non-Hodgkin's lymphoma, Waldenström macroglobulinemia (Waldenström macroglobulinemia). Macroglobulinemia, multiple myeloma, bone cancer, bone metastases, arthritis, multiple sclerosis, osteoporosis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease, lupus, Sjögren's syndrome, and diseases related to kidney transplantation. Attached Figure Description
[0036] The foregoing overview and the following detailed description of this disclosure will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating this disclosure, the drawings illustrate some, but not all, alternative embodiments. However, it should be understood that this disclosure is not limited to the precise arrangements and means shown. These drawings, incorporated into and forming part of this specification, help to explain the principles of this disclosure.
[0037] Figure 1 The study demonstrated the BTK degradation activity of compounds 13, 25, 34, 42, 48, 49, 51, and 78 in the RAMOS cell line 6 hours after application.
[0038] Figure 2 The study demonstrated the BTK degradation activity of compounds 53, 54, 93, and 96 in the RAMOS cell line 6 hours after application. Invention Details
[0040] definition
[0041] Use a dash ("-") not between two letters or symbols to indicate the connection point of a substituent. For example, -CN is connected by a carbon atom.
[0042] When listing a range of values, the intention is to cover every value within the range and every subrange. For example, "C1-C6 alkyl" is intended to cover C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl, C5 alkyl, C6 alkyl, C... 1-6 Alkyl, C 1-5 Alkyl, C 1-4 Alkyl, C 1-3 Alkyl, C 1-2 Alkyl, C 2-6 Alkyl, C 2-5 Alkyl, C 2-4 Alkyl, C 2-3 Alkyl, C 3-6 Alkyl, C 3-5 Alkyl, C 3-4 Alkyl, C 4-6 Alkyl, C 4-5 Alkyl and C 5-6 alkyl.
[0043] As used herein, the term "acyl" refers to an RC(O)- group, such as, but not limited to, (alkyl)-C(O)-, (alkenyl)-C(O)-, (alkynyl)-C(O)-, (aryl)-C(O)-, (cycloalkyl)-C(O)-, (heteroaryl)-C(O)-, and (heterocyclic)-C(O)-, wherein the group is attached to the parent molecule structure via a carbonyl functional group. In some embodiments, C 1-10 An acyl group refers to, for example, the total number of carbonyl carbons in a chain or ring of an alkyl, alkenyl, alkynyl, aryl, cycloalkyl, or heteroaryl moiety, plus the acyl group. For example, a C4-acyl group has three other ring or chain atoms plus the carbonyl group.
[0044] As used herein, the term "alkenyl" refers to an unsaturated straight-chain or branched hydrocarbon having at least one carbon-carbon double bond, such as a straight-chain or branched group having 2-8 carbon atoms, referred to herein as (C... 2- C8) Alkenyl. Exemplary alkenyl groups include, but are not limited to, vinyl, allyl, butenyl, pentenyl, hexenyl, butadienyl, pentadienyl, hexadienyl, 2-ethylhexenyl, 2-propyl-2-butenyl, and 4-(2-methyl-3-buten)-pentenyl.
[0045] As used herein, the term "alkyl" refers to a saturated straight-chain or branched hydrocarbon, such as a straight-chain or branched group having 1-8 carbon atoms, referred to herein as (C... 1-8Alkyl groups. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-1-propyl, 2-methyl-2-propyl, 2-methyl-1-butyl, 3-methyl-1-butyl, 2-methyl-3-butyl, 2,2-dimethyl-1-propyl, 2-methyl-1-pentyl, 3-methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3-dimethyl-1-butyl, 2-ethyl-1-butyl, butyl, isobutyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, and octyl. In some embodiments, "alkyl" is a straight-chain hydrocarbon. In some embodiments, "alkyl" is a branched-chain hydrocarbon.
[0046] The term "alkoxy" refers to a straight-chain or branched saturated hydrocarbon containing 1 to 12 carbon atoms, such as -O (alkyl), which has a terminal "O" in the chain. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, tert-butoxy, or pentoxy.
[0047] As used in this article, the term "alkylene" refers to a divalent alkyl group. C 1-10 Representative examples of alkylene groups include, but are not limited to, methylene, ethylene, n-propylene, isopropylene, n-butylene, sec-butylene, isobutylene, tert-butylene, n-pentylene, isopentylene, neopentylene, n-hexylene, 3-methylhexylene, 2,2-dimethylpentylene, 2,3-dimethylpentylene, n-heptylene, n-octylene, n-nonylene, and n-decylene.
[0048] As used herein, the term "alkynyl" refers to an unsaturated straight-chain or branched hydrocarbon having at least one carbon-carbon triple bond, such as a straight-chain or branched group having 2-8 carbon atoms, referred to herein as (C2-C8) alkynyl. Exemplary alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, penynyl, hexynyl, methylpropynyl, 4-methyl-1-butynyl, 4-propyl-2-pentynyl, and 4-butyl-2-hexynyl.
[0049] As used herein, the term "aryl" refers to a monocyclic, bicyclic, or other polycyclic aromatic ring system having 5 to 14 ring atoms. The aryl group may optionally be fused with one or more rings selected from aryl, cycloalkyl, heteroaryl, and heterocyclic groups. The aryl groups of the present invention may be substituted with groups selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, aralkyl, carbamate, carboxyl, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclic, hydroxyl, ketone, nitro, phosphate ester, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thionyl groups. Exemplary aryl groups include, but are not limited to, phenyl, tolyl, anthracene, fluorenyl, indene, azulel, and naphthyl, as well as benzofused carbocyclic moieties, such as 5,6,7,8-tetrahydronaphthyl. Exemplary aryl groups also include, but are not limited to, monocyclic aromatic ring systems, wherein the ring comprises 6 carbon atoms, referred to herein as “C6-aryl”.
[0050] The term "cyano" as used in this article refers to -CN.
[0051] As used herein, the term "cycloalkyl" refers to a saturated or unsaturated cyclic, bicyclic, or bridged bicyclic hydrocarbon group having 3-16 carbon atoms, or 3-8 carbon atoms, referred to herein as "(C3-C8)cycloalkyl". Exemplary cycloalkyl groups include, but are not limited to, cyclohexane, cyclohexene, cyclopentane, and cyclopentene. Cycloalkyl groups may be substituted with alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxyl, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclic, hydroxyl, ketone, nitro, phosphate ester, thio, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone groups. Cycloalkyl groups may be fused with other cycloalkyl groups (saturated or partially unsaturated), aryl, or heterocyclic groups to form bicyclic, tetracyclic, etc. The term "cycloalkyl" also includes bridged and spirofused cyclic structures that may or may not contain heteroatoms.
[0052] As used in this article, the terms "halogen" or "halogenated" refer to -F, -Cl, -Br, and / or -I.
[0053] "Halogenated alkyl" refers to an alkyl group that has been substituted with one or more halogens. Examples of halogenated alkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, and trichloromethyl.
[0054] As used herein, the term "heteroaryl" refers to a monocyclic, bicyclic, or polycyclic aromatic ring system containing one or more heteroatoms, such as 1-3 heteroatoms, such as nitrogen, oxygen, and sulfur. Heteroaryl groups can be substituted with one or more substituents, including alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxyl, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclic, hydroxyl, ketone, nitro, phosphate ester, thio, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thionyl. Heteroaryl groups can also be fused with non-aromatic rings. Exemplary heteroaryl groups include, but are not limited to, monocyclic aromatic rings containing 2-5 carbon atoms and 1-3 heteroatoms, referred to herein as "(C2-C5)heteroaryl". Illustrative examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrimidinyl, pyrazyl, triazinyl, pyrroloyl, pyrazolyl, imidazolyl, (1,2,3)-triazolyl and (1,2,4)-triazolyl, pyrazinyl, pyrimidinyl, tetrazolyl, furanyl, thiophene, isoxazolyl, thiazolyl, furanyl, phenyl, isoxazolyl and oxazolyl. Exemplary heteroaryl groups also include, but are not limited to, bicyclic aromatic rings, wherein the ring comprises 5-14 carbon atoms and 1-3 heteroatoms, referred to herein as "(C5-C 14 "Heteroaryl groups". Representative examples of heteroaryl groups include, but are not limited to, indazole, indolyl, azaindolyl, indololinyl, benzotriazolyl, benzoxadiazolyl, imidazolyl, cinnolinyl, imidazopyridyl, pyrazolopyridyl, pyrrolopyridyl, quinolinyl, isoquinolinyl, quinazolinyl, quinazolinone, indololinone, isoindololinone, tetrahydronaphthyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, etc.
[0055] As used herein, the terms “heterocyclic,” “heterocyclic group,” or “heterocyclic” each refer to a saturated or unsaturated 3- to 18-membered ring containing one, two, three, or four heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. Heterocyclic rings can be aromatic (heteroaryl) or non-aromatic. Heterocyclic rings can be substituted with one or more substituents, including alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxyl, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclic, hydroxyl, ketone, nitro, phosphate ester, thio, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thionyl. Heterocyclic rings also include bicyclic, tricyclic, and tetracyclic groups, wherein any of the aforementioned heterocyclic rings is fused with one or two rings independently selected from aryl, cycloalkyl, and heterocyclic groups. Exemplary heterocycles include acridine, benzimidazolyl, benzofuranyl, benzothiazolyl, benzothiophene, benzoxazolyl, biotinyl, cenolinyl, dihydrofuranyl, dihydroindolyl, dihydropyranyl, dihydrothiaphene, dithiazolyl, furanyl, homopiperidinyl, imidazolyl, imidazolinyl, imidazolyl, indolyl, isoquinolinyl, isothiazolyl, isothiazolyl, isoxazolyl, isoxazolyl, morpholinyl, oxadiazolyl, oxazolyl, oxazolyl, piperazine, piperidinyl, and pyranyl. Pyrazolyl, pyrazinyl, pyrazolyl, pyrazolinyl, pyridinyl, pyridinyl, pyrimidinyl, pyrimidyl, pyrrolidinyl, pyrrolidine-2-one, pyrrolinyl, pyrrolidinyl, quinolinyl, quinoxaloyl, tetrahydrofuranyl, tetrahydroisoquinolinyl, tetrahydropyranyl, tetrahydroquinolinyl, tetrazolyl, thiadiazolyl, thiazolyl, thiazolyl, thiophenyl, thiomorpholinyl, thiaranyl, and triazolyl.
[0056] The term "hydroxyl group" as used in this article refers to -OH.
[0057] "Spirocycloalkyl" or "spirocycloyl" refers to a carbocyclic bicyclic system in which two rings are linked by a single atom. The rings may differ in size and properties, or they may be identical in size and properties. Examples include spiropentane, spirohexane, spiroheptane, spiroctane, spirononane, or spirodecane. One or both rings of the spirocyclic ring may fused to another ring, which may be a carbocyclic, heterocyclic, aromatic, or heteroaromatic ring. (C) 3-12 Spirocycloalkyl groups are spirocyclic rings containing 3 to 12 carbon atoms.
[0058] "Spiroheteroalkyl" or "spiroheteroyl" refers to a spirocycle in which at least one ring is a heterocycle, and one or more carbon atoms may be substituted with heteroatoms (e.g., one or more carbon atoms may be substituted with heteroatoms in at least one ring). One or both rings of a spiroheterocycle may fused to another carbon ring, heterocycle, aromatic ring, or heteroaromatic ring.
[0059] "Isomers" are compounds that have the same number and type of atoms and therefore the same molecular weight, but whose atoms are arranged or configured differently in space.
[0060] "Stereoisomer" or "optical isomer" refers to a stable isomer having at least one chiral atom or producing restricted rotation perpendicular to the plane of asymmetry (e.g., certain biphenyls, propylenes, and spirocyclic compounds) and capable of rotating plane-polarized light. Because the asymmetric center and other chemical structures are present in the compounds disclosed herein that can produce stereoisomerism, this disclosure considers stereoisomers and mixtures thereof. The compounds of this disclosure and their salts include asymmetric carbon atoms and can therefore exist as single stereoisomers, racemates, and mixtures of enantiomers and diastereomers. Typically, such compounds are prepared as racemic mixtures. However, if desired, such compounds can be prepared or isolated as pure stereoisomers, i.e., as single enantiomers or diastereomers, or as mixtures enriched with stereoisomers. As discussed in more detail below, individual stereoisomers of the compound are prepared by synthesis from an optically active starting material containing the desired chiral center, or by preparing a mixture of enantiomeric products followed by separation or resolution (e.g., conversion to a diastereomeric mixture followed by separation or recrystallization, chromatographic techniques using chiral resolving agents, or direct separation of enantiomers on a chiral column). The starting compound of the specific stereochemistry is commercially available or prepared by the methods described below and resolved by techniques well known in the art.
[0061] It is well known in the art that the biological and pharmacological activities of a compound are sensitive to its stereochemistry. Therefore, for example, enantiomers often exhibit significantly different biological activities, including differences in pharmacokinetic properties (including metabolism, protein binding, etc.) and pharmacological properties (including the type, degree, and toxicity of the activity exhibited). Therefore, those skilled in the art will understand that an enantiomer may be more active or may exhibit beneficial effects when enriched relative to other enantiomers or when separated from other enantiomers. Furthermore, those skilled in the art will know how to separate, enrich, or selectively prepare enantiomers of the compounds disclosed herein from the knowledge of this disclosure and the prior art.
[0062] Therefore, although racemic forms of drugs can be used, they are generally less effective than administering an equal amount of the pure enantiomer; in fact, in some cases, an enantiomer can be pharmacologically inactive and merely act as a simple diluent. For example, although ibuprofen was previously administered in racemic form, only the S-isomer of ibuprofen has been found to be effective as an anti-inflammatory agent (however, in the case of ibuprofen, although the R-isomer is inactive, it is converted to the S-isomer in vivo, so the racemic form of the drug has a slower onset of action than the pure S-isomer). Furthermore, the pharmacological activities of enantiomers can differ significantly in their biological activity. For example, S-penicillamine is used to treat chronic arthritis, while R-penicillamine is toxic. In fact, some purified enantiomers are superior to racemic ones, as it has been reported that purified individual isomers have faster transdermal penetration rates compared to racemic mixtures. See U.S. Patent Nos. 5,114,946 and 4,818,541.
[0063] In some embodiments, the compound is a racemic mixture of (S)- and (R)- isomers. In other embodiments, mixtures of compounds are provided herein, wherein the individual compounds of the mixture are present primarily in the (S)- or (R)- isomer configuration. For example, the (S)-enantiomer of the compound mixture is in excess of more than about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or more. In other embodiments, the excess of the (S)-enantiomer of the compound mixture is greater than about 55% to about 99.5%, greater than about 60% to about 99.5%, greater than about 65% to about 99.5%, greater than about 70% to about 99.5%, greater than about 75% to about 99.5%, greater than about 80% to about 99.5%, greater than about 85% to about 99.5%, greater than about 90% to about 99.5%, greater than about 95% to about 99.5%, greater than about 96% to about 99.5%, greater than about 97% to about 99.5%, greater than about 98% to greater than about 99.5%, greater than about 99% to about 99.5%, or higher. In other embodiments, the (R)-enantiomer purity of the compound mixture is greater than about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or higher. In some other embodiments, the excess of the (R)-enantiomer of the compound mixture is greater than about 55% to about 99.5%, greater than about 60% to about 99.5%, greater than about 65% to about 99.5%, greater than about 70% to about 99.5%, greater than about 75% to about 99.5%, greater than about 80% to about 99.5%, greater than about 85% to about 99.5%, greater than about 90% to about 99.5%, greater than about 95% to about 99.5%, greater than about 96% to about 99.5%, greater than about 97% to about 99.5%, greater than about 98% to greater than about 99.5%, greater than about 99% to about 99.5%, or higher.
[0064] Individual stereoisomers of the disclosed compounds can be prepared by synthesis from commercially available starting materials containing asymmetric or stereocenters, or by preparing racemic mixtures followed by resolution methods well known to those skilled in the art. These resolution methods are exemplified by: (1) linking an enantiomer mixture to a chiral auxiliary agent, separating the resulting diastereomer mixture by recrystallization or chromatography, and releasing an optically pure product from the auxiliary agent; (2) forming a salt using an optically active resolving agent; or (3) directly separating the optically enantiomer mixture on a chiral chromatographic column. The stereoisomer mixture can also be resolved into its stereoisomer components by well-known methods such as chiral phase gas chromatography, chiral phase high-performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereoisomerically pure intermediates, reagents, and catalysts using known asymmetric synthetic methods.
[0065] Therefore, if one enantiomer is pharmacologically more active, less toxic, or has a preferred distribution in vivo than another enantiomer, it is more advantageous to administer that enantiomer preferentially. In this way, the treated patient will be exposed to a lower dose of the drug and a lower dose of the enantiomer, which may be toxic or may be an inhibitor of the other enantiomer.
[0066] As used herein, the term "pharmaceutically acceptable carrier" refers to any and all solvents, dispersion media, coatings, isotonic agents, and absorption delay agents compatible with drug administration. The use of such media and reagents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds that provide supplemental, additional, or enhanced therapeutic functions.
[0067] As used herein, the term "pharmaceuticalally acceptable composition" refers to a composition comprising at least one compound, as disclosed herein, formulated together with one or more pharmaceutically acceptable carriers.
[0068] As used herein, the term "pharmaceutically acceptable prodrug" means a prodrug of the compound of the present invention that, to the extent of reasonable medical judgment, is suitable for contact with tissues of humans and lower animals without undue toxicity, irritation, or anaphylactic reaction, is commensurate with a reasonable benefit / risk ratio, and is effective for its intended use, and where possible, means the zwitterionic form of the compound disclosed herein. It is discussed in Higuchi et al., "Prodrugs as Novel Delivery Systems," ACS Symposium Series, Vol. 14, and in Roche, EB et al., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference.
[0069] The term "pharmaceutically acceptable salt" refers to a salt in which acidic or basic groups can be present in compounds used in the compositions of the present invention. The inherently basic compounds included in the compositions of the present invention are capable of forming a variety of salts with various inorganic and organic acids. The pharmaceutically acceptable acids that can be used to prepare such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfates, citrates, malates, acetates, oxalates, chlorides, bromides, iodides, nitrates, sulfates, hydrogen sulfates, phosphates, acid phosphates, isonicotinates, acetates, lactates, salicylates, citrates, tartrates, oleates, tannates, pantothenates, hydrogen tartrates, ascorbic acid salts, succinates, maleates, gentianates, fumarates, gluconates, glucuronides, sucrose salts, formates, benzoates, glutamates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, and pyrates (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthylcarbamate)). The compounds contained in the compositions of the present invention, including the amino moiety, can also form pharmaceutically acceptable salts with various amino acids, in addition to the acids described above. The compositions of this invention contain inherently acidic compounds capable of forming alkaline salts with a variety of pharmacologically acceptable cations. Examples of these salts include alkali metal or alkaline earth metal salts, particularly calcium, magnesium, sodium, lithium, zinc, potassium, and iron salts.
[0070] As used herein, the nomenclature of compounds, including organic compounds, can be given using the common name, IUPAC, IUBMB, or CAS-recommended nomenclature. If a name is given, the compound structure can be reconstructed using a nomenclature convention system, or using commercially available software such as CHEMDRAW.TM (Cambridgesoft Corporation, USA) Those skilled in the art can readily determine the structure of the compound. The chemical name is PerkinElmer. Generated by Professional version 17.
[0071] The compounds of this invention may contain one or more chiral centers and / or double bonds, and thus exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. The term "stereoisomer" as used herein encompasses all geometric isomers, enantiomers, or diastereomers. These compounds may be represented by the symbol "R" or "S," depending on the configuration of the substituents surrounding the stereocarbon atom. This invention covers various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be referred to as "(±)" in nomenclature, but those skilled in the art will recognize that the structure can implicitly represent the chiral center. In some embodiments, enantiomers or stereoisomers substantially free of the corresponding enantiomers may be provided.
[0072] As used herein, “cancer” refers to a disease, disorder, or condition involving abnormal cell growth and having the potential to invade or spread to other parts of the body. Exemplary cancers include, but are not limited to, breast cancer, lung cancer, ovarian cancer, endometrial cancer, prostate cancer, and esophageal cancer.
[0073] As used herein, the term "subject" refers to an animal. Typically, the animal is a mammal. "Subject" also refers to, for example, primates (e.g., humans, males or females), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, etc. In some embodiments, the subject is a primate. In still other embodiments, the subject is a human.
[0074] As used herein, the term “inhibit”, “inhibition”, or “inhibiting” means the reduction or suppression of a given condition, symptom, or disorder or disease, or a significant reduction in the baseline activity of a biological activity or process.
[0075] As used herein, the term “treatment” for any disease or disorder, in one embodiment, means improving the disease or disorder (i.e., slowing or stopping or reducing the development of the disease or at least one of its clinical symptoms). In another embodiment, “treatment” means reducing or improving at least one bodily parameter, including those that the patient may not be able to discern. In yet another embodiment, “treatment” means moderating the disease or disorder physically (e.g., by stabilizing identifiable symptoms), physiologically (e.g., by stabilizing bodily parameters), or both. In yet another embodiment, “treatment” means preventing or delaying the onset, development, or progression of the disease or disorder.
[0076] As used in this article, a subject “needs” treatment if he or she will derive a biological, medical, or quality-of-life benefit from it.
[0077] Furthermore, unless otherwise stated, the structures described herein are also intended to include compounds distinguished only by the presence of one or more isotopically enriched atoms. For example, compounds having the structure of this invention, but using deuterium (… 2 H) or tritium ( 3 H) instead of hydrogen, or use 13 C- or 14 C-carbon atoms are substituted for carbon atoms, within the scope of this invention. Such compounds can be used, for example, as probes in analytical tools, bioassays, or therapeutic agents.
[0078] compound
[0079] In some embodiments, this document provides a compound of formula (I) or a tautomer, stereoisomer, or mixture thereof, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative thereof:
[0080]
[0081] in:
[0082] X is CH or N;
[0083] Y is either CH or N;
[0084] A is selected from -C(O)-, -SO2-, -S(O)-, -O-, -S-, -NH-, -N(C1-C5 alkyl)- and -C(O)NH(C1-C5 alkyl)-;
[0085] B is The condition is when B is A is not -O-;
[0086] R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, dialkylamino, amino, -CN, hydroxyl, C1-C4 alkoxy and halogen;
[0087] Each R2 and R3 is independently selected from H, halogen, -CN, hydroxyl, dialkylamino, C1-C5 alkyl, C1-C5 alkoxy, deuterated C1-C5 alkyl, deuterated C1-C5 alkoxy, and C1-C5 haloalkyl;
[0088] Q is either L-W1 or L-W2;
[0089] in
[0090] L is a linker group with a length of 2 to 20 carbon atoms, wherein one or more carbon atoms are optionally and independently replaced by groups selected from the following: C(=O), O, N(R6), S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, C2-alkenyl, C2-alkynyl, cycloalkyl, heterocycloalkyl, heterocyclic, aryl or heteroaryl, wherein each is independently replaced by 0, 1, 2 or 3 R7s;
[0091] W1 is selected from
[0092]
[0093] R4 is selected from H, halogens, -CN, C1-C5 alkyl, C1-C5 alkoxy, and C1-C5 haloalkyl; and
[0094] W2 is Or it may not exist, wherein R5 is selected from H, halogen, -CN, C1-C5 alkyl, C1-C5 alkoxy and C1-C5 haloalkyl;
[0095] Each R6 is independently selected from H, C1-C3 alkyl, -C(=O)-(C1-C3 alkyl), -C(=O)-O-(C1-C3 alkyl), and -C(=O)-NH-(C1-C3 alkyl), and is substituted by 0, 1, 2, or 3 R7s;
[0096] Each R7 is independently selected from halogens, hydroxyl groups, amino groups, C1-C3 alkyl groups, C1-C3 alkoxy groups, C1-C3 haloalkyl groups, -N(R6)2, and -CN. In some embodiments, the compound of formula (I) can be a compound of formula (IA):
[0097]
[0098] In some embodiments, the compound of formula (I) can be a compound of formula (IB):
[0099]
[0100] In some embodiments, A is -O- or -C(O)-NH-CH2. In some embodiments, A is -O-. In some embodiments, A is -C(O)-NH-CH2.
[0101] In some embodiments, R1 is selected from H, C1-C3 alkyl, C1-C3 haloalkyl, and halogens. In some embodiments, R1 is selected from H, F, Cl, Br, I, -CF3, -CH3, and In some embodiments, R1 is H. In some embodiments, R1 is Br. In some embodiments, R1 is Cl. In some embodiments, R1 is F. In some embodiments, R1 is I.
[0102] In some embodiments, R2 and R3 are each independently selected from H, -OCD3, -CD3, halogen, C1-C4 alkyl, and C1-C4 alkoxy. In some embodiments, R2 and R3 are each H. In some embodiments, R2 is H and R3 is F. In some embodiments, R2 is F and R3 is H. In some embodiments, R2 is -OCH3 and R3 is F. In some embodiments, R2 is F and R3 is -OCH3. In some embodiments, R2 is -OCD3 and R3 is F. In some embodiments, R2 is -F and R3 is -OCD3. In some embodiments, R2 is -CD3 and R3 is F. In some embodiments, R2 is -F and R3 is -CD3.
[0103] In some embodiments, R4 is selected from H, halogens, -CN, and C1-C4 haloalkyl groups. In some embodiments, R4 is H. In some embodiments, R4 is a halogen. In some embodiments, R4 is F. In some embodiments, R4 is Cl. In some embodiments, R4 is Br.
[0104] In some embodiments, R5 is selected from H, halogens, deuterated C1-C5 alkoxy groups, and C1-C5 alkoxy groups. In some embodiments, R5 is -OCH3 or -OCD3. In some embodiments, R5 is -OCH3.
[0105] In some embodiments, L is a linker group with a length of 2 to 12 carbon atoms, wherein one or more carbon atoms are optionally and independently replaced by a group selected from: C(=O), O, S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, NH, NCH3, NCH2CH3, C2-alkynyl,
[0106] In some implementation schemes, W2 is Or it may not exist. In some implementations, W2 is... In some implementation schemes, W2 is In some implementation schemes, W2 is In some implementations, W2 is not present.
[0107] In some embodiments, this document provides compounds selected from those listed in Table 1 or pharmaceutically acceptable salts thereof.
[0108] Table 1. Exemplary Compounds of this Disclosure
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136] Pharmaceutical Composition
[0137] The pharmaceutical compositions disclosed herein comprise at least one compound of formula (I) (e.g., formula (IA), formula (IB)), or a tautomer, stereoisomer, or mixture thereof, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative thereof, formulated with one or more pharmaceutically acceptable carriers. These formulations include those suitable for oral, rectal, topical, buccal, and parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous) administration. The most suitable form of administration in any given situation will depend on the extent and severity of the condition being treated and the nature of the specific compound used.
[0138] Formulations suitable for oral administration may exist in discrete units, such as capsules, pouches, lozenges, or tablets, each containing a predetermined amount as powder or granules; as solutions or suspensions in aqueous or non-aqueous liquids; or as oil-in-water or water-in-oil emulsions of the disclosed compounds. As noted, such formulations can be prepared by any suitable pharmaceutical method comprising the step of combining at least one of the disclosed compounds as an active compound with a carrier or excipient (which may constitute one or more auxiliary components). The carrier must be acceptable in the sense of compatibility with the other components of the formulation and must not be harmful to the recipient. The carrier may be solid or liquid, or both, and may be formulated together with at least one compound described herein as an active compound in a unit-dose formulation, such as a tablet, which may contain about 0.05% to about 95% by weight of at least one active compound. Other pharmacologically active substances, including other compounds, may also be present. The formulations of the disclosed invention can be prepared by any well-known pharmaceutical technique consisting essentially of mixing the components.
[0139] For solid compositions, conventional non-toxic solid carriers include, for example, pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, etc. Liquidly pharmacologically applicable compositions can be prepared, for example, by dissolving or dispersing at least one active compound of the present disclosure as described herein and optionally a pharmaceutical adjuvant in an excipient, such as water, saline, dextran aqueous solution, glycerol, ethanol, etc., to form a solution or suspension. Generally, suitable formulations can be prepared by uniformly and tightly mixing at least one active compound of the present disclosure with a liquid or finely granulated solid carrier, or both, and then shaping the product if desired. For example, tablets can be prepared by pressing or molding at least one compound of the present disclosure into powder or granules (which may optionally be combined with one or more excipients). Compressed tablets can be prepared by compressing at least one free-flowing form of the present disclosure, such as powder or granules (which may optionally be mixed with a binder, lubricant, inert diluent, and / or surfactant / dispersant), in a suitable machine. Molded tablets can be prepared by molding in a suitable machine, wherein at least one compound of the present disclosure is wetted in powder form with an inert liquid diluent.
[0140] Formulations suitable for buccal (sublingual) application include tablets containing at least one compound of the present disclosure in a flavoring matrix (typically sucrose and gum arabic or tragacanth), and tablets containing at least one compound in an inert matrix (e.g., gelatin and glycerin or sucrose and gum arabic).
[0141] Formulations of this disclosure suitable for parenteral administration comprise at least one compound of formula (I) (e.g., formula (IA), formula (IB)), or a tautomer, stereoisomer, or mixture thereof, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative thereof, in a sterile aqueous formulation substantially isotonic with the blood of the intended recipient. These formulations are administered intravenously, but may also be administered subcutaneously, intramuscularly, or intradermally. Such formulations can be conveniently prepared by mixing at least one compound described herein with water and sterilizing the resulting solution to be isotonic with blood. Injectable compositions according to this disclosure may contain about 0.1% to about 5% w / w of the active compound.
[0142] Formulations suitable for rectal administration are provided in the form of unit-dose suppositories. These can be prepared by mixing at least one of the compounds described herein with one or more conventional solid carriers, such as cocoa butter, and then molding the resulting mixture.
[0143] Formulations suitable for topical application to the skin may be in the form of ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils. Carriers and excipients that may be used include petrolatum, lanolin, polyethylene glycol, alcohols, and combinations of two or more thereof. The active compound (i.e., at least one compound of formula (I) (e.g., formula (IA), formula (IB)), or a tautomer, stereoisomer, or mixture thereof, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative) is typically present at a concentration of about 0.1% to about 15% w / w of the composition, for example, about 0.5% to about 2%.
[0144] The amount of active compound administered can depend on the subject being treated, the subject's weight, the method of administration, and the prescribing physician's judgment. For example, a dosing regimen may include administering the encapsulated compound daily or semi-daily at a perceived dosage of about 1 μg to about 1000 mg. In another embodiment, intermittent administration may be used, such as administering a fixed dose of the encapsulated compound monthly or annually. Encapsulation facilitates reach of the site of action and allows for simultaneous administration of the active ingredient, theoretically producing a synergistic effect. Following standard dosing regimens, physicians can easily determine the optimal dosage and can readily modify the dosing to achieve such a dosage.
[0145] The therapeutically effective amount of the compounds or compositions disclosed herein can be measured by the therapeutic efficacy of the compound. However, the dosage can vary depending on the patient's needs, the severity of the condition being treated, and the compound used. In one embodiment, the therapeutically effective amount of the disclosed compound is sufficient to establish a maximum plasma concentration. This may be based on an initial dose determined, for example, from animal studies, and adjusted for human administration according to recognized practice in the art.
[0146] Toxicity and therapeutic efficacy can be determined in cell cultures or laboratory animals using standard pharmaceutical procedures, such as determining LD50. 50 (The dose that is lethal to 50% of the population) and ED 50 (The dose effective for 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the LD50. 50 / ED 50 The ratio is expressed as [ratio]. Compositions exhibiting a high therapeutic index are preferred.
[0147] Data obtained from cell culture assays or animal studies can be used to develop a series of doses for human use. Therapeutic doses achieved in one animal model can be converted for use in another animal, including humans, using conversion factors known in the art (see, for example, Freireich et al., Cancer Chemother. Reports 50(4):219-244(1966) and the equivalent surface area dose factors shown in the table below).
[0148] Table 2. Equivalent surface area dose factor.
[0149]
[0150] The preferred dosage of these compounds includes ED. 50 The dosage is within a range of circulating concentrations with very low or no toxicity. This dosage can vary within this range depending on the dosage form and route of administration. Generally, the therapeutically effective dose can be varied based on the subject's age, condition, sex, and the severity of their medical condition. The dosage can be determined by a physician and adjusted as needed to suit observed therapeutic effects.
[0151] Treatment
[0152] In some embodiments, a compound of formula (I) (e.g., formula (IA), formula (IB)) or its tautomers, stereoisomers, or mixtures of stereoisomers, or a pharmaceutically acceptable salt, hydrate, or deuterated derivative is administered to treat a BTK-regulated condition in a subject of need. In some embodiments, the BTK-regulated condition is selected from cancer, immune diseases, autoimmune diseases, and inflammatory diseases.
[0153] In some implementations, the disease is an inflammatory disease, such as arthritis, kidney disease, or cancer, such as leukemia and lymphoma, such as chronic lymphocytic leukemia (CLL), multiple myeloma and small lymphocytic lymphoma (SLL), and B-cell non-Hodgkin lymphoma.
[0154] In some implementations, the disease is an autoimmune disease. In some implementations, the disease is rheumatoid arthritis. In some implementations, the autoimmune disease is lupus.
[0155] In one implementation, the subject in need suffers from a xenoimmune condition or disease, such as graft-versus-host disease, transplantation, blood transfusion, allergic reaction, allergy, type I hypersensitivity reaction, allergic conjunctivitis, allergic rhinitis, or atopic dermatitis.
[0156] In some implementation schemes, the subjects in need suffer from inflammatory diseases such as asthma, appendicitis, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, colitis, and conjunctivitis.
[0157] In some implementations, the recipients of the cancer are patients with cancer. In one implementation, the cancer is a B-cell proliferative disorder, such as diffuse large B-cell lymphoma, follicular lymphoma, lymphoma, chronic lymphocytic leukemia, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenström macroglobulinemia, splenic marginal zone lymphoma, plasmacytic myeloma, plasmacytoma, extranodular marginal zone B-cell lymphoma, nodular marginal zone B-cell lymphoma, mantle cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary exudative lymphoma, Burkitt lymphoma / leukemia, or lymphomatoid granuloma. In some implementations, the condition is selected from B-cell malignancies, B-cell lymphoma, diffuse large B-cell lymphoma, chronic lymphocytic leukemia, non-Hodgkin lymphoma, mantle cell lymphoma, follicular lymphoma, hairy cell leukemia, B-cell non-Hodgkin lymphoma, marginal zone lymphoma, Waldenström macroglobulinemia, multiple myeloma, bone cancer, bone metastases, arthritis, multiple sclerosis, osteoporosis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease, lupus, Sjögren's syndrome, and kidney transplant-related disorders. In some implementations, the condition is mantle cell lymphoma. In some implementations, the condition is chronic lymphocytic leukemia and small lymphocytic lymphoma. In some implementations, the condition is Waldenström macroglobulinemia. In some implementations, the condition is marginal zone lymphoma.
[0158] In some implementations, the recipient of the disease has an xenoimmune condition or illness, such as graft-versus-host disease (GVHD). In some implementations, the GVHD is acute GVHD. In some implementations, the GVHD is chronic GVHD.
[0159] In some embodiments, a compound of formula (I) (e.g., formula (IA), formula (IB)) or its tautomers, stereoisomers, pharmaceutically acceptable salts, hydrates, or deuterated derivatives are administered as a pharmaceutical composition.
[0160] In some embodiments, the present invention provides a method for degrading BTK in cells, comprising contacting cells with an effective amount of a compound of formula (I) (e.g., formula (IA), formula (IB)), a pharmaceutically acceptable salt thereof, or a pharmaceutical composition containing the compound or a pharmaceutically acceptable salt thereof. In one embodiment, the contact is performed in vitro. In one embodiment, the contact is performed in vivo.
[0161] As used herein, the term “contact” means bringing together a specified portion in an in vitro or in vivo system. For example, “contacting” BTK with a compound provided herein includes administering a compound provided herein to an individual or patient (e.g., a person) suffering from a condition regulated by BTK, and, for example, introducing a compound provided herein into a sample containing cells or a purified formulation of BTK.
[0162] The concentration and route of administration to the patient will vary depending on the condition being treated.
[0163] In one embodiment, a compound of formula (I) (e.g., formula (IA), formula (IB)) or its tautomers, stereoisomers, pharmaceutically acceptable salts, or hydrates, or its deuterated derivatives, are administered in combination with other therapeutic agents. In one embodiment, these therapeutic agents include chemotherapeutic agents, steroids, immunotherapeutic agents, targeted therapeutic agents, antibody-drug conjugates, B-cell receptor pathway inhibitors, antibodies, B-cell receptor signaling inhibitors, PI3K inhibitors, IAP inhibitors, mTOR inhibitors, radioimmunotherapy agents, DNA damaging agents, proteosome inhibitors, histone deacetylase inhibitors, protein kinase inhibitors, hedgehog inhibitors, Hsp90 inhibitors, telomerase inhibitors, Jak1 / 2 inhibitors, protease inhibitors, BCL2 inhibitors, PKC inhibitors, and PARP inhibitors. In some implementations, these therapeutic agents are chlorambucil, ifosfamide, doxorubicin, mesalazine, thalidomide, lenalidomide, tamsulosin, everolimus, fludarabine, fostamatinib, paclitaxel, docetaxel, olfamomumab, rituximab, dexamethasone, prednisone, CAL-101, tiimomamumab, tosimomumab, bortezomib, pentostatin, endostatin, bendamustine, cyclophosphamide, vincristine, venetoclax, and lenalidomide.
[0164] Those skilled in the art will recognize that in vivo and in vitro assays using appropriate, known and generally accepted cell and / or animal models can predict the ability of a test compound to treat or prevent a given disorder.
[0165] Those skilled in the art will further recognize that human clinical trials, including first-in-human trials, dose-range trials, and efficacy trials, can be conducted using methods well known in the clinical and medical fields. Example
[0166] The following examples and preparations further illustrate and demonstrate the compounds disclosed herein and the methods for preparing these compounds. It should be understood that the scope of the invention is not limited in any way by the following examples and formulations.
[0167] The chemical entities described herein can be synthesized according to one or more illustrative reaction formulas herein and / or techniques known in the art. Unless otherwise specified, the reactions described herein are generally carried out at atmospheric pressure and typically in a temperature range of about -10°C to about 200°C. Furthermore, unless otherwise specified, reaction times and conditions are intended to be approximate values; for example, carried out at about atmospheric pressure in a temperature range of about -10°C to about 200°C, for example, the time can be about 1 to about 24 hours; in some embodiments, reactions left overnight may average about 16 hours.
[0168] If desired, the separation and purification of the chemical entities and intermediates described herein can be achieved by any suitable separation or purification method (e.g., filtration, extraction, crystallization, column chromatography, thin-layer chromatography, or thick-layer chromatography, or a combination of these methods). See, for example, Carey et al., Advanced Organic Chemistry, 3 rd Ed., 1990 New York: Plenum Press; Mundy et al., Name Reaction and Reagents in Organic Synthesis, 2 nd Ed., 2005 Hoboken, NJ: J. Wiley & Sons. Specific descriptions of suitable separation and separation procedures are given with reference to the following examples. However, other equivalent separation or separation procedures may also be used.
[0169] In all methods, it is well known that, according to general principles of chemistry, protecting groups can be used when necessary for sensitive or reactive groups. Protecting groups are handled according to standard methods of organic synthesis (TW Greene and PGM Uts (1999) Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons). These groups can be removed at convenient stages of compound synthesis using methods readily apparent to those skilled in the art.
[0170] When needed, the (R)- and (S)-isomers of the non-limiting exemplary compounds (if present) can be separated by methods known to those skilled in the art, such as by forming diastereomer salts or complexes, which can be separated by, for example, crystallization; by forming diastereomer derivatives, which can be separated by, for example, crystallization, gas-liquid or liquid chromatography; selective reaction of an enantiomer with an enantiomer-specific reagent, such as enzymatic oxidation or reduction, followed by separation of modified and unmodified enantiomers; or gas-liquid or liquid chromatography in a chiral environment, such as on a chiral support, for example on silica incorporating chiral ligands, or in the presence of a chiral solvent. Alternatively, a particular enantiomer can be synthesized by asymmetric synthesis using optically active reagents, substrates, catalysts, or solvents, or by asymmetric transformation of one enantiomer into another.
[0171] The compounds described herein may optionally be contacted with pharmaceutically acceptable acids to form the corresponding acid addition salts. Furthermore, the compounds described herein may optionally be contacted with pharmaceutically acceptable bases to form the corresponding base addition salts.
[0172] In some embodiments, the disclosed compounds can typically be synthesized by combining known synthetic methods. Based on this disclosure, the techniques for synthesizing these chemical entities will be apparent to and known to those skilled in the art. Many optionally substituted starting compounds and other reactants are commercially available, for example from Millipore Sigma, or can be readily prepared by those skilled in the art using commonly used synthetic methods.
[0173] The following discussion is provided to illustrate some of the different methods that can be used to prepare the disclosed compounds and is not intended to limit the range of reactions or reaction sequences that can be used to prepare the compounds provided herein. Those skilled in the art will understand that, unless otherwise stated, standard valences apply to all compounds described herein, whether in the superposition or named form.
[0174] The following abbreviations have the following definitions:
[0175] 1. ACN: Acetonitrile
[0176] 2. DCM: Dichloromethane
[0177] 3. DIEA: Diisopropylethylamine
[0178] 4. DMF: Dimethylformamide
[0179] 5. EA: Ethyl acetate
[0180] 6. EDCI: 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide
[0181] 7.FA: Formic acid
[0182] 8. HATU: 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-hexafluorophosphate oxide
[0183] 9. HPLC: High-performance liquid chromatography
[0184] 10. LC / MS: Liquid Chromatography / Mass Spectrometry
[0185] 11.NMM: N-methylmorpholine
[0186] 12. NMR: Nuclear Magnetic Resonance
[0187] 13. PE: Petroleum ether
[0188] 14. TEA: Triethylamine
[0189] 15. TFA: Trifluoroacetic acid
[0190] 16. THF: Tetrahydrofuran
[0191] 17. TLC: Thin-layer chromatography
[0192] 18. TsCl: p-Toluenesulfonyl chloride
[0193] General synthesis scheme
[0194] The claimed compounds can be prepared according to the following schemes. These schemes represent general methods for preparing these compounds. However, the synthesis of these compounds is not limited to these representative methods, as they can also be prepared by those skilled in synthetic chemistry using a variety of other methods.
[0195] Scheme 1: Preparation method of compounds 1, 3, 4, 5 and 6
[0196]
[0197] Option 2: Preparation method of compound 2
[0198]
[0199] Option 3: Preparation method of compounds 7, 8, 11 and 19
[0200]
[0201] Option 4: Preparation method of compounds 14, 16, 17 and 20
[0202]
[0203] Option 5: Preparation method of compounds 9 and 10
[0204]
[0205] Option 6: Preparation method of compounds 12 and 18
[0206]
[0207] The following compounds were prepared according to scheme 3: compounds 22, 23, 28 and 31.
[0208] The following compounds were prepared according to scheme 4: compounds 13, 21, 24 and 25.
[0209] The following compounds were prepared according to Scheme 6: compounds 15, 26, 27, 29, 30, and 34. Scheme 7: Preparation method of compound 32.
[0210]
[0211] Compound 33 can be prepared using a method similar to that described in the synthesis of compound 32. Scheme 8: Preparation of compounds 35, 36, and 38
[0212]
[0213] Compounds 39, 40 and 41 can be prepared using the method described in Scheme 8.
[0214] Scheme 9: Preparation method of compounds 37 and 48
[0215]
[0216] Compounds 42 and 43 can be synthesized using a method similar to that described in Scheme 9.
[0217] Scheme 10: Preparation method of compound 44
[0218]
[0219] Compounds 45, 46 and 47 can be synthesized using a method similar to that described in the preparation of compound 44.
[0220] Scheme 11: Preparation method of compounds 49, 50, 51, 59 and 70
[0221]
[0222] Compounds 65, 66, 67, 68, 69, 81, 82 and 85 can be synthesized using a method similar to that described in Scheme 11.
[0223] Scheme 12: Preparation method of compounds 52, 53, 54, 56, 57, 58, 60 and 61
[0224]
[0225] Scheme 13: Preparation method of compounds 71, 72, 78 and 80
[0226]
[0227] Compound 79 can be synthesized using a method similar to that described in Scheme 13.
[0228] Scheme 14: Preparation method of compounds 73 and 74
[0229]
[0230] Compounds 75, 76 and 77 can be prepared using a method similar to that described in Scheme 14.
[0231] Scheme 15: Preparation method of compounds 83 and 84
[0232]
[0233] Scheme 16: Preparation method of compounds 86 and 87
[0234]
[0235] Scheme 17: Preparation method of compounds 88-91 and 100-101
[0236]
[0237] Compounds 93, 94, 95, 96, 97, 98, 99, 102, 103 and 104 can be prepared using a method similar to that described in Scheme 11.
[0238] Scheme 18: Preparation method of compounds 105-108
[0239]
[0240] Compound 109 can be synthesized using a method similar to that described in Scheme 18.
[0241] Preparation of intermediates
[0242] Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (intermediate A)
[0243]
[0244] Step 1: Preparation of methyl 2-chloro-4-phenoxybenzoate
[0245] A mixture of methyl 2-chloro-4-fluorobenzoate (20 g, 106.1 mmol), phenol (13 g, 137.9 mmol), and cesium carbonate (51.83 g, 156.1 mmol) in N,N-dimethylformamide (200 mL) was stirred at 90 °C for 16 hours. The mixture was extracted with EtOAc (200 mL × 3). The organic layer was washed with saturated NaCl solution and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 50:1 → 5:1) to give methyl 2-chloro-4-phenoxybenzoate (18 g, 64.5%).
[0246] Step 2: Preparation of (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone
[0247] 5-Bromo-4-chloro-7h-pyrrolo[2,3-d]pyrimidine (1 g, 4.3 mmol) was dissolved in tetrahydrofuran (25 mL) at -78 °C and Ar, and n-BuLi (2.5 M in hexane, 2 eq) was slowly added dropwise. The mixture was stirred at -78 °C for 1 h, and then a solution of methyl 2-chloro-4-phenoxybenzoate (1.1 eq) was added dropwise. The mixture was stirred at -78 °C for 2 h. The reaction was quenched with 1 N HCl and extracted with EtOAc. The organic layer was washed with brine and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was subjected to silica gel column chromatography (hexane:ethyl acetate = 9:1 to 1:1) to give (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (650 mg). LCMS: (ES+): m / z 383.02 [M] + .
[0248] Step 3: Preparation of (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylic acid tert-butyl ester
[0249] (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (1 g, 2.6 mmol), DIEA (3 eq), and (R)-3-aminopiperidin-1-carboxylic acid tert-butyl ester (1.2 eq) and isopropanol (12 mL) were added to a 20 mL microwave-safe tube. The mixture was heated at 160 °C for 1.5 h under microwave irradiation. After cooling to room temperature, the reaction mixture was extracted with EtOAc (40 mL × 4), and the organic layer was washed with brine and dried over sodium sulfate. After filtration, the filtrate was concentrated under reduced pressure. The residue was recrystallized from 25% EtOAc / petroleum ether to give (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carboxylic acid tert-butyl ester (1.1 g). LCMS:(ES+):m / z 547.2[M] + .
[0250] Step 4: Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone
[0251] To a solution of (R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carboxylic acid tert-butyl ester (11 g, 20.07 mmol) in 250 mL of dioxane, 4 N HCl in dioxane (50 mL) was added. The reaction mixture was stirred at room temperature for 2.0 h. The mixture was concentrated under vacuum to dryness. The residue was ground together with DCM to give a crude product (9 g). The solid was further purified by reversed-phase chromatography to give 7.8 g of TFA salt.
[0252] 1H NMR(400MHz,DMSO-d6)δ12.91(br,1H),8.91-8.81(m,3H),8.31(s,1H),7.70(s, 1H),7.58(d,J=8.4Hz,1H),7.49(t,J=7.6Hz,2H),7.27(t,J=7.6Hz,1H),7.20-7 .05(m,3H),7.05(d,J=6.7Hz,1H),4.44(s,1H),3.56(br,1H),3.25(br,1H),3.0 2-2.97(m,2H),2.15(br,1H),1.98(br,1H),1.82-1.77(m,2H).LCMS:(ES+):m / z 448.2[M] + .
[0253] Preparation of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone hydrochloride (intermediate B)
[0254]
[0255] Step 1: Preparation of tert-butyl 4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylic acid
[0256] Add (2-chloro-4-phenoxyphenyl)(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (4.4 g, 11.45 mmol), DIEA (3 eq), tert-butyl 4-aminopiperidine-1-carboxylate (1.2 eq), and isopropanol (12 mL) to a 20 mL microwave-safe tube. Heat the mixture at 160 °C for 1.5 h under microwave irradiation. After cooling to room temperature, extract the reaction mixture with EtOAc (40 mL × 4), wash the organic layer with brine, and dry it with sodium sulfate. Filter the mixture and concentrate the filtrate under reduced pressure. The residue was recrystallized from 25% EtOAc / petroleum ether to give tert-butyl 4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carboxylic acid (5 g). LCMS: (ES+): m / z 547.2 [M] + .
[0257] Step 2: Preparation of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone hydrochloride
[0258] To a solution of 10 g (18.3 mmol) of tert-butyl piperidine-1-carboxylate in 250 mL of dioxane, 4 N HCl in 50 mL of dioxane was added. The reaction mixture was stirred at room temperature for 2.0 h. The mixture was concentrated to dryness under vacuum. The residue was ground with DCM to give (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone hydrochloride (8 g).
[0259] 1H NMR (400MHz, MeOD) δ8.47(s,1H),7.85(s,1H),7.57(d,J=7.9Hz,1H),7.47(t,J=7.8Hz,2H),7.27(t,J=7.4Hz,1H),7.18–7 .10(m,3H),7.04(d,J=6.7Hz,1H),4.44(s,1H),3.57(br,2H),3.34(br,2H),2.47(br,2H),2.06(br,2H).LCMS:(ES+):m / z 448.2[M] + .
[0260] Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (intermediate C)
[0261]
[0262] According to the above scheme, the hydrochloride salt of intermediate 2-1 was prepared using a similar method described in the literature. LC / MS 343.1 [M+H] + ; 1 H-NMR (400MHz, CD3OD) δppm7.76(d,J=8.36Hz,1H),7.47(s,1H),7.35(dd,J=8.36,1.54Hz,1H),5.09(br dd,J=12.8,5.40Hz,1H),3.67-3.74(m,4H), 3.37-3.42(m,4H), 2.63-2.94(m,3H), 2.07-2.17(m,1H).
[0263] Synthesis of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidine-2,6-dionebenzenesulfonic acid (intermediate D)
[0264]
[0265] To a solution of (S)-4-(2-(1-amino-5-tert-butoxy-1,5-dioxopentan-2-yl)-1-oxoisoindoline-5-yl)piperazin-1-carboxylic acid tert-butyl ester (5.8 g, 12 mol) in acetonitrile (90 mL), benzenesulfonic acid (3.64 g, 23 mol) was added. The mixture was stirred at 85 °C for 12 hours. LC / MS showed that the reaction was complete. The mixture was concentrated under vacuum. The residue was ground with ethyl acetate to give ((S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidine-2,6-dione benzenesulfonate (5.2 g, 93%) as a grayish-white solid. LC / MS 329.1 [M+1] +; 1 H NMR (400MHz, DMSO-d6) δ1.95-1.99 (m, 1H), 2.36-2.41 (m, 1H), 2.58-2.62 (d, 1H), 2.88-2.91 (m, 1H), 3.26 (s, 4H), 3.49-3. 52(m, 4H), 4.21-4.38(dd, 2H), 5.05-5.10(dd, 1H), 7.12-7.16(m, 2H), 7.30-7.358(m, 3H), 7.58-7.62(m, 3H), 8.72(s, 2H).
[0266] Synthesis of N-(4-(4-amino-1-(4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Intermediate E)
[0267]
[0268] Step 1: Preparation of N-(4-bromobenzyl)-5-fluoro-2-methoxybenzamide
[0269] A solution of 5-fluoro-2-methoxybenzoic acid (30 g, 176 mmol, 1.0 eq), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethylurea hexafluorophosphate (80.5 g, 212 mmol, 1.2 eq), and N,N-diisopropylethylamine (45.6 g, 353 mmol, 2 eq) in N,N-dimethylformamide (300 mL) was stirred at 25 °C for 30 min. Then, (4-bromophenyl)methylamine (32.8 g, 176 mmol, 1.0 eq) was added to the solution, and the mixture was stirred at 25 °C for 12 h. The solution was poured into water (500 mL) and extracted with ethyl acetate (500 mL × 3). The combined organic phases were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by silica gel chromatography using 20%–30% ethyl acetate / petroleum ether solution as eluent to give the desired compound (56 g, 94% yield) as a white solid.
[0270] 1 HNMR(400MHz, CDCl3): δ8.26(br s, 1H), 7.94 (q, J=2.0Hz, 1H), 7.45 (d, J=7.6Hz, 2H), 7.22 (d, J=8.0Hz, 2H) , 7.16-7.12 (m, 1H), 6.94-6.91 (m, 1H), 4.61 (d, J=6.0Hz, 2H), 3.91 (s, 3H).
[0271] Step 2: Preparation of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)phenyl]methyl]benzamide
[0272] Potassium acetate (26.7 g, 272 mmol, 2.0 eq) and 1,1-bis(diphenylphosphine)ferrocene]palladium(II) dichloride (9.95 g, 13.6 mmol, 0.1 eq) were added to a solution of N-[(4-bromophenyl)methyl]-5-fluoro-2-methoxybenzamide (46 g, 136 mmol, 1.0 eq) and 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyl-2-yl)-1,3,2-dioxaborhecyl) dioxane (51.8 g, 204 mmol, 1.5 eq) in dioxane (500 mL). The suspension was degassed under vacuum and purged three times with nitrogen. The mixture was stirred at 90 °C for 12 hours under nitrogen. The solution was poured into water (2 L) and extracted with ethyl acetate (1 L × 3). The combined organic phases were washed with brine (2 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The combined crude products were purified by silica gel chromatography using 20%–30% ethyl acetate / petroleum ether as eluent. The crude products were ground together with petroleum ether (200 mL), filtered, and the filter cake was dried under vacuum to give the desired compound as a white solid (50 g, 79% yield). LC / MS: 386.2 [M+H] + .
[0273] Step 3: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0274] A mixture of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)phenyl]methyl]benzamide (10.0 g, 26.0 mmol, 1.0 eq), 3-iodo-1H-pyrazolo[3,4-d]pyrimidin-4-amine (6.78 g, 26.0 mmol, 1.0 eq), 1,1-bis(diphenylphosphine)ferrocene]palladium(II) dichloride (3.80 g, 5.19 mmol, 0.2 eq), and potassium phosphate (16.5 g, 77.9 mmol, 3.0 eq) in dioxane (200 mL) and water (40 mL) was degassed and purged three times with nitrogen. The mixture was then stirred at 110 °C for 60 h under a nitrogen atmosphere. The reaction mixture was partitioned between ethyl acetate (1 L) and water (1 L). The organic phase was separated, washed with brine (1 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was ground with acetonitrile (50 mL), then with ethyl acetate (50 mL). The solid was collected and dried under vacuum to give the desired compound (6.0 g, 59% yield) as a pale yellow solid. LC / MS: 393.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6): δ13.59 (s, 1H), 8.86 (t, J=6.0Hz, 1H), 8.22 (s, 1H), 7.64 (d, J=8.0Hz, 2H), 7. 57-7.47 (m, 3H), 7.37-7.31 (m, 1H), 7.19 (dd, J=4.4, 9.2Hz, 1H), 4.59 (d, J=6.0Hz, 2H), 3.90 (s, 3H).
[0275] Step 4: Preparation of N-[[4-[4-amino-1-[4-[4-[4-(dimethoxymethyl)-1-piperidinyl]-3-fluoro-phenyl]pyrazolo[3,4-d]pyrimidin-3-yl]phenyl]methyl]-5-fluoro-2-methoxy-benzamide
[0276] Add copper iodide (3.24 g, 17.0 mmol, 0.55 eq), 2-(dimethylamino)acetic acid (3.50 g, 33.98 mmol, 1.1 eq), and sodium carbonate (7.20 g, 68.0 mmol, 2.2 eq) to a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl]-5-fluoro-2-methoxy-benzamide (12.0 g, 30.6 mmol, 1.0 eq) in dimethyl sulfoxide (150 mL) to a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)piperidine (11.6 g, 30.6 mmol, 1.0 eq) in dimethyl sulfoxide (150 mL), copper iodide (3.24 g, 17.0 mmol, 0.55 eq), 2-(dimethylamino)acetic acid (3.50 g, 33.98 mmol, 1.1 eq), and sodium carbonate (7.20 g, 68.0 mmol, 2.2 eq). Degas the suspension under vacuum and purge three times with nitrogen. Stir the mixture at 110 °C for 12 hours under nitrogen. Partition the solution between ethyl acetate (800 mL) and water (2.0 L). The separated aqueous layer was extracted with ethyl acetate (700 mL × 3). The combined organic layers were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give a crude product (15 g). The crude product was refluxed and dissolved in ethyl acetate (420 mL). The solution was then cooled to ambient temperature, while a small amount of precipitate formed, and the mixture was stored in a refrigerator (~5 °C) for 48 hours. The solution was filtered, and the filter cake was washed with cold ethyl acetate (20 mL) to give a pure product (5.28 g). The mother liquor was concentrated, and the residue was recrystallized from ethyl acetate (100 mL) to give another batch of pure product (1.7 g) (total 6.98 g, 36% yield), as a gray solid. LC / MS: 644.2 [M+H] + . 1 HNMR (400MHz, CDCl3): δ8.47 (s, 1H), 8.38 (t, J=5.2Hz, 1H), 7.99 (dd, J=3.2, 9.2Hz, 1H), 7.97-7.93 (m, 1H), 7.92 (s, 1H), 7 .75 (d, J=8.0Hz, 2H), 7.56 (d, J=8.0Hz, 2H), 7.22-7.14 (m, 1H), 7.08 (t, J=8.8Hz, 1H), 6.97 (dd, J=4.4, 8.8Hz, 1H), 5.60 (br s, 2H), 4.78 (d, J=6.0Hz, 2H), 4.12 (d, J=7.2Hz, 1H), 3.97 (s, 3H), 3.53 (d, J=12.0Hz, 2H), 3.39 (s, 6H), 2.69 (t, J=11.6Hz, 2H), 1.88 (d, J=12.0Hz, 2H), 1.82-1.73 (m, 1H), 1.64-1.48 (m, 2H).
[0277] Preparation of (S)-3-(6-fluoro-1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidine-2,6-dionebenzenesulfonic acid (intermediate F)
[0278]
[0279] Step 1: Preparation of methyl 2-bromo-4,5-difluorobenzoate
[0280] Thionyl chloride (13 g, 0.11 mol) was slowly added to a mixture of 2-bromo-4,5-difluorobenzoic acid (20 g, 0.084 mol) in MeOH (60 mL) at 10 °C, and then stirred at 80 °C for 3 hours. TLC showed that the reaction was complete. The mixture was cooled to room temperature, concentrated, and then partitioned between ethyl acetate and water. The organic layer was washed twice with saturated Na₂CO₃ and brine, dried over Na₂SO₄, and concentrated to give the crude desired product (21 g, yield: 100%), which was used in the next step without further purification.
[0281] Step 2: Preparation of tert-butyl 4-(5-bromo-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate
[0282] A mixture of methyl 2-bromo-4,5-difluorobenzoate (21 g, 0.084 mol), tert-butyl piperazine-1-carboxylate (23.4 g, 0.125 mol), and K₂CO₃ (17.3 g, 0.125 mol) in N,N-dimethylacetamide (60 mL) was stirred at 80 °C for 16 hours. TLC showed the reaction was complete. The mixture was added to water (200 mL) and stirred for 10 minutes. EtOAc (200 mL) was added. The mixture was partitioned between ethyl acetate and water. The organic layer was washed with water and brine, dried over Na₂SO₄, and concentrated to give the desired product (31.6 g, yield: 90%).
[0283] Step 3: Preparation of tert-butyl 4-(5-cyano-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate
[0284] A mixture of tert-butyl 4-(5-bromo-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate (30.6 g, 0.073 mol) and CuCN (9.8 g, 0.11 mol) in DMF (120 mL) was stirred at 100 °C for 16 h. TLC showed the reaction was complete. The mixture was cooled to room temperature. Ethyl acetate (200 mL) and ammonium hydroxide (200 mL) were added and stirred for 30 min. The mixture was filtered. The organic layer was washed with water, dried over Na₂SO₄ and concentrated to give a crude product (25.4 g). The crude product was refluxed in petroleum ether (100 mL). The mixture was filtered and dried in an oven at 50 °C to give the title compound (21.5 g, yield: 81%).
[0285] Step 4: Preparation of tert-butyl 4-(2-fluoro-5-formyl-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate
[0286] 4-(5-cyano-2-fluoro-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylic acid tert-butyl ester (20 g, 55 mmol) and Raney nickel (85% in water, 10 g) were added to a solution of pyridine (39.1 g, 495 mmol), water (20 mL), and acetic acid (26.4 g, 440 mmol) at room temperature. The resulting mixture was heated to 60 °C. Sodium hypophosphite (29.2 g in 50 mL of water) was added dropwise to the mixture. The mixture was stirred at 60 °C for 16 hours. TLC showed that the reaction was incomplete. The mixture was stirred for another 10 hours. The mixture was cooled to room temperature. Ethyl acetate and water were added. The mixture was filtered. The organic layer was washed with water, 1N HCl, and brine, dried over Na₂SO₄, and concentrated under reduced pressure to give a crude product (20.8 g, crude). The residue was purified by silica gel to give the desired product (8.7 g, yield: 43%).
[0287] Step 5: Preparation of (S)-4-(2-(1-amino-5-(tert-butoxy)-1,5-dioxopentan-2-yl)-6-fluoro-1-oxoisoindoline-5-yl)piperazine-1-carboxylic acid tert-butyl ester
[0288] (S)-4,5-diamino-5-oxovalerate tert-butyl ester (5.4 g, 27 mmol) was added to a solution of 4-(2-fluoro-5-formyl-4-(methoxycarbonyl)phenyl)piperazine-1-carboxylate (8.15 g, 22 mmol) in methanol (50 mL) at room temperature. Acetic acid (1.98 g, 33 mmol) was added at 0 °C. Sodium cyanoborohydride (2.76 g, 44 mmol) was added slowly. The mixture was stirred at room temperature for 16 hours. TLC showed that the reaction was complete. The mixture was concentrated and partitioned between ethyl acetate and water. The organic layer was washed with saturated citric acid and brine, dried over Na2SO4, and concentrated under reduced pressure to give a crude product. The crude product was purified by silica gel to give the desired product (8 g, yield: 69%).
[0289] Step 6: Preparation of (S)-3-(6-fluoro-1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidine-2,6-dionebenzenesulfonic acid
[0290] To a solution of (S)-4-(2-(1-amino-5-(tert-butoxy)-1,5-dioxopentan-2-yl)-6-fluoro-1-oxoisoindoline-5-yl)piperazine-1-carboxylic acid tert-butyl ester (6.7 g, 13 mmol) in acetonitrile (67 mL), benzenesulfonic acid (4.3 g, 26 mmol) was added. The mixture was stirred at 80 °C for 16 h. LC / MS showed that the reaction was complete. The mixture was cooled to room temperature. The mixture was filtered and dried to give the desired product (5.6 g, 86%) as a grayish-white solid. 1H NMR (400MHz, DMSO-d6) δ10.99 (s, 1H), 8.73 (br s, 2H), 7.60 (m, 2H), 7.49 (d, 1H), 7.32 (m, 4H), 5.08 (dd, J=13.2 and 5.2Hz, 1H), 4.38 (dJ=17.2Hz, 1H), 4.27 (d, J=17.2Hz, 1H), 3.30 (br s, 8H), 2.91 (m, 1H), 2.67 (m, 1H), 2.50 (m, 1H), 1.98 (m, 1H); LC / MS 347.3[M+H] +
[0291] Example
[0292] Example 1: Preparation of 5-((7-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)heptyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 1)
[0293]
[0294] Step 1: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-hydroxyisoindoline-1,3-dione
[0295] Sodium acetate (4.1 g, 49.4 mmol) was added to a solution of 3-aminopiperidin-2,6-dione HCl salt (4.1 g, 24.7 mmol) in acetic acid (45 mL), and the mixture was stirred at 25 °C for 1 hour. 4-Hydroxyphthalic acid (3.0 g, 16.5 mmol) was added to the mixture, and the mixture was heated to 120 °C for 11 hours. The mixture was concentrated and then poured into water (20 mL). The suspension was filtered. The crude product was purified by column chromatography (dichloromethane:methanol = 50:1 to 10:1) to give 2-(2,6-dioxo-3-piperidinyl)-5-hydroxy-isoindoline-1,3-dione (3.9 g, 14.3 mmol, 86% yield) as a colorless solid.
[0296] Step 2: Preparation of tert-butyl 6-(piperazin-1-yl)nicotinic acid
[0297] Piperazine (17.2 g, 200 mmol) was added to a solution of tert-butyl 6-chloronicotinic acid (8.52 g, 40 mmol) in tert-butanol (100 mL), and the mixture was heated to 60 °C for 6 hours. The mixture was concentrated under vacuum, and the crude product was purified by column chromatography to give the title compound (10 g, 95%) as a colorless solid. LCMS: m / z = 264.2 [M] + .
[0298] Step 3: Preparation of 6-(4-(7-hydroxyheptyl)piperazin-1-yl)tert-butyl nicotinate
[0299] K₂CO₃ was added to a solution of 6-(piperazin-1-yl)nicotinic acid tert-butyl ester (526 mg, 2 mmol) and 7-bromohept-1-ol (468 mg, 2.4 mmol) in CH₃CN (5 mL) at room temperature, and the reaction mixture was stirred at 85 °C for 4 hours. The mixture was diluted with EtOAc and filtered through a diatomaceous earth mat. The filtrate was concentrated to give 6-(4-(7-hydroxyheptyl)piperazin-1-yl)nicotinic acid tert-butyl ester (630 mg, 83%) as a pale yellow solid. LCMS: m / z = 378.3 [M] + .
[0300] Step 4: Preparation of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)heptyl)piperazin-1-yl)tert-butyl nicotinate
[0301] 2-(2,6-dioxadiazin-3-yl)-5-hydroxyisoindoline-1,3-dione (383.6 mg, 1.4 mmol) and PPh3 (524 mg, 2.0 mmol) were added to a solution of 6-(4-(7-hydroxyheptyl)piperazin-1-yl)nicotinic acid tert-butyl ester (377 mg, 1 mmol) in anhydrous THF (3 mL) at 25 °C under nitrogen atmosphere. DIAD (404 mg, 2.0 mmol) was added to the mixture at room temperature. The resulting mixture was stirred at 45 °C for 2 hours. After cooling to room temperature, the reaction was quenched with H2O (10 mL) and extracted with EtOAc (10 mL × 2). The combined organic layers were washed with brine (20 mL × 5), dried over anhydrous sodium sulfate, and concentrated. The residue was purified by Pre-TLC to give the desired product (80 mg, 12.6%) as a white solid. LCMS: m / z = 634.3 [M+1] + .
[0302] Step 5: Preparation of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)heptyl)piperazin-1-yl)nicotinic acid
[0303] A solution of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)heptyl)piperazin-1-yl)nicotinic acid tert-butyl ester (80 mg, 0.13 mmol) in TFA / DCM (6.0 mL, 1:5) was stirred at room temperature for 3 hours. The reaction mixture was concentrated by rotary evaporation to give the title product (70 mg), which could be used in the next step without further purification. LCMS: m / z = 578.3 [M+1] + .
[0304] Step 6: Preparation of 5-((7-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)heptyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0305] HATU (57 mg, 0.1 mmol) was added to a solution of 6-(4-(7-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)heptyl)piperazin-1-yl)nicotinic acid (58 mg, 0.1 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (54 mg, 0.12 mmol), and DIEA (51.6 mg, 0.4 mmol) in DMF (3 mL) at room temperature. The reaction mixture was stirred at room temperature until LCMS showed complete reaction. The mixture was quenched with ice water and extracted with DCM (10 mL × 3). The organic layer was washed with water and brine, dried over Na2SO4, filtered, and the solvent was removed by rotary evaporation. The residue was purified by pre-TLC to give the title product (21 mg, 20.8%) as a white solid. LCMS: m / z = 1007.4 [M+H] + .
[0306] 1 HNMR (400MHz, CDCl3-d): δ9.05 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.65 (m, 2H), 7.41-7.31 (m, 5H), 7.23-7.16 (m, 2H), 7.10-7.07 (m, 3H), 6.95-6.93 (m, 1H), 6.50-6.48 (m, 1H), 4.9 6-4.95(m, 1H), 4.38(s, 1H), 4.08(s, 3H), 3.90(s, 1H), 3.58-3.44(m, 6H), 2.91-2.74(m, 3H), 2.52(m, 4H), 2.36(s, 2H), 2.19-2.01(m, 4H), 1.18-1.75(m, 5H), 1.51-1.36(m, 8H).
[0307] Example 2: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 2)
[0308]
[0309] Step 1: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-fluoroisoindoline-1,3-dione
[0310] Sodium acetate (1.98 g, 24.08 mmol) and 3-aminopiperidine-2,6-dione hydrochloride (1.98 g, 12.05 mmol) were added to a solution of 5-fluoroisobenzofuran-1,3-dione (2 g, 12.05 mmol) in acetic acid (30 mL). The mixture was stirred at 120 °C for 18 hours. The reaction mixture was concentrated under reduced pressure. The residue was poured into water (60 mL) and stirred for 10 minutes. The solid was collected by filtration, washed with water (2 × 20 mL), and dried under vacuum to give the title compound (2.8 g, 94%) as a white solid.
[0311] Step 2: Preparation of 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)tert-butyl nicotinate
[0312] 2-(2,6-dioxopiperidin-3-yl)-5-fluoroisoindoline-1,3-dione (200 mg, 0.724 mmol), 6-(piperazin-1-yl)nicotinic acid tert-butyl ester (158 mg, 0.603 mmol), and K₂CO₃ (167 mg, 1.207 mmol) were suspended in DMF in a 20 mL microwave-safe tube. The mixture was irradiated with microwave at 120 °C for 1 hour. The mixture was extracted with EtOAc (30 mL × 3) and washed with brine (20 mL × 2). The combined organic phases were dried over Na₂SO₄ and concentrated under vacuum. The residue was purified by Prep-TLC to give 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)nicotinic acid tert-butyl ester (200 mg).
[0313] Step 3: Preparation of 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)nicotinic acid
[0314] 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl) tert-butyl nicotinate (180 mg, 0.346 mol) was dissolved in 4N HCl / dioxane and the mixture was stirred at room temperature for 1 hour. After vacuum concentration, the title compound (130 mg) was obtained as a yellow solid and used in the next step as is.
[0315] Step 4: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0316] To a solution of 6-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindololin-5-yl)piperazin-1-yl)nicotinic acid (130 mg 0.281 mmol) in DMF (5 mL), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (163 mg 0.337 mmol), HATU (128 mg 0.337 mmol), and DIEA (145 mg 1.12 mmol) were added. The mixture was stirred at room temperature for 3 hours and then extracted with ethyl acetate. The combined organic phases were washed with aqueous sodium chloride solution. After vacuum concentration, the residue was purified by prep-HPLC to give the title compound (16.8 mg) as a yellow solid. LCMS:(ES + ):m / z 893.3[M+1] + .
[0317] 1 HNMR (400MHz, CDCl3): δ: 12.71 (s, 1H), 11.06 (s, 1H), 8.87 (s, 1H), 8.17 (m, 2H), 7.82 (d, J=13.6Hz, 1H), 7.77-7.10 (m, 12 H)7.05(br,1H),6,68(br,1H,5.08-5.06(m,1H),4,25(br,1H),3,79-3.51(m,14H),2.93-2.89(m,1H),2.13-21.85(m,5H)
[0318] Example 3: Preparation of 5-((6-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)hexyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 3)
[0319]
[0320] Compound 3 was prepared in step 3 by replacing 7-bromohept-1-ol with 6-bromohex-1-ol using the same method as compound 1.
[0321] LCMS: m / z = 993.4 [M] + .
[0322] 1HNMR (400MHz, CDCl3-d): δ9.04 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.65, (m, 2H), 7.41- 7.32(m, 5H), 7.22-7.18(m, 2H), 7.10-7.07(m, 3H), 6.95-6.93(m, 1H), 6.54-6.50(m, 1 H), 4.96-4.95(m, 1H), 4.37(s, 1H), 4.10-4.06(m, 4H), 3.57-3.42(m, 6H), 2.90-2.78( m, 3H), 2.49 (s, 4H), 2.35 (s, 2H), 2.18-2.15 (m, 2H), 2.00 (s, 3H), 1.83-1.51 (m, 10H).
[0323] Example 4: Preparation of 5-(3-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)propoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 4)
[0324]
[0325] Compound 4 was prepared by replacing 7-bromohept-1-ol with 3-bromoprop-1-ol in step 3, using the same procedure as described for Compound 1.
[0326] LCMS: m / z = 951.3 [M] + .
[0327] 1 HNMR (400MHz, CDCl3-d): δ8.98-8.89(m, 1H), 8.46-8.32(m, 2H), 7.81-7.68(m, 2H), 7 .41-7.39(m,3H),7.29-7.20(m,3H),7.09-7.07(m,3H),6.95-6.93,(m,1H),6.54-6.4 7(m, 1H), 4.96-4.93(m, 1H), 4.35-4.13(m, 4H), 3.74-3.73(m, 1H), 3.57(s, 3H), 3.35 -3.32 (m, 1H), 2.91-2.73 (m, 4H), 2.47 (s, 3H), 2.38-2.17, (m, 5H), 1.89-1.59 (m, 9H).
[0328] Example 5: Preparation of 5-(2-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)ethoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 5)
[0329]
[0330] Step 1: Preparation of 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinic acid tert-butyl ester
[0331] To a solution of 6-(piperazin-1-yl)nicotinic acid tert-butyl ester (800 mg, 3.04 mmol) in 20 mL of acetonitrile, 2-bromoethanol (452 mg, 3.65 mmol) and K₂CO₃ (839 mg, 6.08 mmol) were added. The mixture was stirred at 85 °C for 12 hours. The mixture was diluted with ethyl acetate and then filtered. The filtrate was concentrated to give 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinic acid tert-butyl ester (760 mg, 78.9%), which was used as is in the next step. LCMS: 308.2 [M+H] + .
[0332] Step 2: Preparation of 6-(4-(2-((2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)ethyl)piperazin-1-yl)tert-butyl nicotinate
[0333] To a solution of 6-(4-(2-hydroxyethyl)piperazin-1-yl)nicotinic acid tert-butyl ester (760 mg, 2.47 mmol) in THF (10 mL), 2-(2,6-dioxopiperidin-3-yl)-5-hydroxyisoindoline-1,3-dione (813 mg, 2.97 mmol) and PPh3 (1.01 g, 2.97 mmol) were added, followed by the addition of DIAD (748 mg, 3.70 mmol). The reaction mixture was stirred overnight at room temperature. The reaction mixture was concentrated under vacuum. The residue was dissolved in ethyl acetate and washed with an aqueous sodium chloride solution. The organic phase was concentrated to dryness, and the residue was purified by silica gel column chromatography (DCM / MeOH = 20 / 1) to give 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid tert-butyl ester (130 mg, 87.1%). LCMS: 564.3 [M+H] + .
[0334] Step 3: Preparation of 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid
[0335] A solution of tert-butyl nicotinic acid (130 mg, 0.23 mol) in DCM / TFA (3:1) was stirred at room temperature for 1 hour. After vacuum concentration, a yellow oily solution of 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)oxy)ethyl)piperidin-1-yl)nicotinic acid (120 mg) was obtained and used as is in the next step. LCMS: 508.1 [M+H] + .
[0336] Step 4: Preparation of 5-(2-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)ethoxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0337] To a solution of 6-(4-(2-((2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindololin-5-yl)oxy)ethyl)piperazin-1-yl)nicotinic acid (120 mg 0.236 mmol) in DMF (30 mL), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (137 mg 0.283 mmol), HATU (90 mg 0.283 mmol), and DIEA (121 mg 0.944 mmol) were added. The mixture was stirred at room temperature for 3 hours and then extracted with ethyl acetate. The combined organic phases were washed with aqueous sodium chloride solution. After vacuum concentration, the residue was purified by prep-HPLC to give the title compound (19 mg, 9%) as a yellow solid. LC-MS: (ES + ):m / z 940.3[M+1] + .
[0338] 1HNMR (400MHz, CDCl3): δ: 8.99 (s, 1H), 8.35 (s, 1H), 8.29 (s, 1H) 7.77 (d, J=8.4Hz, 1H), 7.65 (s, 1H) 7.49-7.39 (m, 4H), 7.30 (s, 1H), 7.29-7.10 (s, 2H) 7.07-7.07, (m, 2H), 6.95 (d, J=1.6Hz, 1H ), 6.47 (s, 1H), 5.36-5.34 (m, 1H), 4.97-4.94 (m, 1H), 4.31 (s, 2H), 4.15-4.06 (m, 1H), 3.57 (s, 6H),2.86(s,4H),2.63(s,4H),2.25-2.12,(m,2H),2.08-2.01(m,2H),1.92(s,1H),1.85(s,1H)
[0339] Example 6: Preparation of 5-((5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperazin-1-yl)pentyl)oxy)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 6)
[0340]
[0341] Compound 6 was prepared by replacing 7-bromohept-1-ol with 5-bromopent-1-ol in step 3, using the same method as described for Compound 1.
[0342] LCMS: m / z = 979.4 [M] + .
[0343] 1 HNMR (400MHz, CDCl3-d): δ9.06 (s, 1H), 8.36-8.30 (m, 2H), 7.77-7.64 (m, 2H), 7.43-7.38 (m, 3H), 7.33-7.31 (m, 2H), 7.23-7.15 (m, 2H), 7.10-7.06 (m, 3H), 6.95-6.93 (m, 1H), 6.5 1-6.48(m, 1H), 4.97-4.93(m, 1H), 4.38(s, 1H), 4.12-4.07(m, 3H), 3.56-3.47(m, 6H), 2. 90-2.73 (m, 3H), 2.49 (s, 4H), 2.36-2.35 (m, 2H), 2.19-2.01 (m, 4H), 1.88-1.50 (m, 10H).
[0344] Example 7: Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 7)
[0345]
[0346] Step 1: Preparation of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one
[0347] A mixture of 6-bromohexanoyl chloride (45 mg, 0.21 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (94 mg, 0.21 mmol), and DIEA (136 mg, 1 mmol) in DCM (5 mL) was stirred at room temperature for 1 hour. The reaction mixture was quenched by adding water (5 mL). The organic phase was collected and concentrated under vacuum to give a crude product. The crude product was purified by Prep-TLC (DCM / MeOH = 10:1) to give the desired product (150 mg, 98%) as a white solid. LC / MS: 624.5 [M+H] + .
[0348] Step 2: Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0349] A mixture of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one (150 mg, 0.20 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (90.9 mg, 0.24 mmol), K₂CO₃ (165.9 mg, 1.2 mmol), and KI (7.9 mg, 0.05 mmol) in DMF (3 mL) was stirred at 60 °C for 16 hours. The reaction mixture was filtered, and the solution was concentrated under vacuum. The residue was purified by Prep-TLC (DCM / MeOH = 10:1) to give the desired product (37 mg, 19.8%) as a white solid. LC / MS: 885.5 [M+H] + .
[0350] 1 H NMR (400MHz, DMSO) δ12.78 (br, 1H), 11.11 (s, 1H), 8.92-8.89 (m, 1H), 8.30-8.25 (m, 1H), 7.71-7.61 (m, 2H), 7.59-7 .52(m,1H),7.51-7.39(m,2H),7.37(s,1H),7.32-7.23(m,2H),7.22-7.,12(m,3H),7.07-6.96(m,1H),5.09(dd,J=1 2.9, 5.3Hz, 1H), 4.31-4.13(m, 1H), 3.89-3.71(m, 1H), 3.67–3.37(m, 6H), 2.96-2.81(m, 1H), 2.70-2.54(m, 2H), 2. 49-2.17 (m, 5H), 2.03 (d, J=4.9Hz, 2H), 1.95-1.67 (m, 3H), 1.65-1.41 (m, 4H), 1.39-1.02 (m, 5H), 1.00-0.70 (m, 1H).
[0351] Example 8: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 8)
[0352]
[0353] Step 1: Preparation of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one
[0354] To a solution of 7-bromoheptanoyl chloride (60 mg, 0.26 mmol) in DCM (5 mL), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (145.8 mg, 0.26 mmol) and N,N-diisopropylethylamine (335.4 mg, 2.6 mmol) were added. The reaction mixture was stirred overnight at room temperature. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound as a white oil. LC / MS: 639.6 [M+H] + .
[0355] Step 2: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0356] N,N-diisopropylethylamine (27.09 mg, 0.21 mmol) and KI (1.2 mg, 0.007 mmol) were added to a solution of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one (45 mg, 0.07 mmol) and 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (23 mg, 0.06 mmol) in acetonitrile. The reaction mixture was stirred overnight at room temperature. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (32 mg, 50.8%). LC / MS: 899.3 [M+H] + .
[0357] 1H NMR (400MHz, DMSO) δ12.81 (br, 1H), 11.10 (s, 1H), 8.95-8.85 (m, 1H), 8.32-8.25 (m, 1H), 7.70-7.61(m, 2H), 7.59-7.53(m, 1H), 7.51-7.49(m, 2H), 7.40-7.25(m, 3H), 7.24-7.15(m , 3H), 7.12-7.03(m, 1H), 5.14-5.07(m, 1H), 4.27-4.16(m, 1H), 3.82-3.74(m, 1H), 3.62- 3.41(m, 4H), 3.29-3.27(m, 2H), 2.95-2.85(m, 1H), 2.70-2.62(m, 2H), 2.45-2.12(m, 5H),
[0358] 2.08-1.98 (m, 2H), 1.90-1.70 (m, 3H), 1.65-1.40 (m, 4H), 1.31-1.10 (m, 7H), 0.95-0.82 (m, 1H).
[0359] Example 9: 5-(4-((5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 9)
[0360]
[0361] Step 1: Preparation of tert-butyl 6-methylnicotinic acid
[0362] DMAP (520 mg, 3.79 mmol) and Boc₂O (12.37 g, 56.9 mmol) were added to a solution of 6-methylnicotinic acid (5.2 g, 37.9 mmol) in toluene (150 mL). The mixture was stirred at 110 °C for 12 h. After cooling to room temperature, the mixture was diluted with ethyl acetate and extracted with aqueous sodium chloride solution. The combined organic phases were concentrated under vacuum and the residue was purified by silica gel column chromatography (eluting with 3% EtOAc in petroleum ether) to give the title product (5.09 g, 69%). LCMS: m / z 194.2 [M+1] + .
[0363] Step 2: Preparation of tert-butyl 6-(bromomethyl)nicotinic acid
[0364] NBS (440 mg, 2.48 mmol) and AIBN (59 mg, 0.3 mmol) were added to a solution of 6-methylnicotinic acid tert-butyl ester (590 mg, 3.05 mmol) in carbon tetrachloride (10 mL). The mixture was stirred at 70 °C for 12 hours and then diluted with ethyl acetate. After extraction with aqueous sodium chloride solution, the combined organic phases were concentrated under vacuum. The residue was purified by silica gel column chromatography (eluting with 3% EtOAc in petroleum ether) to give the title product (320 mg, 38.5%).
[0365] Step 3: Preparation of 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)tert-butyl nicotinate
[0366] DIEA (770 mg 5.96 mmol) was added to a solution of 2-(2,6-dioxadiazin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (520 mg, 1.52 mmol) in CH3CN (10 mL), and the mixture was stirred at room temperature for 20 min. 6-(bromomethyl)nicotinic acid tert-butyl ester (316 mg, 1.16 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 12 h. The reaction was quenched with water and extracted with EtOAc (100 mL × 3). The combined organic phases were washed with brine and dried over Na2SO4. After filtration, the organic solvent was removed under vacuum. The residue was purified by column chromatography (DCM / MeOH = 50 / 1) to give 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)nicotinic acid tert-butyl ester (480 mg, 59%). LCMS: m / z 534.3 [M+1] + .
[0367] Step 4: Preparation of 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)nicotinic acid
[0368] 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)nicotinic acid tert-butyl ester (480 mg, 0.9 mmol) was dissolved in 4N HCl / dioxane (30 mL) and stirred at room temperature for 5 hours. The mixture was concentrated under vacuum to give the title product (470 mg), which was used in the next step without further purification. LCMS:(ES + ):m / z478.2[M+1] + .
[0369] Step 5: Preparation of 5-(4-((5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0370] To a solution of 6-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)nicotinic acid (220 mg, 0.46 mmol) in DMF (5 mL), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (240 mg, 536 mmol), HOBT (120 mg, 0.88 mmol), EDCI (170 mg, 0.89 mmol), and DIEA (350 mg, 2.713 mmol) were added. The mixture was stirred at room temperature for 12 hours. The mixture was diluted with water and extracted with EtOAc (100 mL × 3). The combined organic phases were washed with brine and dried over Na2SO4. After filtration, the solvent was removed by rotary evaporation, and the residue was purified by prep-HPLC to give the title product (27 mg, 6%) as a yellow solid. LCMS: m / z 454.2 [M+1] + .
[0371] 1 HNMR (400MHz, CDCl3): δ: 8.91 (s, 1H), 8.34 (s, 1H) 8.68 (d, J = 8.4Hz, 1H) 8.20 (d, J = 8Hz, 1 H)7.85-7.61(m,2H)7.45-7.35(m,5H)7.31(s,2H)7.29-7.11(m,2H)7.10(s,1H)7.09-7.0 1(m, 3H) 6.96 (d, J = 8.0Hz, 1H) 5.98-5.91 (m, 1H) 4.21 (s, 1H) 4.11 (s, 1H) 4.12-3.89 (m, 1H) 3.72(s,3H)3.35(s,6H)2.92-2.71(m,4H)2.55(s,3H)2.27-2.15(m,1H)2.14-2.09(m,3H)
[0372] Example 10: Preparation of 5-(4-((1-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 10)
[0373]
[0374] Step 1: Preparation of tert-butyl 4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-carboxylic acid
[0375] To a solution of 2-(2,6-dioxadiazin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (540 mg, 1.578 mmol) in DCM (20 mL), tert-butyl 4-formylpiperidin-1-carboxylate (350 mg, 1.643 mmol) and sodium triacetoxyborohydride (990 mg, 4.691 mmol) were added. The mixture was stirred overnight at room temperature. The reaction mixture was extracted with ethyl acetate (40 mL × 4) and washed with aqueous sodium chloride solution. The organic phase was concentrated under vacuum and the residue was purified by column chromatography with DCM / MeOH 100:1 to 50:1 to give the title compound (469 mg, 55.1%). LCMS: (ES + ):m / z440[M+1-Boc) + .
[0376] Step 2: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindoline-1,3-dione
[0377] 4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-carboxylic acid tert-butyl ester (400 mg, 0.74 mmol) was dissolved in HCl / dioxane (10 mL) and the mixture was stirred at room temperature for 1.5 hours. The solid was collected by filtration to give the title compound (450 mg), which is an HCl salt. LCMS: 440.2 [M+H] + .
[0378] Step 3: Preparation of 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)tert-butyl nicotinate
[0379] To a solution of 2-(2,6-dioxadiazin-3-yl)-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindoline-1,3-dione (350 mg, 0.797 mmol) in DMSO (20 mL), tert-butyl 6-chloronicotinate (169 mg, 0.793 mmol), L-proline (70 mg, 10%), K₂CO₃ (220 mg, 1.59 mmol), and CuI (35 mg, 10%) were added. The mixture was stirred at 90 °C for 12 hours. The mixture was extracted with EtOAc (50 mL × 4) and the organic phase was washed with aqueous sodium chloride solution (40 mL × 3). The organic phase was concentrated under vacuum, and the residue was purified by column chromatography (DCM / MeOH 20:1) to give the title compound (280 mg, 71.4%) as a yellow oil. LCMS:(ES + ):m / z 617.3[M+H] + .
[0380] Step 4: Preparation of 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinic acid
[0381] 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)tert-butyl nicotinate (280 mg, 0.133 mmol) was dissolved in DCM (6 mL) and TFA (2 mL). The mixture was stirred at room temperature for 2 hours. After evaporating the solvent under vacuum, the residue was dissolved in DCE and then concentrated under vacuum to dryness. The residue was azeotropically treated with DCE three times to give the title compound (340 mg) as a pale yellow oil. LCMS:(ES + ):m / z 562.2[M+1] + .
[0382] Step 5: Preparation of 5-(4-((1-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)pyridin-2-yl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0383] To a solution of 6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)nicotinic acid (110 mg, 0.196 mmol) in DMF (20 mL), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (70 mg, 0.156 mmol) and DIEA (300 mg, 2.34 mmol) were added, followed by the addition of HATU (89 mg, 0.234 mmol) at room temperature. The mixture was stirred at room temperature for 2 hours. After extraction with EtOAc (30 mL × 4) and washing with brine (20 mL × 3), the organic phase was concentrated under vacuum. The residue was purified by prep-HPLC to give the title product (18.8 mg) as a yellow solid. LCMS:(ES + ):m / z 992.3[M+1] + ,
[0384] 1 HNMR (400MHz, CDCl3): δ: 10.20 (s, 1H), 8.34 (s, 1H), 8.18 (s, 1H), 8.06, (s, 1H), 7 .77(d,J=8.4Hz,1H),7.22-7.12(m,5H),7.11-6.19(m,2H),5.35-5.33,(m,1H),4 .97-4.93(m, 1H), 4.51-4.21(m, 3H), 3.91-3.85(m, 3H), 3.76(s, 5H), 3.41-3.03( m, 8H), 2.91-2.71 (m, 4H), 1.71-1.59 (m, 1H), 1.54 (d, J=6.8Hz, 4H), 1.45 (s, 2H).
[0385] Example 11: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 11)
[0386]
[0387] Step 1: Preparation of tert-butyl 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)valerate
[0388] To a solution of tert-butyl 5-bromopentanoate (47 mg, 0.2 mmol) in ACN (10 mL), 2-(2,6-dioxadiidine-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (75.7 mg, 0.2 mmol) and N,N-diisopropylethylamine (38.7 mg, 0.3 mmol) were added. The reaction mixture was stirred overnight at 60 °C. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (60 mg, 60.1%) as a yellow solid. LC / MS: 498.8 [M+H] + .
[0389] Step 2: Preparation of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)valeric acid
[0390] TFA (2 mL) was added to a solution of tert-butyl 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)valerate (40 mg, 0.08 mmol) in 10 mL of DCM. The reaction mixture was stirred at room temperature for 4 hours. The solution was concentrated under vacuum to give a crude product (35 mg, yield: 100%) as a yellow solid. LC / MS: 442.7 [M+H] + .
[0391] Step 3: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0392] HATU (36.48 mg, 0.096 mmol) and DIEA (15.48 mg, 0.12 mmol) were added to a solution of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)valeric acid (35 mg, 0.08 mmol) and (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (44.88 mg, 0.08 mmol) in DMF (10 mL) under nitrogen and stirred at room temperature. The reaction mixture was stirred overnight at room temperature. The solvent was removed under vacuum to give the crude product. The crude product was purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (40 mg, 57.4%). LC / MS: 871.3 [M+H] + .
[0393] 1 H NMR (400MHz, DMSO) δ12.84 (br, 1H), 11.12 (s, 1H), 9.57-9.51 (m, 1H), 8.96-8.90 (m, 1H), 8.38-8.35 (m, 1H), 7.77 (d, J=8.5 Hz, 1H), 7.68 (d, J=9.7Hz, 1H), 7.57 (dd, J=8.5, 3.0Hz, 1H), 7.51-7.46 (m, 2H), 7.38-7.15 (m, 5H), 7.08-7.01 (m, 1H), 5.14 -5.06(m, 1H), 4.26-4.16(m, 3H), 3.99-3.85(m, 2H), 3.56-3.52(m, 2H), 3.27-3.03(m, 5H), 2.94-2.84(m, 1H), 2.69-2.54( m, 3H), 2.45-2.41 (m, 1H), 2.37-2.31 (m, 1H), 2.10-1.99 (m, 2H), 1.80-1.50 (m, 6H), 1.30-1.23 (m, 2H), 0.90-0.80 (m, 1H).
[0394] Example 12: Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 12)
[0395]
[0396] Step 1: Preparation of 7-bromoheptan
[0397] IBX (1.8 g, 6.62 mmol) was added to a solution of 7-bromoheptane-1-ol (1 g, 5.52 mmol) in DMSO (30 mL), and the mixture was stirred at room temperature for 12 hours. The mixture was diluted with water (30 mL) and filtered. The filtrate was extracted with EtOAc. The combined organic phases were washed with an aqueous solution of sodium bicarbonate and brine. After drying with Na2SO4, the solvent was concentrated under vacuum to give 7-bromoheptane (780 mg, 4.062 mmol) as a yellow oil.
[0398] Step 2: Preparation of 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0399] 7-Bromoheptanal (161 mg, 0.83 mmol) was added to a solution of 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (260 mg, 0.76 mmol) in DCM (20 mL) at 0 °C, and the mixture was stirred for 30 min. Then, Na(OAc)3BH (483 mg, 2.28 mmol) was added. After stirring at room temperature for 12 hours, the mixture was extracted with ethyl acetate and washed with sodium chloride solution. The combined organic phases were dried over Na2SO4 and concentrated under vacuum to give 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (410 mg, 89%) as a yellow solid. LCMS: m / z 519 [M+1] + .
[0400] Step 3: Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0401] Add (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (472 mg 0.97 mmol) and DIEA (483 mg 3.75 mmol) to a solution of 5-(4-(7-bromoheptyl)piperazin-1-yl)-2-(2,6-dioxadiazin-3-yl)isoindoline-1,3-dione (410 mg, 0.75 mmol) in DMSO (10 mL) to a solution of DMSO (410 mg, 0.75 mmol). Stir the mixture at 70 °C for 12 hours and filter. Extract the filtrate with ethyl acetate and wash with brine. Dry the organic phase over Na₂SO₄ and concentrate under vacuum. Purify the residue by prep-HPLC to give the desired product (42.8 mg, 6%) as a yellow solid. LCMS: m / z 443 [M+1] 2+ .
[0402] 1 HNMR (400MHz, DMSO): δ: 12.85 (s, 1H), 11.09 (s, 1H), 8.81 (d, J=7.2Hz, 1H)
[0403] 8.29 (s, 1H), 7.77 (d, J = 8.4Hz, 1H) 7.68 (s, 1H), 7.58 (d, J = 8.4Hz, 1H), 7.53-7.45 (m, 3H), 7.39 ( s, 1H), 7.29-7.21 (m, 1H) 7.18 (d, J=8.8Hz, 3H), 7.05 (d, J=2.4Hz, 1H), 5.12-5.10 (m, 2H), 4.32( s, 1H), 4.22 (s, 2H), 3.59-3.48 (m, 4H), 3.21-3.09 (m, 8H), 2.95-2.81 (m, 1H), 2.69-2.52 (m, 2H) , 2.36 (d, J=14.0Hz, 1H), 2.15 (s, 2H), 2.05-2.01 (m, 1H), 2.71 (s, 4H), 1.34 (s, 6H), 1.23 (s, 2H)
[0404] Example 13: (S)-3-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 13)
[0405]
[0406] Step 1: Preparation of 6-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one
[0407] 6-Bromohexanoyl chloride (43 mg, 0.2 mmol) and DIEA (130 mg, 1.0 mmol) were added to a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (90 mg, 0.2 mmol) stirred under argon in DCM (5 mL). The reaction mixture was stirred at room temperature for 16 hours. The mixture was concentrated under vacuum and purified by Prep-TLC (DCM / MeOH = 10:1) to give the title compound (120 mg, 96%) as a white solid. LC / MS: 623.6 [M+H] + .
[0408] Step 2: Preparation of (S)-3-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0409] To a solution of 6-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one (110 mg, 0.18 mmol) in ACN (2 mL) under argon atmosphere at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione (88 mg, 0.18 mmol), DIEA (116 mg, 0.9 mmol), and potassium iodide (6.0 mg, 0.04 mmol) were added. The reaction mixture was stirred at 25 °C for 16 h. The crude product was concentrated under vacuum and purified by Prep-TLC (DCM / MeOH = 10:1) to give the title compound (13 mg, 8.3%). LC / MS: 872.5 [M+H] + .
[0410] 1 H NMR (400MHz, DMSO) δ12.80 (s, 1H), 10.97 (s, 1H), 10.49 (br, 1H), 8.84 (d, J = 7.4Hz, 1H), 8.27 (s, 1H), 7.65 (s, 1H), 7.59 (d, J = 8.5Hz, 2H), 7.49 (t , J=7.9Hz, 2H), 7.26(t, J=7.4Hz, 1H), 7.22-7.19(m, 2H), 7.18-7.15(m, 1H), 7.07-7.00 (m, 1H), 5.07 (dd, J=13.2, 5.0Hz, 1H), 4.42-4.30 (m, 2H) , 4.27–4.13(m, 2H), 4.05-3.96(m, 1H), 3.90-3.82(m, 1H), 3.62-3.54(m , 1H), 3.30-3.20 (m, 2H), 3.19-2.97 (m, 4H), 2.95-2.86 (m, 1H), 2.69-2. 56 (m, 1H), 2.47-2.31 (m, 4H), 2.13-2.01 (m, 2H), 2.00-1.92 (m, 1H), 1.8 2-1.65 (m, 2H), 1.64-1.45 (m, 4H), 1.43-1.32 (m, 3H), 1.30-1.17 (m, 3H).
[0411] Example 14: (S)-3-(5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 14)
[0412]
[0413] Step 1: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)tert-butyl valerate
[0414] To a solution of tert-butyl 5-bromopentanoate (50 mg, 0.21 mmol) stirred at room temperature in MeCN (5 mL), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (103 mg, 0.21 mmol), KI (35 mg, 0.21 mmol), and DIEA (109 mg, 0.84 mmol) were added. The reaction mixture was stirred at 60 °C for 12 hours. The mixture was cooled to room temperature, poured into water (45 mL), and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (MeOH / DCM = 1:10) to give the desired product (100 mg, yield = 98.4%) as a yellow solid. LC / MS: 484.9 [M+H] + .
[0415] Step 2: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeric acid
[0416] A solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)tert-butyl valerate (100 mg, 0.20 mmol) in TFA / DCM (1:5, 12 mL) was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum to give the crude product (100 mg, crude). LC / MS: 428.8 [M+H] + .
[0417] Step 3: Preparation of (S)-3-(5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0418] HATU (94 mg, 0.25 mmol), DIEA (107 mg, 0.828 mmol), and (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (116 mg, 0.187 mmol) were added to a solution of (S)-5-(4-(2-(2,6-dioxadiazin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valerate (100 mg, 0.20 mmol) in DMF (5 mL) at room temperature. The reaction mixture was stirred at room temperature for 2 hours. The mixture was poured into water (45 mL) and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH / DCM = 1:10) to obtain the desired product (25 mg, yield = 14.5%, two steps). LC / MS: 857.6 [M+H] + .
[0419] 1 H NMR (400MHz, DMSO) δ12.83 (br, 1H), 10.97 (s, 1H), 8.95-8.85 (m, 1H), 8.37-8.25 (m, 1H), 7.71-7.63 (m, 1H), 7.60-7.53 (m, 3H), 7.48 ( t, J=7.6, Hz, 2H), 7.25 (t, J=7.6Hz, 1H), 7.24-7.16 (m, 3H), 7.15-7.06 (m, 2H), 7.04 (dd, J=8.4, 2.4Hz, 1H), 5.09-5.04 (m, 1H), 4.40- 4.30 (m, 1H), 4.28-4.15 (m, 2H), 3.95-3.75 (m, 1H), 3.65-3.41 (m, 5H), 3.22-3.10 (m, 2H), 2.98-2.85 (m, 2H), 2.60-2.52 (m, 2H), 2.47 -2.28 (m, 3H), 2.28-2.15 (m, 1H), 2.09-1.94 (m, 2H), 1.88-1.70 (m, 2H), 1.65-1.40 (m, 4H), 1.31 (t, J=7.2Hz, 2H), 1.26-1.21 (m, 1H).
[0420] Example 15: 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 15)
[0421]
[0422] Step 1: Preparation of (R)-(2-chloro-4-phenoxyphenyl)(4-((1-(6,6-dimethoxyhexyl)piperidin-3-yl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone
[0423] A suspension of 6-bromo-1,1-dimethoxyhexane (21 mg, 0.09 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (50 mg, 0.09 mmol), KI (15 mg, 0.09 mmol), and DIEA (24 mg, 0.18 mmol) in DMF (2 mL) was stirred at 25 °C for 16 hours. The solvent was removed under vacuum. The residue was purified by chromatography, eluting with DCM / MeOH = 20:1, to give the product (50 mg, 94%) as a yellow solid. LC / MS: 592.3 [M+H] + .
[0424] Step 2: Preparation of (R)-6-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexanal
[0425] TsOH (14 mg, 0.08 mmol) and HOAc (14 mg, 0.08 mmol) were added to a solution of (R)-(2-chloro-4-phenoxyphenyl)(4-((1-(6,6-dimethoxypentyl)piperidin-3-yl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) ketone (50 mg, 0.08 mmol) in ACN (2 mL). The reaction mixture was stirred at 25 °C for 5 hours. The mixture was concentrated under vacuum. The residue was dissolved in EtOAc (10 mL) and washed with saturated NaHCO3 solution. The organic phase was dried over Na2SO4 and concentrated under vacuum to give the title product (35 mg, 80%) as a yellow solid. LC / MS: 546.2 [M+H] + .
[0426] Step 3: Preparation of 5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0427] A solution of (R)-6-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexanal (35 mg, 0.07 mmol), Et3N (14 mg, 0.14 mmol), and 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (27 mg, 0.07 mmol) in DCM (5 mL) was stirred at 25 °C for 10 min. The mixture was cooled to 0 °C and NaBH(OAc)3 (22 mg, 0.11 mmol) was added in portions. The mixture was stirred at 25 °C for 16 h. The solvent was removed under vacuum, and the residue was purified by chromatography by elution with DCM / MeOH = 20:1 to give the title product (15 mg, 24%) as a yellow solid. LC / MS: 872.3 [M+H] + .
[0428] 1 H NMR (400MHz, DMSO) δ12.79 (br, 1H), 10.97 (s, 1H), 10.60 (br, 1H), 8.83 (d, J = 7.5Hz, 1H), 8.27 (s, 1H), 7.64 (s, 1 H), 7.60-7.46 (m, 3H), 7.26 (t, J, = 7.4Hz, 1H), 7.23-7.06 (m, 4H), 7.04-7.01 (m, 1H), 5.09-5.04 (m, 1H), 4.42,-4 .13(m, 4H), 4.09-3.93(m, 1H), 3.92-3.78(m, 1H), 3.72-3.41(m, 2H), 3.29,-3.17(m, 3H), 3.14-2.85(m, 4H), 2.7 7-2.52(m, 4H), 2.42-2.30(m, 3H), 2.13,-1.60(m, 3H), 1.77-1.65(m, 1H), 1.58-1.45(m, 3H), 1.41-1.19(m, 5H).
[0429] Example 16: Preparation of (S)-3-(5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 16)
[0430]
[0431] Step 1: Preparation of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one
[0432] 6-Bromohexanoyl chloride (42.8 mg, 0.20 mmol) was added to a mixture of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (113 mg, 0.20 mmol) and DIEA (77.8 mg, 0.60 mmol) in DCM (10 mL) at 0 °C. The mixture was stirred at room temperature for 5 hours. The mixture was concentrated under vacuum. The crude product was purified by silica gel chromatography with 4–8% MeOH / DCM to give the desired compound (80 mg, 64%). LC / MS: 623.5 [M+H] + .
[0433] Step 2: Preparation of (S)-3-(5-(4-(6-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-1-oxoisoindololin-2-yl)piperidin-2,6-dione
[0434] A mixture of (R)-6-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hex-1-one (50 mg, 0.08 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione (38.8 mg, 0.08 mmol), DIEA (20 mg, 0.16 mmol), and NaI (1.2 mg, 0.008 mmol) in ACN (9 mL) was stirred at 90 °C for 18 hours under N2 atmosphere. The mixture was concentrated under vacuum. The residue was purified by silica gel chromatography with 5–10% MeOH / DCM to give the desired compound (38 mg, 70%). LC / MS: 871.4 [M+H] + .
[0435] 1 H NMR (400MHz, DMSO) δ12.75 (br, 1H), 10.96 (s, 1H), 8.91 (d, J=6.8, Hz, 1H), 8.30-8.26 (m, 1H), 7.68-7.59 (m, 1H), 7.56-7.46 (m, 4H), 7.32- 7.24(m, 1H), 7.21-7.13(m, 3H), 7.10-7.02(m, 3H), 5.08-5.03(m, 1H) ,4.37-4.29(m,1H),4.25-4.16(m,2H),3.82-3.70(m,1H),3.65-3.39 (m, 3H), 3.28-3.15 (m, 2H), 2.95-2.83 (m, 2H), 2.72-2.65 (m, 1H), 2.63-2.59 (m, 1H), 2.57-2.55 (m, 1H), 2.49-2.40 (m, 2H), 2.37-2.31 (m, 1H), 2.28-2.15(m, 2H), 2.03-1.95(m, 2H), 1.81-1.71(m, 2H), 1.63-1 .32(m, 4H), 1.30-1.18(m, 3H), 1.15-1.08(s, 2H), 0.90-0.84(m, 1H).
[0436] Example 17: 3-(5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 17)
[0437]
[0438] Step 1: Preparation of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one
[0439] 7-Bromoheptanoyl chloride (45.7 mg, 0.20 mmol) was added to a mixture of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (113 mg, 0.20 mmol) and DIEA (77.8 mg, 0.60 mmol) in DCM (10 mL) at 0 °C. The mixture was stirred at room temperature for 5 hours. The mixture was concentrated under vacuum. The crude product was purified by silica gel chromatography with 4–8% MeOH / DCM to give the desired compound (80 mg, 63%). LC / MS: 637.4 [M+H] + .
[0440] Step 2: Preparation of 3-(5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0441] A mixture of (R)-7-bromo-1-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one (50 mg, 0.08 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione (38.8 mg, 0.08 mmol), DIEA (20 mg, 0.16 mmol), and NaI (1.2 mg, 0.008 mmol) in ACN (9 mL) was stirred at 90 °C under N2 atmosphere for 18 hours. The mixture was concentrated under vacuum. The residue was purified by silica gel chromatography with 5–10% MeOH / DCM to give the desired compound (22 mg, 98% purity, 30% yield). Chiral chromatographic analysis indicated partial racemization. LC / MS: 885.5 [M+H] + .
[0442] 1H NMR (400MHz, DMSO) δ12.75 (br, 1H), 10.96 (s, 1H), 8.92-8.86 (m, 1H), 8.32-8.25 (m, 1H), 7.72-7.60 (m, 1H), 7.57-7.46 (m, 4H), 7.3 2-7.20 (m, 1H), 7.21-7.15 (m, 3H), 7.08-7.02 (m, 3H), 5.06 (dd, J=13.3, 5.1Hz, 1H), 4.37-4.30 (m, 1H), 4.28-4.15 (m, 2H), 3.77 (d, J =13.2Hz, 1H), 3.61-3.45(m, 3H), 3.29-3.21(m, 2H), 3.02-2.79(m, 2H), 2.69-2.55(m, 2H), 2.40-2.29(m, 3H), 2.25-2.12(m, 2H), 2. 07-1.91 (m, 3H), 1.88-1.73 (m, 2H), 1.63-1.55 (m, 1H), 1.50-1.32 (m, 4H), 1.28-1.23 (m, 3H), 1.17-1.08 (m, 3H), 0.89-0.78 (m, 1H).
[0443] Example 18: Preparation of 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 18)
[0444]
[0445] Compound 18 was prepared using a procedure similar to that described for compound 12. LCMS: m / z 436.8 [M+1] 2+ .
[0446] 1HNMR (400MHz, DMSO): δ: 12.91 (s, 1H), 11.12 (s, 1H), 8.81 (d, J=6.8Hz, 1H), 8.31 (s, 1H), 7.77 (d, J=8. 8Hz, 1H) 7.72 (s, 1H), 7.61 (s, 1H), 7.51-7.48 (m, 3H), 7.31 (s, 1H), 7.15 (s, 1H), 7.13 (s, 3H), 7.05 (d, J=2Hz, 1H), 5.19-5.15 (m, 1H), 4.35 (s, 1H), 4.21 (s, 2H), 3.61 (s, 6H), 3.19 (s, 7H), 2.91-2.87 (m, 1H) ,2.71-2.69,(m,1H),2.50(d,J=1.6Hz,2H),2.12-2.08(m,2H),1.71(s,4H),1.35(s,4H),1.22(s,3H)
[0447] Example 19: 5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 19)
[0448]
[0449] Compound 19 was prepared using a procedure similar to that described for compound 14.
[0450] LC / MS: 857.5 [M+H] + .
[0451] 1 H NMR (400MHz, DMSO) δ12.81 (br, 1H), 11.10 (s, 1H), 8.92-8.83 (m, 1H), 8.32-8.19 (m, 1H), 7.84-7.55(m, 3H), 7.54-7.40(m, 2H), 7.39-6.97(m, 6H), 5.17-5.02(m, 1H), 4.3 7-4.05 (m, 2H), 3.97-3.75 (m, 1H), 3.72-3.33 (m, 6H), 3.27-2.81 (m, 4H), 2.73-2.54 (m, 2H), 2.47-2.09 (m, 5H), 2.06-1.97 (m, 2H), 1.93-1.45 (m, 5H), 1.35-1.15 (m, 1H).
[0452] Example 20: (S)-3-(5-(4-(4-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 20)
[0453]
[0454] Compound 20 was prepared using a procedure similar to that described for compound 14.
[0455] LC / MS: 843.6 [M+H] + .
[0456] 1 H NMR (400MHz, DMSO) δ12.90-12.75 (m, 1H), 10.97 (s, 1H), 10.47, (br, 1H), 8.93-8.81 (m, 1H), 8.35-8. 24(m,1H),7.73-7.43(m,5H),7.29-7.08,(m,5H),7.07-7.00(m,1H),5.13-5.03(m,1H),4.42-4.15( m, 3H), 4.03-3.85, (m, 2H), 3.78-3.38 (m, 5H), 3.29-3.01 (m, 5H), 2.96-2.86 (m, 1H), 2.64-2.56, (m, 1H), 2.47-2.32(m, 3H), 2.06-1.91(m, 3H), 1.83-1.46(m, 4H), 1.28-1.18, (m, 1H), 0.96-0.75(m, 1H).
[0457] Example 21: Preparation of (S)-3-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 21)
[0458]
[0459] Step 1: Preparation of (S)-3-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0460] To a solution of 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one (80 mg, 0.13 mmol) in DMF (5 mL) under argon atmosphere, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione (63 mg, 0.13 mmol), DIEA (50 mg, 0.39 mmol), and potassium iodide (20 mg, 0.13 mmol) were added to the solution. The reaction mixture was stirred at 70 °C for 15 hours. The crude product was concentrated under vacuum and purified by Prep-TLC (DCM / MeOH = 10:1) to give the title compound (30 mg, 26.0%). LC / MS: 886.3, [M+H] + .
[0461] 1 H NMR (400MHz, DMSO) δ12.79 (s, 1H), 10.97 (s, 1H), 10.25 (br, 1H), 8.83 (d, J=7.3Hz, 1H), 8.27 (s, 1H), 7.64 (s, 1H), 7.60-7.46 (m, 3H), 7.26 (t, J, = 7.4Hz, 1H), 7.22-7.01 (m, 5H), 5.06 (dd, J = 13.4, 5.1Hz, 1H), 4.38-4.15 (m, 4H), 4. 08-3.92(m, 1H), 3.90-3.77(m, 1H), 3.75-3.50(m, 2H), 3.45-3.35(m, 1H), 3.32-3.18(m, 3H), 3.14-2.85(m, 4H), 2 .75-2.53(m, 5H), 2.42-2.31(m, 3H), 2.15-1.95(m, 3H), 1.77-1.62(m, 1H), 1.57-1.47(m, 3H), 1.45-1.27(m, 5H).
[0462] Example 22: Preparation of 5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 22)
[0463]
[0464] Compound 22 was prepared using a procedure similar to that described for compound 13.
[0465] LC / MS: 901.2 [M+H] + .
[0466] 1 H NMR (400MHz, DMSO) δ = 12.87 (br, 1H), 11.10 (s, 1H), 8.83 (d, J = 7.4, 1H), 8.26 (s, 1H), 7.78-7.67 (m, 1H), 7.65-7.56 ( m, 2H), 7.50-7.45 (m, 2H), 7.35-7.23 (m, 2H), 7.22-7.14 (m, 3H), 7.06-7.01 (m, 1H), 5.15-5.05 (m, 1H), 4.38-4.30 (m, 1H), 4.28-4.12(m, 2H), 3.89-3.80(m, 1H), 3.65-3.40(m, 3H), 3.29-3.23(m, 2H), 3.17-2.82(m, 5H), 2.65-2.54(m, 2H) ), 2.39-2.32(m, 2H), 2.12-1.99(m, 3H), 1.80-1.68(m, 1H), 1.60-1.44(m, 4H), 1.40-1.20(m, 7H), 0.94-0.73(m, 1H).
[0467] Example 23: Preparation of 5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 23)
[0468]
[0469] Compound 23 was prepared using a procedure similar to that described for compound 11.
[0470] LC / MS: 857.3 [M+H] + .
[0471] 1H NMR (400MHz, DMSO) δ12.79 (br, 1H), 11.10 (s, 1H), 8.84 (d, J=7.2, Hz, 1H), 8.27 (s, 1H), 7.72 (brs, 1H), 7.64 (s, 1H), 7.58 ( d, J=8.5Hz, 1H), 7.49, (t, J=7.9Hz, 2H), 7.46-7.35 (m, 1H), 7.34-7.23 (m, 2H), 7.23-7.15 (m, 3H), 7.08-7.00 (m, 1H), 5.14 -5.03(m, 1H), 4.40-4.31(m, 1H), 4.28-4.07(m, 2H), 3.93-3.81(m, 1H), 3.70-3.39(m, 3H), 3.10-2.85(m, 3H), 2.71-2.56( m, 2H), 2.36-2.32 (m, 1H), 2.14-1.97 (m, 4H), 1.94-1.75 (m, 2H), 1.68-1.48 (m, 2H), 1.48-1.15 (m, 4H), 1.06-0.74 (m, 2H).
[0472] Example 24: Preparation of (S)-3-(5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-4-oxobutyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 24)
[0473]
[0474] Compound 24 was prepared using a procedure similar to that described for compound 14.
[0475] LC / MS: 843.4 [M+H] + .
[0476] 1H NMR (400MHz, DMSO) δ12.81 (br, 1H), 10.96 (s, 1H), 8.84 (d, J=7.3Hz, 1H), 8.73 (s, 0.5H), 8.51 (d, J=8.4Hz, 0.5H), 8.27 (s, 1H), 7.64 (s, 1H), 7.59 (d, J=8.5Hz, 1H), 7.54 (d, J=8.4Hz, 1H), 7.50-7.46 (m, 2H), 7.26 (t, J=7.4Hz, 1H), 7.23-7.15 (m, 3H), 7.14-7.06 (m, 2H), 7.03 (dd, J=8.5 , 2.3Hz, 1H), 5.10-5.05(m, 1H), 4.39-4.30(m, 2H), 4.25-4.17(m, 2H) , 3.89-3.82(m, 1H), 3.50-3.32(m, 4H), 3.06-3.00(m, 1H), 2.94-2.88( m, 3H), 2.76-2.66 (m, 2H), 2.62-2.56 (m, 1H), 2.47-2.33 (m, 3H), 2.18- 1.92(m, 4H), 1.89-1.80(m, 2H), 1.59-1.52(m, 1H), 1.47-1.34(m, 2H).
[0477] Example 25: Preparation of (S)-3-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 25)
[0478]
[0479] Step 1: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)tert-butyl valerate
[0480] KI (14.00 mg, 0.084 mmol) was added to a solution of tert-butyl 5-bromopentanoate (200 mg, 0.84 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (410.37 mg, 0.84 mmol), and DIEA (326.87 mg, 2.53 mmol) in MeCN (20 mL) at room temperature. The reaction mixture was stirred at 60 °C for 12 hours. The reaction mixture was evaporated under vacuum to give a crude product. The crude product was purified by silica gel column chromatography using DCM / MeOH (50 / 1-10 / 1) to give a product (250 mg, 61%) as a yellow solid. LC / MS: 484.7 [M+H] + .
[0481] Step 2: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeric acid
[0482] (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)tert-butyl valerate (250 mg, 0.52 mmol) was dissolved in DCM (10 mL) and TFA (2 mL). The reaction mixture was stirred at 25 °C for 5 hours. The mixture was concentrated to give the product (200 mg, 78%) as a brown solid. LC / MS: 428.8 [M+H] + .
[0483] Step 3: Preparation of (S)-3-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0484] A solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeric acid (50 mg, 0.10 mmol), HATU (53.24 mg, 0.14 mmol), and DIEA (45.23 mg, 0.35 mmol) in DCM (15 mL) was stirred for 10 min. (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (53.24 mg, 0.14 mmol) was added. The mixture was stirred at 25 °C for 2 h. The solvent was removed, and the residue was purified by silica gel column chromatography (DCM / MeOH = 20 / 1) to give the product (35 mg, 0.04 mmol, 40%) as a yellow solid. LC / MS: 858.3, [M+H] + .
[0485] 1 H NMR (400MHz, DMSO) δ12.78 (s, 1H), 10.96 (s, 1H), 10.13 (br, 1H), 8.84 (d, J=7.4Hz, 1H), 8.27 (s, 1H), 7 .64 (s, 1H), 7.60-7.46 (m, 3H), 7.26 (t, J, = 7.4Hz, 1H), 7.23-6.97 (m, 5H), 5.06-5.01 (m, 1H), 4.48-4.1 2(m, 4H), 4.061,-3.81(m, 2H), 3.66-3.49(m, 1H), 3.34-3.11(m, 5H), 3.10-2.76(m, 3H), 2.67,-2.52(m , 3H), 2.50-2.24(m, 6H), 2.17-2.08(m, 2H), 2.01-1.87(m, 1H), 1.74,-1.46(m, 4H), 1.43-1.31(m, 1H).
[0486] Example 26: Preparation of 5-(4-(3-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)propyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 26)
[0487]
[0488] Compound 26 was prepared using a procedure similar to that described for compound 15.
[0489] LC / MS: 830.5 [M+H] + .
[0490] 1 H NMR (400MHz, DMSO) δ12.87 (s, 1H), 11.11 (s, 1H), 8.81 (s, 1H), 8.29 (s, 1H), 7.70 (s, 1H), 7.64-7.5 6(m, 1H), 7.53-7.45(m, 2H), 7.40-7.35(m, 1H), 7.30-7.23(m, 2H), 7.22-7.17(m, 2H), 7.15-7.10(m , 1H), 7.07-7.00(m, 1H), 5.17-5.05(m, 1H), 4.42-4.16(m, 2H), 3.72-3.41(m, 7H), 3.27-3.07(m, 6 H), 2.97-2.82 (m, 1H), 2.73-2.53 (m, 3H), 2.37-2.21 (m, 3H), 2.12-1.85 (m, 4H), 1.04-0.72 (m, 2H).
[0491] Example 27: Preparation of 5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)butyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 27)
[0492]
[0493] Compound 27 was prepared using a procedure similar to that described for compound 15.
[0494] LC / MS: 844.4 [M+H] + .
[0495] 1 H NMR (400MHz, DMSO) δ12.97 (s, 1H), 11.11 (s, 1H), 8.86 (s, 1H), 8.30 (s, 1H), 7.80- 7.59(m,2H),7.54-7.43(m,3H),7.39-7.29(m,3H),7.26-7.16,(m,3H),5.21-4.98 (m, 1H), 4.35-4.13 (m, 2H), 3.72-3.35 (m, 9H), 3.27-3.18, (m, 4H), 3.01-2.93 (m, 1H), 2.80-2.51(m, 4H), 2.41-2.19(m, 4H), 2.08-1.79, (m, 4H), 0.96-0.69(m, 2H).
[0496] Example 28: Preparation of 5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 28)
[0497]
[0498] Compound 28 was prepared using a procedure similar to that described for compound 11.
[0499] LCMS: m / z = 886.3 [M+1] + .
[0500] 1 HNMR (400MHz, CDCl3): δ11.06 (s, 1H), 8.85 (s, 1H), 8.229 (s, 1H), 7.69-7.67 (m, 1H), 7.58-7 .56(m,1H),7.51-7.49(m,2H),7.32(s,1H),7.28-7.21(s,2H),7.19-7.15(m,3H),7.01-6.9 9(s, 1H), 6.65(s, 1H), 5.32(s, 2H), 5.11-5.08(m, 1H), 4.35(s, 1H), 4.19(s, 1H), 3.91-3.88 (m, 2H), 2.68 (s, 1H), 2.39-2.31 (m, 5H), 2.09-1.99 (m, 8H), 1.60-1.42 (m, 8H), 0.85 (s, 4H).
[0501] Example 29: 5-(4-(7-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)heptyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 29)
[0502]
[0503] Compound 29 was prepared using a procedure similar to that described for compound 15.
[0504] LC / MS: 886.3 [M+H] + .
[0505] 1H NMR (400MHz, DMSO) δ12.89 (br, 1H), 11.10 (s, 1H), 8.79 (s, 1H), 8.31 (s, 1H), 7.77-7.65 (m, 2H), 7.58 (d, J=8.5H z, 1H), 7.54-7.45 (m, 2H), 7.44-7.32 (m, 1H), 7.30-7.17 (m, 4H), 7.04 (dd, J=8.5, 2.4Hz, 1H), 5.09 (dd, J=12.8, 5.3Hz, 1H), 4.64-4.46 (m, 1H), 4.30-4.12 (m, 1H), 3.81-3.65 (m, 1H), 3.57-3.38 (m, 4H), 3.17-3.02 (m, 3H), 2.9 8-2.79 (m, 3H), 2.71-2.53 (m, 3H), 2.46-2.21 (m, 3H), 2.20-1.86 (m, 5H), 1.81-1.42 (m, 6H), 1.40-1.27 (m, 6H).
[0506] Example 30: Preparation of 5-(4-(5-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 30)
[0507]
[0508] Compound 30 was prepared using a procedure similar to that described for compound 15.
[0509] LC / MS: 857.4 [M+H] + .
[0510] 1H NMR (400MHz, DMSO) δ12.87 (br, 1H), 11.10 (s, 1H), 8.82 (br, 1H), 8.30 (s, 1H), 7.75-7.65 (m, 2H), 7.58 (d, J=8.5Hz, 1H), 7.52-7.46 (m, 2H), 7.41-7.31 (m, 1H), 7.29-7.16 (m, 4H), 7.07-7 .01 (m, 1H), 5.13-5.06 (m, 1H), 4.59-4.45 (m, 1H), 3.61-3.43 (m, 5H), 3.07-2.77 (m, 5H), 2.7 2-2.55(m, 4H), 2.45-2.25(m, 3H), 2.15-1.87(m, 4H), 1.80-1.46(m, 6H), 1.42-1.17(m, 4H). Example 31: Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 31)
[0511]
[0512] Compound 31 was prepared using a procedure similar to that described for compound 14.
[0513] LCMS: m / z = 872.3 [M+1] + .
[0514] 1 HNMR (400MHz, DMSO): δ: 12.91 (s, 1H), 11.09 (s, 1H), 9.71 (s, 1H), 9.01-8.98 (m, 1H), 8.31 (s, 1H), 7.81-7.79 (m , 1H), 7.70(s, 1H), 7.60(s, 1H), 7.59-7.49(m, 3H), 7.45-7.35(m, 1H), 7.21(s, 1H), 7.19-7.16(m, 2H), 7.02(s, 1H),5.19-5.09(m,1H),4.31(s,2H),3.89(s,2H),3.61(s,1H),3.39-2.91(m,8H),2.92-2.85(m,1H),2.69-2.5 9(m, 1H), 2.45-2.35(s, 1H), 2.21-2.01(s, 3H), 1.75(s, 2H), 1.62-1.52(m, 3H), 1.49-1.32(m, 1H), 1.25(s, 1H).
[0515] Example 32: Preparation of (S)-3-(5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 32)
[0516]
[0517] Step 1: Preparation of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-carboxylic acid benzyl ester
[0518] To a solution of 4-formylpiperidin-1-carboxylic acid benzyl ester (60 mg, 0.24 mmol) in DCM (10 mL) under argon atmosphere at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (117 mg, 0.24 mmol), MgSO4 (288 mg, 2.4 mmol), and TEA (49 mg, 0.48 mmol) were added. The reaction mixture was stirred at room temperature for 30 min, and then sodium triacetoxyborohydride (127 mg, 0.6 mmol) was added. The reaction mixture was stirred at room temperature for 1 h. The solid was filtered off and washed with DCM (5 mL × 3). The combined solutions were concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC using PE:EA = 1:1 to give the title product (100 mg, 74%) as a white solid. LC / MS: 560.8 [M + H] + .
[0519] Step 2: Preparation of (S)-3-(1-oxo-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione
[0520] A solution of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-carboxylic acid benzyl ester (100 mg, 0.18 mmol) in TFA (4 mL) was stirred overnight at 70 °C. The mixture was concentrated under vacuum to give a crude product (136 mg) as a yellow solid, which was used in the next step without further purification. LC / MS: 426.8 [M+H] + .
[0521] Step 3: Preparation of (S)-3-(5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0522] Triphosgene (14 mg, 0.05 mmol) and DIEA (124 mg, 0.96 mmol) were added to a solution of (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (90 mg, 0.16 mmol) in DCM (5 mL) under argon atmosphere at room temperature. The reaction mixture was stirred at room temperature for 1 hour. The solution was concentrated under vacuum. The residue was dissolved in DCM (5 mL). (S)-3-(1-oxo-5-(4-(piperidin-4-ylmethyl)piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (136 mg) and DIEA (124 mg, 0.96 mmol) were added. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (2 mL) and the organic phase was separated. The organic phase was dried over Na₂SO₄ and concentrated under vacuum to obtain the crude product. The crude product was purified by Prep-TLC using DCM / MeOH = 10:1 to obtain a white solid (30 mg, 20%). LC / MS: 898.4 [M+H] + .
[0523] 1 H NMR (400MHz, DMSO) δ12.81 (br, 1H), 10.97 (s, 1H), 8.90 (br, 1H), 8.29 (s, 1H), 7.64 (s, 1H), 7.62-7.44 (m, 4H), 7.29-7.15 (m, 4H), 7.13-7.01 (m, 2H), 5.07 (dd, J=13.3, 5.1Hz, 1H), 4.38-4.18 (m, 3H), 4.00- 3.87(m, 1H), 3.75-3.50(m, 4H), 3.30-3.20(m, 2H), 3.17-3.05(m, 3H), 2.95-2.88(m, 1H), 2.73-2.53( m, 4H), 2.46-2.34 (m, 2H), 2.06-1.85 (m, 4H), 1.79-1.45 (m, 5H), 1.37-1.17 (m, 3H), 1.10-0.80 (m, 3H).
[0524] Example 33: Preparation of 5-(4-((1-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-carbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-((S)-2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 33)
[0525]
[0526] Compound 33 was prepared using a procedure similar to that described for compound 32.
[0527] LC / MS: 913.2 [M+H] + .
[0528] 1 H NMR (400MHz, DMSO) δ12.79 (s, 1H), 11.11 (s, 1H), 8.90 (s, 1H), 8.28 (s, 1H), 7.76-7.62 (m, 2H), 7.57 ( d, J=8.5Hz, 1H), 7.51-7.44 (m, 2H), 7.40-7.31 (m, 1H), 7.30-7.15 (m, 4H), 7.12-7.00 (m, 1H), 5.14-5. 05(m, 1H), 4.35-4.12(m, 2H), 3.68-3.40(m, 6H), 3.02-2.84(m, 5H), 2.70-2.61(m, 2H), 2.59-2.54(m , 1H), 2.46-2.33(m, 2H), 2.19-1.84(m, 5H), 1.72-1.48(m, 4H), 1.33-1.14(m, 3H), 0.99-0.72(m, 3H).
[0529] Example 34: Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 34)
[0530]
[0531] Step 1: Preparation of 5-(4-(5,5-dimethoxypentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0532] Add 2-(2,6-dioxadiazin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (340 mg, 0.994 mmol) and DIEA (350 mg, 2.71 mmol) to a solution of 5-bromo-1,1-dimethoxypentane (250 mg, 1.19 mmol) in DMSO (10 mL). Stir the mixture at 70 °C for 12 hours and extract with ethyl acetate. Wash the combined organic phases with an aqueous sodium chloride solution and dry over Na₂SO₄. Remove the solvent under vacuum and purify the residue by Prep-TLC (DCM / MeOH = 10 / 1) to give the desired product (135 mg, 24%) as a yellow solid.
[0533] Step 2: Preparation of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)pentanal
[0534] 5-(4-(5,5-dimethoxypentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (360 mg, 0.762 mmol) was dissolved in 2N HCl / dioxane (10 mL), and the reaction mixture was stirred at room temperature for 3 hours. The mixture was adjusted to pH 8-9 with aqueous NaHCO3 solution, and then extracted with EtOAc (40 mL, x 3). The organic layer was washed with water and brine and dried over Na2SO4. The solvent was removed by rotary evaporation, and the residue was purified by Prep-TLC (DCM / MeOH = 20 / 1) to give 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)pentanal (240 mg, 70%).
[0535] Step 3: Preparation of 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0536] Potassium acetate (72.3 mg 0.738 mmol) was added to a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (220 mg 0.492 mmol) in DCM (3 mL). The mixture was stirred for 30 minutes. A solution of 5-(4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)pentanal (210 mg 0.492 mmol) and AcOH (44.28 mg 0.738 mmol) in DCM (5 mL) was added. After stirring for 30 minutes, sodium triacetoxyborohydride (312 mg 1.476 mmol) was added and the mixture was stirred overnight at room temperature. The mixture was extracted with EtOAc (30 mL x 3). The organic layer was washed with water and brine and dried over Na₂SO₄. The solvent was removed by rotary evaporation, and the residue was purified by prep-HPLC to give 5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)pentyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (43.1 mg, 9.7%), as a white solid. LCMS: m / z = 860.3 [M+H] + .
[0537] 1H NMR (400MHz, DMSO) δ12.87 (s, 1H), 11.09 (s, 1H), 10.11 (s, 1H), 9.52 (s, 1H), 8.82 (d, J = 6.4Hz, 1H), 8.29 (s, 1H) ,7.69-7.59(m,1H)7.58(s,1H),7.56(s,1H),7.50-7.48(m,2H),7.45-7.44(m,1H),7.42-7.40(m,1H),7.25-7.2 3(m,2H),7.09-7.01(s,1H),5.12-5.07(m,2H),4.26-4.23(m,4H),3.61(s,4H),3.61-3.58(m,2H),3.21-3.12(s , 9H), 2.99-2.81 (m, 2H), 2.69-2.52 (m, 2H), 2.40 (d, J=2.4Hz, 2H), 2.15 (s, 1H), 2.09-1.98 (m, 2H), 1.35 (s, 2H).
[0538] Example 35: Preparation of 4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonon-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 35)
[0539]
[0540] Step 1: Preparation of non-8-ynylic acid
[0541] 7-Bromoheptanoic acid (1.50 g, 7.17 mmol) in DMSO (7 mL) was added dropwise to a solution of lithium acetylene-ethylenediamine complex (2.20 g, 21.5 mmol, 90%) in DMSO (5 mL) at 0 °C. The solution was stirred at room temperature for 2 hours. The reaction mixture was poured into ice / water, acidified with 1 N HCl, and extracted with DCM. The organic layer was dried over Na₂SO₄ and concentrated under vacuum. The residue was purified by rapid column chromatography (10–30% EA / PE) to give the title compound (713 mg, 64%) as a clear oil. LC / MS: 155.1 [M+H] + .
[0542] 1 H NMR (400MHz, CDCl3) δ2.38 (t, J=7.5Hz, 2H), 2.21 (td, J=7.0, 2.6, Hz, 2H), 1. 96(t, J=2.6Hz, 1H), 1.71-1.63(m, 2H), 1.60-1.52(m, 2H), 1.49-1.38(m, 4H).
[0543] Step 2: Preparation of tert-butyl nonano-8-ynylene ester
[0544] Oxaloyl chloride (1.5 g, 11.68 mmol) was added dropwise to a solution of nono-8-ynyl acetic acid (900 mg, 5.84 mmol) and anhydrous N,N-dimethylformamide (85 mg, 1.17 mmol) in anhydrous DCM (20 mL) at room temperature under Ar conditions. The reaction mixture was stirred at room temperature for 1 hour. The mixture was evaporated under vacuum, and the residue was dissolved in anhydrous THF (20 mL). The solution was cooled to 0 °C, and t-BuOK (1.3 g, 11.68 mmol) was added in portions. The mixture was stirred at room temperature for 1 hour. The reaction was quenched by adding ice water and extracted with Et,2O. The organic layer was dried over Na2SO4 and evaporated under vacuum. The residue was purified by rapid chromatography with PE / EA = 10:1 to give the title compound (657 mg, 53%) as a clear oil. LC / MS: 232.9 [M + Na] + .
[0545] 1 H NMR (400MHz, CDCl3) δ2.26-2.17 (m, 4H), 1.96 (t, J = 2.6Hz, 1H), 1.65-1.52 (m, 4H), 1.46 (s, 9H), 1.45-1.30 (m, 4H).
[0546] Step 3: Preparation of tert-butyl 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-4-yl)non-8-ynyl acetonitrile
[0547] A suspension of tert-butyl nonanoic acid (63 mg, 0.3 mmol), 4-bromo-2-(2,6-dioxadiazine-3-yl)isoindol-1,3-dione (50 mg, 0.15 mmol), cuprous iodide (I) (6.3 mg, 0.033 mmol), bis(triphenylphosphine)palladium chloride (II) (11 mg, 0.017 mmol), and Et3N (2 mL) in THF (5 mL) was stirred at 70 °C under an Ar atmosphere for 10 hours. The mixture was cooled to room temperature and filtered. The filtrate was evaporated under vacuum. The residue was purified by Prep-TLC with PE / EA = 1:1 to give the title compound (48 mg, 68%) as a white solid. LC / MS: 488.7 [M + Na] + .,
[0548] Step 4: Preparation of 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-4-yl)non-8-ynyl acid
[0549] A solution of tert-butyl 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-4-yl)non-8-ynyl ester (30 mg, 0.06 mmol) in TFA (1 mL) and DCM (3 mL) was stirred at room temperature for 2 hours. The mixture was evaporated under vacuum to give crude product (33 mg), which was used in the next step without further purification. LC / MS: 432.7 [M + Na] + .,
[0550] Step 5: Preparation of 4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonon-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0551] A mixture of 9-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-4-yl)non-8-ynyl acid (33 mg, 80% purity, 0.06 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (31 mg, 0.070 mmol), HATU (40 mg, 0.11 mmol), N,N-diisopropylethylamine (27 mg, 0.21 mmol), and DMF (5 mL) was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum and purified by Prep-TLC with DCM / MeOH = 10:1 to give the title compound (16.1 mg, 29%) as a white solid. LC / MS: 839.5 [M+H] + . ,
[0552] 1 H NMR (400MHz, DMSO) δ12.78 (br, 1H), 11.15 (br, 1H), 8.83 (s, 1H), 8.26 (s, 1H), 7.88-7.80 (m, 3 H), 7.65-7 / 62(m, 1H), 7.59(d, J=8.0Hz, 1H), 7.49(t, J=7.7Hz, 2H), 7.29-7.17(m, 4H), 7.03(d , J=7.6Hz, 1H), 5.18-5.12 (m, 1H), 4.35-4.06 (m, 2H), 3.91-3.76 (m, 1H), 3.05-2.85 (m, 2H), 2 .70-2.57(m, 2H), 2.37-2.35(m, 2H), 2.30-2.20(m, 3H), 1.63-1.48(m, 8H), 1.36-1.25(m, 5H).
[0553] Example 36: Preparation of 4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohep-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 36)
[0554]
[0555] Compound 36 was prepared using a procedure similar to that described for compound 35.
[0556] LC / MS: 811.4 [M+H] + . ,
[0557] 1H NMR (400MHz, DMSO) δ12.78 (br, 1H), 11.16 (s, 1H), 8.82 (d, J=6.5, Hz, 1H), 8.26 (s, 1H), 7.91-7.87 (m, 3 H), 7.64 (s, 1H), 7.58 (d, J=8.3Hz, 1H), 7.49 (t, J=7.3Hz, 2H), 7.30-7.25 (m, 1H), 7.28-7.22 (m, 3H), 7.0 7-7.02(m,1H),5.18-5.11(m,1H),4.39-4.14(m,2H),3.90-3.80(m,1H),3.07-2.81(m,2H),2.70-2.58 (m, 2H), 2.43-2.31 (m, 2H), 2.15-2.02 (m, 3H), 1.78-1.61 (m, 4H), 1.60-1.30 (m, 3H), 1.30-1.03 (m, 2H).
[0558] Example 37: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiridin-3-yl)isoindoline-1,3-dione (Compound 37)
[0559]
[0560] Step 1: Preparation of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutane-1-one
[0561] HATU (890 mg, 2.34 mmol), DIEA (756 mg, 5.85 mmol), and (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (944 mg, 1.95 mmol) were added to a solution of (3-oxocyclobutyl)acetic acid (250 mg, 1.95 mmol) in DMF (10 mL) under stirring at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (40 mL) and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated under vacuum to give a crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (1 g, 91.79%) as a yellow solid. LC / MS: 558.0 [M+H] + .
[0562] Step 2: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0563] To a solution of 3-{2-[4-({5-[(2-chloro-4-phenoxyphenyl)carbonyl]-7H-pyrrolo[2,3-d]pyrimidin-4-yl}amino)piperidin-1-yl]-2-oxoethyl}cyclobutane-1-one (1 g, 1.79 mmol) in MeOH / DMF / AcOH (8 mL, 4 mL, 0.5 mL), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (678 mg, 1.79 mmol) and NaBH3CN (169 mg, 2.685 mmol) were added. The reaction mixture was stirred at 60 °C for 1 hour. The mixture was concentrated under vacuum to give a crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (290 mg, 18.44%) as a yellow solid. LC / MS: 884.1 [M+H] + .
[0564] 1 H NMR (400MHz, DMSO) δ12.76 (s, 1H), 11.09 (s, 1H), 10.1 (br, 1H), 8.83 (d, J = 7.2Hz, 1H), 8.26 (s, 1H), 7.85-7.72 (m, 1H), 7.64 (s, 1 H), 7.58 (d, J=8.4Hz, 1H), 7.48 (t, J=8.4Hz, 2H), 7.35-7.30 (m, 1H), 7.26 (t, J=7.6Hz, 2H), 7.2-7.16 (m, 3H), 7.03 (dd, J=8.4, 2.4 Hz, 1H), 5.18-5.05 (m, 1H), 4.40-4.30 (m, 1H), 4.19-4.13 (m, 1H), 3.86-3.82 (m, 1H), 3.48-3.39 (m, 3H), 3.29-3.25 (m, 2H), 3.05 -2.80 (m, 4H), 2.64-2.53 (m, 3H), 2.43-2.30 (m, 4H), 2.27-2.21 (m, 2H), 2.18-1.95 (m, 4H), 1.61-1.48 (m, 2H), 1.40-1.35 (m, 1H).
[0565] Example 38: Preparation of 4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 38)
[0566]
[0567] Compound 38 was prepared using a procedure similar to that described for compound 35.
[0568] LC / MS: 825.5 [M+H] + .,
[0569] 1 H NMR (400MHz, DMSO) δ12.77 (br, 1H), 11.15 (s, 1H), 8.83 (d, J=7.3Hz, 1H), 8.26 (s, 1H), 7.87-7.81 (m, 3H), 7.63 (s, 1H), 7.58 (d, J=8.5Hz, 1H), 7.52-7.46 (m, 2H), 7.26 (t, J=7.4Hz, 1H), 7.22-7.17 (m, 3H), 7.02 (dd, J=8.5, 2.3Hz, 1H), 5.15 (d d, J=12.9, 5.3Hz, 1H), 4.35-4.20 (m, 1H), 4.18-4.13 (m, 1H), 3.85 (d, J=14.3Hz, 1H), 3.32-3.26 (m, 1H), 3.05-2.98 (m, 1 H), 2.92-2.84(m, 1H), 2.63-2.53(m, 3H), 2.42-2.32(m, 3H), 2.09-2.01(m, 3H), 1.64,-1.51(m, 6H), 1.44-1.29(m, 2H).
[0570] Example 39: Preparation of 3-(4-(9-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-9-oxonon-1-yn-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 39)
[0571]
[0572] Compound 39 was prepared using a procedure similar to that described for compound 35.
[0573] LC / MS: 825.5 [M+H] + . ,
[0574] 1 H NMR (400MHz, DMSO) δ12.76 (br, 1H), 11.00 (br, 1H), 9.00-8.75 (m, 1H), 8.26 (br, 1 H), 7.72-7.46 (m, 7H), 7.35-7.16 (m, 4H), 7.12-7.04 (m, 1H), 5.23-5.10 (m, 1H), 4. 51-4.42(m, 1H), 4.39-4.27(m, 2H), 4.22-4.12(m, 1H), 3.89-3.77(m, 1H), 3.01-2. 88(m, 2H), 2.76-2.65(m, 2H), 2.38-2.33(m, 2H), 2.04(s, 3H), 1.70-1.30(m, 13H).
[0575] Example 40: Preparation of 3-(4-(8-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-8-oxooct-1-yn-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 40)
[0576]
[0577] Compound 40 was prepared using a procedure similar to that described for compound 35.
[0578] LC / MS: 811.5 [M+H] + . ,
[0579] 1H NMR (400MHz, DMSO) δ12.76 (br, 1H), 11.00 (s, 1H), 8.82 (d, J=7.4, Hz, 1H), 8.26 (s, 1H), 7.70 (d, J=7.0Hz, 1H), 7.64 (t, J=3. 4Hz, 2H), 7.58 (d, J, = 8.5Hz, 1H), 7.54-7.43 (m, 3H), 7.28-7.24 (m, 1H), 7.20-7.18 (m, 2H), 7.02, (dd, J = 8.5, 2.4Hz, 1H), 5. 19-5.10 (m, 1H), 4.53-4.45 (m, 1H), 4.39-4.25 (m, 2H), 4.20-4.15 (m, 1H), 3.90-3.81 (m, 1H), 3.29-3.25 (m, 1H), 3.04-2.85 (m, 3H), 2.70-2.66 (m, 1H), 2.62-2.54 (m, 2H), 2.40-2.33 (m, 2H), 2.10-1.98 (m, 3H), 1.63-1.36 (m, 8H), 1.29-1.21 (m, 1H).
[0580] Example 41: Preparation of 3-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohept-1-yn-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 41)
[0581]
[0582] Compound 41 was prepared using a procedure similar to that described for compound 35.
[0583] LC / MS: 798.3 [M+H] + . ,
[0584] 1H NMR (400MHz, DMSO) δ12.79 (s, 1H), 11.1-10.9 (m, 1H), 8.82 (d, J = 7.6Hz, 1H), 8.26 (s, 1H), 7.70 (d, J = 6.8Hz, 1H), 7.63 (t, J = 3.6Hz, 2H), 7 .58, (d, J=8.4Hz, 1H), 7.54-7.43 (m, 3H), 7.30-7.23 (m, 1H), 7.23-7.14 (m, 3H), 7.02 (dd, J=8.4, 2.4Hz, 1H), 5.15 (dd, J=13.2, 4.6Hz, 1H ), 4.50-4.45(m, 1H), 4.35-4.28(m, 2H), 4.20-4.10(m, 1H), 3.89-3.80(m, 1H), 3.65-3.57(m, 1H), 3.33-3.25(m, 1H), 3.15-3.08(m, 1H), 3.02-2.87 (m, 2H), 2.62-2.53 (m, 2H), 2.42 (t, J=7.2Hz, 2H), 2.09-1.97 (m, 3H), 1.72-1.60 (m, 3H), 1.55-1.46 (m, 1H), 1.41-1.31 (m, 2H).
[0585] Example 42: Preparation of (S)-3-(5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 42)
[0586]
[0587] Step 1: Preparation of 3-(2-diazoacetyl)cyclobutane-1-one
[0588] SOCl2 (3.84 mL) was added to a solution of 3-oxocyclobutane-1-carboxylic acid (2 g, 17.54 mmol) in DCM (10 mL). The reaction mixture was stirred at 20 °C for 2 hours. The mixture was evaporated to dryness under reduced pressure. (diazomethyl)trimethylsilane (2 M in hexane, 17.5 mL) was added to a solution of the residue in THF (5 mL) and acetonitrile (5 mL). The reaction mixture was stirred at 20 °C overnight and then evaporated under vacuum to give the crude product. The crude product was purified by column chromatography (silica gel, PE / EA = 2:1) to give the title compound (1.6 g, 52.8% yield) as a yellow oil. LC / MS: 139.1 [M+H]+.
[0589] Step 2: Preparation of 2-(3-oxocyclobutyl)acetic acid
[0590] AgNO3 (1.87 g, 11.12 mmol) was added to a solution of 3-(2-diazoacetyl)cyclobutane-1-one (1.6 g, 9.27 mmol) in THF (30 mL) and water (15 mL). The reaction mixture was stirred overnight at room temperature, and then evaporated under vacuum to remove THF. The aqueous phase was extracted with EA (20 mL × 3). The combined organic layers were dried over Na2SO4 and evaporated under vacuum to provide the title compound (1.0 g, 76.4% yield) as a yellow oil. LC / MS: 127.1 [MH] - .
[0591] Step 3: Preparation of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutane-1-one
[0592] A solution of 2-(3-oxocyclobutyl)acetic acid (50 mg, 90% purity, 0.35 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (207.8 mg, 0.43 mmol), HATU (177.9 mg, 0.47 mmol), N,N-diisopropylethylamine (75.6 mg, 0.59 mmol), and DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM (1:10) to give the title compound (100 mg, 51%). LC / MS: 557.6 [M+H],
[0593] Step 4: Preparation of (S)-3-(5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0594] A solution of 3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutane-1-one (100 mg, 0.18 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (87.5 mg, 0.18 mmol), and sodium cyanoborohydride (21.6 mg, 0.36 mmol) in DMF / MeOH / HOAc (16 mL, 5:10:1) was stirred overnight at room temperature. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (40 mg, 25.6%). LC / MS: 869.5 [M+H] + .
[0595] 1 H NMR (400MHz, DMSO) δ12.77 (s, 1H), 10.96 (s, 1H), 8.83 (d, J=7.5, Hz, 1H), 8.26 (s, 1H), 7.64 (s, 1H), 7.58 (d, J=8.5Hz , 1H), 7.51-7.46 (m, 2H), 7.26 (t, J=7.4Hz, 1H), 7.21-7.16 (m, 3H), 7.08-7.01 (m, 2H), 5.06 (d, J=12.7, Hz, 1H), 4.37- 4.13(m, 4H), 4.00(s, 1H), 3.87-3.79(m, 1H), 3.71-3.34(m, 2H), 3.31-3.13(m, 4H), 3.06-2.85(m, 3H), 2.80-2.52(m , 2H), 2.49-2.46(m, 1H), 2.37(s, 4H), 2.23(s, 2H), 2.13-1.89(m, 5H), 1.51(br, 2H), 1.41-1.34(m, 1H), 1.24(s, 1H).
[0596] Example 43: Preparation of 5-(4-(3-(2-((R)-3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)cyclobutyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 43)
[0597] Compound 43 was prepared using the same method as described in the preparation of compound 42. LC / MS: 884.4, [M+H]+
[0598] 1H NMR (400MHz, DMSO) δ12.81-12.75 (m, 1H), 11.09 (s, 1H), 8.92-8.86 (m, 1H), 8.33-8.25 (m, 1 H), 7.67-7.63(m, 2H), 7.59-7.42(m, 3H), 7.35,-7.30(m, 1H), 7.29-7.11(m, 5H), 7.07-7.01 (m, 1H), 5.10-5.06 (m, 1H), 4.28,-4.20 (m, 1H), 3.79-3.35 (m, 8H), 2.94-2.84 (m, 1H), 2.68 -2.55(m,3H),2.46,-2.08(m,9H),2.05-1.80(m,3H),1.78-1.72(m,3H),1.27-1.20(M,1H).
[0599] Example 44: Preparation of 5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 44)
[0600]
[0601] Step 1: Preparation of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde
[0602] A solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(2,2-dimethoxyethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (250 mg, 0.4 mmol) in THF / H₂SO₄ (10% aq) (30 mL, THF / H₂SO₄ = 1 / 1) was stirred at 70 °C for 1 hour. The reaction mixture was adjusted to pH 10 with sodium hydroxide solution (2 M) and extracted with EtOAc (15 mL, × 3). The organic phase was dried over sodium sulfate and concentrated under vacuum to give the desired product (200 mg, 82%) as a yellow solid. LC / MS: 583. [M+1] + .
[0603] Step 2: Preparation of 5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0604] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (100 mg, 0.17 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (64 mg, 0.17 mmol), TEA (52 mg, 0.51 mmol), and MgSO4 (408 mg, 3.4 mmol) in DCM (20 mL) was stirred at room temperature under nitrogen for 30 min. Sodium triacetoxyborohydride (72 mg, 0.34 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered and extracted with water. The organic phase was concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH:DCM = 1:10) to obtain the desired product (50 mg, 32%) as a yellow solid. LC / MS: 910.4 [M+1] + .
[0605] 1 H NMR (400MHz, DMSO) δ13.06 (br, 1H), 11.12 (d, J=18.0Hz, 2H), 8.46 (s, 1H), 8.11-8.02 (m, 1H), 7.8 4(s, 1H), 7.74-7.61(m, 2H), 7.54-7.45(m, 2H), 7.38-7.18(m, 6H), 7.14-7.02(m, 2H), 5.08(dd, J =12.8, 5.3Hz, 1H), 3.52,-3.37(m, 2H), 3.36-3.28(m, 7H), 2.95-2.82(m, 1H), 2.71-2.53(m, 4H), 2.45-2.27(m, 3H), 2.04-1.97(m, 1H), 1.85-1.73(m, 2H), 1.55-1.3.0(m, 5H), 1.28-1.20(m, 1H).
[0606] Example 45: Preparation of (S)-3-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 45)
[0607]
[0608] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (100 mg, 0.17 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (83 mg, 0.17 mmol), TEA (52 mg, 0.51 mmol), and MgSO4 (408 mg, 3.4 mmol) in DCM (20 mL) was stirred at room temperature under nitrogen for 30 min. Sodium triacetoxyborohydride (72 mg, 0.34 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered. The organic layer was washed with water and concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH:DCM = 1:10) to obtain the desired product (30 mg, 17.6%) as a yellow solid. LC / MS: 896.4 [M+1] + .
[0609] 1 H NMR (400MHz, DMSO) δ13.06 (br, 1H), 11.14 (s, 1H), 10.96 (s, 1H), 8.46 (s, 1H), 8.05 (dd, J=15.0, 2.1H z, 1H), 7.84 (s, 1H), 7.64 (d, J=8.5Hz, 1H), 7.65-7.39 (m, 3H), 7.35-7.18 (m, 5H), 7.12-7.02 (m, 4H), 5.06(dd, J=13.2, 5.0Hz, 1H), 4.39-4.19(m, 2H), 3.35-3.25(m, 7H), 2.94-2.85(m, 1H), 2.70-2.53(m , 4H), 2.49-2.25(m, 4H), 1.95-1.85(m, 1H), 1.80-1.75(m, 2H), 1.62-1.30(m, 5H), 1.25-1.15(m, 1H).
[0610] Example 46: Preparation of (S)-3-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione (Compound 46)
[0611]
[0612] Step 1: Preparation of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carboxaldehyde
[0613] A solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (200 mg, 0.32 mmol) in THF / H₂SO₄ (10% aq) (20 mL, 1:1) was stirred at 70 °C for 1 hour. The reaction mixture was adjusted to pH 10 with sodium hydroxide solution (2 M) and extracted with EtOAc (100 mL). The organic phase was dried over sodium sulfate and evaporated under vacuum to give the desired product (150 mg, 82% yield) as a yellow solid. LC / MS: 570.1 [M+1] + .
[0614] Step 2: Preparation of (S)-3-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-1-oxoisoindoline-2-yl)piperidin-2,6-dione
[0615] A solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-carboxaldehyde (70 mg, 0.12 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (60 mg, 0.12 mmol), TEA (24 mg, 0.24 mmol), and MgSO4 (289 mg, 2.4 mmol) in DCM (10 mL) was stirred at room temperature under nitrogen for 30 minutes. Sodium triacetoxyborohydride (64 mg, 0.3 mmol) was added to the solution in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was then filtered. The organic layer was washed with water and extracted with DCM (50 mL) to obtain the crude product. This crude product was purified by Prep-TLC (PE:EA = 5:1) to obtain the desired product (20 mg, 19% yield) as a yellow solid. LC / MS: 882.0 [M+1] +
[0616] 1 H NMR (400MHz, DMSO) δ13.05 (br, 1H), 11.14 (s, 1H), 10.96 (s, 1H), 8.46 (s, 1H), 8.04 (d, J=16.6Hz, 1H), 7.84 (s, 1 H), 7.65 (d, J=8.5Hz, 1H), 7.59-7.46 (m, 3H), 7.39-7.14 (m, 5H), 7.11-7.03 (m, 3H), 5.05 (dd, J=13.4, 5.1Hz, 1H) , 4.34 (d, J = 17.0Hz, 1H), 4.21 (d, J = 16.9Hz, 1H), 3.30-3.27 (m, 6H), 2.96-2.86 (m, 1H), 2.71-2.53 (m, 4H), 2.46- 2.31 (m, 3H), 2.26 (d, J=6.5Hz, 2H), 2.02-1.92 (m, 1H), 1.88-1.78 (m, 2H), 1.76-1.62 (m, 2H), 1.38-1.19 (m, 3H).
[0617] Example 47: Preparation of 5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 47)
[0618]
[0619] A solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-carboxaldehyde (70 mg, 0.12 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione (45 mg, 0.12 mmol), TEA (24 mg, 0.24 mmol), and MgSO4 (289 mg, 2.4 mmol) in DCM (10 mL) was stirred at room temperature for 30 min under nitrogen. Sodium triacetoxyborohydride (64 mg, 0.3 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered. The organic layer was washed with water and concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH:DCM = 1:10) to obtain the desired product (20 mg, 18%) as a yellow solid. LC / MS: 898.1 [M+1] + .
[0620] 1 H NMR (400MHz, DMSO) δ13.05 (s, 1H), 11.14 (s, 1H), 11.09 (s, 1H), 8.46 (s, 1H), 8.08-8.01 (m, 1H), 7.84 ( s, 1H), 7.72-7.61 (m, 2H), 7.54-7.45 (m, 2H), 7.37-7.18 (m, 6H), 7.13-7.02 (m, 2H), 5.08 (dd, J=13.0, 5.4Hz, 1H), 3.50-3.41(m, 3H), 3.33-3.29(m, 2H), 2.93-2.84(m, 1H), 2.75-2.58(m, 3H), 2.57-2.52(m , 2H), 2.47-2.30(m, 2H), 2.29-2.20(m, 2H), 2.10-1.92(m, 2H), 1.90-1.64(m, 4H), 1.39-1.22(m, 3H).
[0621] Example 48: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)azacyclobutane-1-yl)piperidin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (Compound 48)
[0622]
[0623] Step 1: Preparation of benzyl 4-(3-(2-(tert-butoxy)-2-oxoethyl)azacyclobutane-1-yl)piperidine-1-carboxylate
[0624] Et3N (194 mg, 1.92 mmol), MgSO4 (300 mg), and [3-(4-oxopiperidin-1-yl)phenyl]methyl formate (224 mg, 0.96 mmol) were added to a solution of 2-(azacyclobutan-3-yl)-tert-butyl acetate (200 mg, 0.96 mmol) in DCM (5 mL) under stirring at room temperature. The mixture was stirred at room temperature for 30 min, and then NaBH(OAc)3 (406 mg, 1.92 mmol) was slowly added (0.5 eq / 30 min). The reaction mixture was stirred at room temperature for 1 h. The mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was purified by rapid chromatography (MeOH / DCM = 1:10) to give the desired product (255 mg, 68.37%) as a colorless oil. LC / MS: 388.8 [M+H] + .
[0625] Step 2: Preparation of 2-(1-(piperidin-4-yl)azacyclobutane-3-yl)tert-butyl acetate
[0626] Pd / C (70 mg, 0.66 mmol) was added to a solution of 2-[1-(1-{3-[(formyloxy)methyl]phenyl}piperidin-4-yl)azacyclobutan-3-yl]tert-butyl acetate (255 mg, 0.66 mmol) in MeOH (5 mL) under stirring at room temperature. The reaction mixture was stirred at room temperature under H2 for 3 hours. The mixture was filtered, and the filtrate was concentrated under reduced pressure to give the desired product (160 mg, yield = 95.3%) as a white solid. LC / MS: 255.1 [M+H] + .
[0627] Step 3: Preparation of 2-(1-(1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperidin-4-yl)azacyclobutane-3-yl)tert-butyl acetate
[0628] To a solution of 2-(2,6-dioxadiazin-3-yl)-5-fluoroisoindole-1,3-dione (140 mg, 0.55 mmol) in NMP (5 mL) under stirring at room temperature, 2-[1-(piperidin-4-yl)azacyclobutane-3-yl]tert-butyl acetate (140 mg, 0.55 mmol) and DIEA (142 mg, 1.1 mmol) were added. The reaction mixture was stirred at 90 °C for 12 hours. The mixture was poured into water (25 mL) and extracted with EtOAc (30 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (MeOH / DCM = 1:10) to give the desired product (70 mg, yield = 25.4%) as a yellow solid. LC / MS: 510.8 [M+H] + .
[0629] Step 4: Preparation of 2-(1-(1-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperidin-4-yl)azacyclobutane-3-yl)acetic acid
[0630] A solution of 2-(1-{1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl}azacyclobutane-3-yl)tert-butyl acetate (70 mg, 0.14 mmol) in TFA / DCM (1:5, 6 mL) was stirred at room temperature for 2 hours. The solution was concentrated under vacuum to give the crude product (80 mg, crude product). LC / MS: 455.1 [M+H] + .
[0631] Step 5: Preparation of 5-(4-(3-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)azacyclobutane-1-yl)piperidin-1-yl)-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione
[0632] HOBt (22 mg, 0.156 mmol), EDCI (30 mg, 0.156 mmol), NMM (53 mg, 0.52 mmol), and N-{5-[(2-chloro-4-phenoxyphenyl)carbonyl]-7H-pyrrolo[2,3-d]pyrimidin-4-yl}piperidine-4-amine hydrochloride (63 mg, 0.14 mmol) were added to a solution of (1-{1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl}piperidine-4-amine hydrochloride) stirred at room temperature in DMF (5 mL). The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (25 mL) and extracted with EtOAc (30 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to obtain the crude product. The crude product was purified by Prep-TLC (MeOH / DCM = 1:10) to give the desired product as a yellow solid (30 mg, yield = 24.2%). LC / MS: 884.1 [M+H] + .
[0633] 1 H NMR (400MHz, DMSO) δ12.75 (br, 1H), 11.09 (s, 1H), 8.83 (d, J = 7.2Hz, 1H), 8.26 (s, 1H), 7.66-7.61 (m, 2H), 7.58 (d, J = 8.8Hz, 1H), 7 .47(t, J=8.0Hz, 2H), 7.30(s, 1H), 7.28-7.14(m, 5H), 7.02(dd, J=8.8, 2.4Hz, 1H), 5.09–5.04(m, 1H), 4.40-4.30(m, 1H), 4.18-4.1 3(m,1H),3.95-3.73(m,3H),3.13,-3.05(m,2H),3.03-2.95(m,1H),2.94-2.86(m,1H),2.84-2.73(m,2H),2.70-2.65(m,2H),2.6 2-2.54 (m, 2H), 2.34-2.21 (m, 2H), 2.10-1.95 (m, 4H), 1.74-1.64 (m, 2H), 1.58-1.45 (m, 2H), 1.43-1.30 (m, 2H), 1.22-1.15 (m, 2H).
[0634] Example 49: Preparation of (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 49)
[0635]
[0636] Step 1: Preparation of N-(4-bromobenzyl)-5-fluoro-2-methoxybenzamide
[0637] A solution of 5-fluoro-2-methoxybenzoic acid (30 g, 176 mmol, 1.0 eq), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethylurea hexafluorophosphate (80.5 g, 212 mmol, 1.2 eq), and N,N-diisopropylethylamine (45.6 g, 353 mmol, 2 eq) in N,N-dimethylformamide (300 mL) was stirred at 25 °C for 30 min. (4-Bromophenyl)methylamine (32.8 g, 176 mmol, 1.0 eq) was added to the solution, and the mixture was stirred at 25 °C for 12 h. The solution was poured into water (500 mL) and extracted with ethyl acetate (500 mL × 3). The combined organic phases were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by silica gel chromatography using 20%-30% ethyl acetate / petroleum ether as eluent to give the desired compound (56 g, 94% yield) as a white solid.
[0638] 1 HNMR (400MHz, CDCl3): δ8.26(br s, 1H), 7.94 (q, J=2.0Hz, 1H), 7.45 (d, J=7.6Hz, 2H), 7.22 (d, J=8.0Hz, 2H) , 7.16-7.12 (m, 1H), 6.94-6.91 (m, 1H), 4.61 (d, J=6.0Hz, 2H), 3.91 (s, 3H).
[0639] Step 2: Preparation of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)phenyl]methyl]benzamide
[0640] Potassium acetate (26.7 g, 272 mmol, 2.0 eq) and 1,1-bis(diphenylphosphine)ferrocene]palladium(II) dichloride (9.95 g, 13.6 mmol, 0.1 eq) were added to a solution of N-[(4-bromophenyl)methyl]-5-fluoro-2-methoxy-benzamide (46 g, 136 mmol, 1.0 eq) and 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyl-2-yl)-1,3,2-dioxaborhecyl (51.8 g, 204 mmol, 1.5 eq) in dioxane (500 mL). The suspension was degassed under vacuum and purged three times with nitrogen. The mixture was stirred at 90 °C for 12 hours under nitrogen. The solution was poured into water (2 L) and extracted with ethyl acetate (1 L × 3). The combined organic phases were washed with brine (2 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The combined crude products were purified by silica gel chromatography using 20%–30% ethyl acetate / petroleum ether as eluent. The crude products were ground together with petroleum ether (200 mL), filtered, and the filter cake was dried under vacuum to give the desired compound (50 g, 79% yield) as a white solid. LC / MS: 386.2 [M+H] + .
[0641] Step 3: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0642] A mixture of 5-fluoro-2-methoxy-N-[[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)phenyl]methyl]benzamide (10.0 g, 26.0 mmol, 1.0 eq), 3-iodo-1H-pyrazolo[3,4-d]pyrimidin-4-amine (6.78 g, 26.0 mmol, 1.0 eq), 1,1-bis(diphenylphosphine)ferrocene]palladium(II) dichloride (3.80 g, 5.19 mmol, 0.2 eq), and potassium phosphate (16.5 g, 77.9 mmol, 3.0 eq) in dioxane (200 mL) and water (40 mL) was degassed and purged three times with nitrogen. The mixture was then stirred at 110 °C for 60 hours under a nitrogen atmosphere. The reaction mixture was partitioned between ethyl acetate (1 L) and water (1 L). The organic phase was separated, washed with brine (1 L), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was ground successively with acetonitrile (50 mL) and ethyl acetate (50 mL). The solid was collected and dried under vacuum to give the desired compound (6.0 g, 59% yield) as a pale yellow solid. LC / MS: 393.1 [M+H] + . , 1H NMR (400MHz, DMSO-d6): δ13.59 (s, 1H), 8.86 (t, J=6.0Hz, 1H), 8.22 (s, 1H), 7.64 (d, J=8.0Hz, 2H), 7. 57-7.47 (m, 3H), 7.37-7.31 (m, 1H), 7.19 (dd, J=4.4, 9.2Hz, 1H), 4.59 (d, J=6.0Hz, 2H), 3.90 (s, 3H).
[0643] Step 4: Preparation of N-[[4-[4-amino-1-[4-[4-[4-(dimethoxymethyl)-1-piperidinyl]-3-fluoro-phenyl]pyrazolo[3,4-d]pyrimidin-3-yl]phenyl]methyl]-5-fluoro-2-methoxy-benzamide
[0644] Add copper iodide (3.24 g, 17.0 mmol, 0.55 eq), 2-(dimethylamino)acetic acid (3.50 g, 33.98 mmol, 1.1 eq), and sodium carbonate (7.20 g, 68.0 mmol, 2.2 eq) to a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl]-5-fluoro-2-methoxy-benzamide (12.0 g, 30.6 mmol, 1.0 eq) in dimethyl sulfoxide (150 mL) to a solution of N-[[4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)piperidine (11.6 g, 30.6 mmol, 1.0 eq) in dimethyl sulfoxide (150 mL). Degas the suspension under vacuum and purge three times with nitrogen. Stir the mixture at 110 °C for 12 hours under nitrogen. The reaction mixture was partitioned between ethyl acetate (800 mL) and water (2.0 L). The aqueous layer was extracted with ethyl acetate (700 mL × 3). The combined organic layers were washed with brine (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give a crude product (15 g). The crude product was dissolved in ethyl acetate (420 mL) under reflux, and the solution was cooled to ambient temperature and then stored in a refrigerator (~5 °C) for 48 hours. The suspension was filtered, and the wet filter cake was washed with cold ethyl acetate (20 mL) to give a pure product (5.28 g). The mother liquor was concentrated, and the residue was recrystallized from ethyl acetate (100 mL) to give another batch of pure product (1.7 g) (total 6.98 g, 36% yield), as a gray solid.
[0645] LC / MS: 644.2 [M+H] + . , 1HNMR (400MHz, CDCl3): δ8.47 (s, 1H), 8.38 (t, J = 5.2Hz, 1H), 7.99 (dd, J = 3.2, 9.2Hz, 1H), 7.97-7.93 (m, 1H), 7.92 (s, 1H), 7 .75 (d, J=8.0Hz, 2H), 7.56 (d, J=8.0Hz, 2H), 7.22-7.14 (m, 1H), 7.08 (t, J=8.8Hz, 1H), 6.97 (dd, J=4.4, 8.8Hz, 1H), 5.60 (br s, 2H), 4.78 (d, J=6.0Hz, 2H), 4.12 (d, J=7.2Hz, 1H), 3.97 (s, 3H), 3.53 (d, J=12.0Hz, 2H), 3.39 (s, 6H), 2.69 (t, J=11.6Hz, 2H), 1.88 (d, J=12.0Hz, 2H), 1.82-1.73 (m, 1H), 1.64-1.48 (m, 2H).
[0646] Step 5: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(4-formylpiperidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0647] A solution of N-(4-(4-amino-1-(4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (1.03 g, 1.60 mmol) in THF (20 mL) and H₂SO₄ (2 M, 20 mL) was stirred at 70 °C for 1 hour. The reaction mixture was diluted with DCM (50 mL), and the pH was adjusted dropwise to 8 with an aqueous sodium hydroxide solution (2 M). The organic layer was evaporated under vacuum to give the desired product (900 mg, 96% yield) as a yellow solid. LC / MS: 598.1 [M+1] + .
[0648] Step 6: Preparation of (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0649] A solution of N-(4-(4-amino-1-(3-fluoro-4-(4-formylpiperidin-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (900 mg, 1.51 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindololin-2-yl)piperidin-2,6-dione (1.46 g, 3.02 mmol), and triethylamine (325 mg, 3.21 mmol) in DCM (60 mL) was stirred in air at room temperature for 1 hour. Sodium triacetoxyborohydride (956 mg, 4.53 mmol) was added in portions to this solution at 0 °C. The reaction mixture was stirred overnight at room temperature and then partitioned between water (50 mL) and DCM (60 mL). The organic phase was dried over sodium sulfate and evaporated under vacuum. The crude product was ground together with MeOH to give a white solid product (1.0 g, 1.10 mmol, 73% yield). LC / MS: 910.4 [M+1] + .
[0650] 1 H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.90 (t, J=6.0Hz, 1H), 8.38 (s, 1H), 8.05-7.99 (m , 2H), 7.74 (d, J=8.1Hz, 2H), 7.57-7.50 (m, 4H), 7.37-7.32 (m, 1H), 7.25-7.18 (m, 2H) , 7.07 (d, J=8.5Hz, 2H), 5.05 (dd, J=13.1, 4.9Hz, 1H), 4.61 (d, J=6.0Hz, 2H), 4.33 (d, J=17.2Hz, 1H), 4.20 (d, J=17.2Hz, 1H), 3.91 (s, 3H), 3.42 (d, J=10.4Hz, 2H), 3.30 (br s, 4H), 2.96-2.85 (m, 1H), 2.77–2.67 (m, 2H), 2.64-2.52 (m, 5H), 2.43-2.3 0 (m, 1H), 2.24 (br, d, J = 6.4Hz, 2H), 2.01-1.66 (m, 4H), 1.38-1.25 (m, 2H).
[0651] Example 50: Preparation of N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 50)
[0652]
[0653] A solution of N-[(4-{4-amino-1-[3-fluoro-4-(4-formylpiperidin-1-yl)phenyl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (60 mg, 0.1 mmol), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindoline-1,3-dione hydrochloride (57 mg, 0.15 mmol), and triethylamine (30 mg, 0.3 mmol) in DCM (5.0 mL) was stirred in air at room temperature. The reaction mixture was stirred at room temperature for 2 hours. Then, sodium triacetoxyborohydride (53 mg, 0.25 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was evaporated under vacuum to give the crude product. The crude product was purified by Prep-TLC (DCM:MeOH = 10:1) to give the desired product as a white solid (31.8 mg, 0.034 mmol, yield 34%). LC / MS: 924 [M+1] + .
[0654] 1 H NMR (400MHz, DMSO) δ = 11.12 (s, 1H), 9.41 (s, 1H), 8.92 (t, J = 6.2, 1H), 8.39 (s, 1H), 8.04 (dd, J = 14.0, 2.4, 1H), 7 .98 (d, J=8.9Hz, 1H), 7.76 (dd, J=19.5, 8.3Hz, 3H), 7.53 (dd, J=9.2, 3.4Hz, 3H), 7.39-7.33 (m, 2H), 7.20 (dd, J= 9.2, 4.3Hz, 2H), 5.11 (dd, J=13.1, 5.1Hz, 1H), 4.60 (s, 2H), 4.23 (m, 2H), 3.92, (m, 8H), 3.64 (s, 2H), 3.45 (d, J= 10.4, 2H), 3.14-3.22 (m, 3H), 2.84-2.95 (m, 2H), 2.78 (t, J=11.6Hz, 2H), 1.85-2.06 (m, 3H), 1.33-1.47 (m, 2H).
[0655] Example 51: Preparation of (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 51)
[0656]
[0657] A solution of N-[(4-{4-amino-1-[3-fluoro-4-(4-formylpiperidin-1-yl)phenyl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (60 mg, 0.1 mmol), (S)-2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (76 mg, 0.15 mmol), and triethylamine (30 mg, 0.3 mmol) in DCM (5.0 mL) was stirred in air at room temperature. The reaction mixture was stirred at room temperature for 2 hours. Then, sodium triacetoxyborohydride (53 mg, 0.25 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was evaporated under vacuum to give the crude product. The crude product was purified by Prep-TLC (DCM:MeOH = 10:1) to give the desired product as a white solid (29.7 mg, 0.032 mmol, yield 32%). LC / MS: 927 [M+1] + .
[0658] 1 H NMR (400MHz, DMSO) δ = 11.01 (s, 1H), 9.45 (s, 1H), 8.92 (s, 1H), 8.40 (s, 1H), 7. 95-8.20 (m, 2H), 7.74 (d, J=7.2Hz, 2H), 7.53 (m, 3H), 7.46-7.04 (m, 4H), 5.10 (b r, d, J=9.0Hz, 1H), 4.61 (d, J=4.9Hz, 2H), 4.34 (m, 3H), 3.92 (m, 5H), 3.46 (m, 3H) ), 3.15-3.35(m, 6H), 2.85-2.96(m, 2H), 2.70-2.79(m, 3H), 2.11-1.69(m, 6H).
[0659] Example 52: Preparation of (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 52)
[0660]
[0661] Step 1: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0662] To a solution of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (200 mg, 0.42 mmol) in DMF (10 mL) under stirring at room temperature, 6-bromonicaraldehyde (156 mg, 0.84 mmol) and K₂CO₃ (116 mg, 0.84 mmol) were added. The reaction mixture was stirred at 100 °C for 3 hours. The mixture was cooled to room temperature, poured into water (40 mL), and extracted with EA (50 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (100 mg, 41.0%). LC / MS: 581.0 [M+H] + .
[0663] Step 2: Preparation of (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0664] (S)-2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (63 mg, 0.13 mmol) and Et3N (13 mg, 0.13 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Then, N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methyl Oxybenzamide (75 mg, 0.13 mmol), HOAc (155 mg, 2.58 mmol), and NaBH3CN (32 mg, 0.52 mmol). The mixture was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (15 mL × 3). The organic layer was concentrated under vacuum. The residue was purified by prep-HPLC (ACN (15-30%) / water (0.1% FA)) to give the desired product as a white solid (16 mg, 13%). LC / MS: 893 [M+H]+ .
[0665] 1 H NMR (400MHz, DMSO) δ10.98-10.91 (m, 1H), 8.89-8.82 (m, 1H), 8.26-8.25 (m, 1H), 8.07-8.02 (m, 1H), 7.62 (d, J=8.2Hz, 2H), 7.5 5-7.45 (m, 5H), 7.36-7.31 (m, 1H), 7.18 (dd, J=9.1, 4.3Hz, 1H), 7.05 (d, J=8.1Hz, 2H), 6.92 (d, J=8.9Hz, 1H), 5.08-4.96 (m, 2H) , 4.57 (d, J = 6.1Hz, 2H), 4.49-4.46 (m, 2H), 4.33-4.28 (m, 1H), 4.22-4.18 (m, 1H), 3.89 (s, 3H), 3.41-3.39 (m, 2H), 3.29-3.25 ( m, 5H), 3.08 (t, J=12.4Hz, 2H), 2.94-2.85 (m, 1H), 2.62-2.52 (m, 4H), 2.40-2.30 (m, 1H), 2.18-2.06 (m, 2H), 2.10-1.92 (m, 3H).
[0666] Example 53: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 53)
[0667]
[0668] Step 1: Preparation of tert-butyl 4-(toluenesulfonyloxy)piperidine-1-carboxylate
[0669] TsCl (2.27 g, 11.93 mmol) was added to a solution of tert-butyl 4-hydroxypiperidine-1-carboxylate (2 g, 9.94 mmol) in pyridine (20 mL) under stirring at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (80 mL) and extracted with EA (100 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (PE / , EtOAc, = 3:1) to give the desired product (2.2 g, 62%). LC / MS: 377.8 [M + Na] + .
[0670] Step 2: Preparation of tert-butyl 4-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidine-1-carboxylic acid
[0671] Cs₂CO₃ (4.03 g, 12.38 mmol) and N-(4-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (2.43 g, 6.19 mmol) were added to a solution of tert-butyl 4-(toluenesulfonyloxy)piperidine-1-carboxylate (2.2 g, 6.19 mmol) in DMF (2 mL) under stirring at room temperature. The reaction mixture was stirred at 60 °C for 12 h. The mixture was cooled to room temperature, poured into water (75 mL), and extracted with EA (100 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (2.5 g, 70%). LC / MS: 575.8 [M+H] + .
[0672] Step 3: Preparation of N-(4-(4-amino-1-(piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0673] A solution of tert-butyl 4-(4-amino-3-(4-(((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-carboxylate (2.5 g, 4.34 mmol) in TFA / DCM (1:5, 30 mL) was stirred at room temperature for 2 hours. The solution was concentrated under vacuum. The residue was dissolved in DCM (100 mL) and washed with saturated sodium bicarbonate solution (100 mL × 2). The organic layer was dried over Na₂SO₄ and concentrated under vacuum to give the desired product (1.5 g, 72%). LC / MS: 476.0 [M+H] + .
[0674] Step 4: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0675] 4-fluorobenzaldehyde (365 mg, 2.94 mmol) and K₂CO₃ (406 mg, 2.94 mmol) were added to a solution of N-({4-[4-amino-1-(piperidin-4-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (700 mg, 1.47 mmol) in DMF (10 mL) under stirring at room temperature. The reaction mixture was stirred at 100 °C for 3 hours. The mixture was cooled to room temperature, poured into water (40 mL), and extracted with EA (50 mL × 2). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (300 mg, 35%). LC / MS: 580.0 [M+H] + .
[0676] Step 5: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0677] (S)-2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (71 mg, 0.15 mmol) and Et3N (15 mg, 0.15 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Then, N-(4-(4-amino-1-(1-(4-formylphenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (85 mg, 0.15 mmol), HOAc (176 mg, 2.93 mmol), and NaBH3CN (37 mg, 0.59 mmol) were added to DCM (4 mL). The solution was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (3 × 15 mL). The organic layers were combined and concentrated under vacuum. The residue was purified by preparative HPLC [ACN (20-40%) / water (0.1% FA)] to obtain the desired product as a white solid (26 mg, 19%). LC / MS: 892 [M+H] + .
[0678] 1H NMR (400MHz, DMSO) δ10.95 (s, 1H), 8.87 (t, J = 6.3Hz, 1H), 8.26 (s, 1H), 7.64 (d, J = 8.1Hz, 2H), 7.55-7.4 7 (m, 4H), 7.37-7.31 (m, 1H), 7.18 (dd, J = 9.1, 4.3Hz, 3H), 7.10-6.94 (m, 4H), 5.09-5.03 (m, 1H), 4.93-4 .89 (m, 1H), 4.58 (d, J = 6.1Hz, 2H), 4.35-4.10 (m, 2H), 3.95-3.80 (m, 5H), 3.48-3.35 (m, 2H), 3.31-3.19 (m, 3H), 3.15-2.85 (m, 4H), 2.63-2.53 (m, 4H), 2.44-2.34 (m, 2H), 2.47-2.25 (m, 2H), 2.09-1.95 (m, 3H).
[0679] Example 54: Preparation of (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 54)
[0680]
[0681] Step 1: Preparation of tert-butyl 3-(toluenesulfonyloxy)azacyclobutane-1-carboxylate
[0682] A solution of tert-butyl 3-hydroxyazacyclobutane-1-carboxylate (1270 mg, 7.33 mmol), Et3N (1113 mg, 11.00 mmol), and TsCl (1677 mg, 8.80 mmol) in DCM (20 mL) was stirred overnight at room temperature under N2. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL × 3). The organic phase was washed with brine and concentrated under vacuum. The residue was purified by rapid chromatography (PE / EA = 9 / 1) to give the desired product (2.4 g, 100%) as a colorless oil. LC / MS: 328 [M + H] + .
[0683] Step 2: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azacyclobutane-1-carboxylate
[0684] A suspension of tert-butyl 3-(toluenesulfonyloxy)azacyclobutane-1-carboxylate (667 mg, 2.04 mmol), N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (800 mg, 2.04 mmol) and Cs₂CO₃ (1993 mg, 6.12 mmol) in DMF (10 mL) was stirred overnight at 80 °C. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL × 3). The organic layer was washed with brine and concentrated under vacuum. The residue was purified by rapid chromatography (DCM / MeOH = 97 / 3) to give the desired product (200 mg, 17.9%) as a light brown solid. LC / MS: 548 [M+H] + .
[0685] Step 3: Preparation of N-(4-(4-amino-1-(azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0686] A solution of tert-butyl 3-(4-amino-3-(4-(((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azacyclobutane-1-carboxylate (200 mg, 0.36 mmol) in DCM / TFA (8 mL, 3:1) was stirred at room temperature for 1 hour. The solution was concentrated under vacuum to give the desired product as a white solid (198 mg of TFA salt, 100%). LC / MS: 448 [M+H] + .
[0687] Step 4: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0688] K₂CO₃ (151 mg, 1.11 mmol) was added to a solution of N-(4-(4-amino-1-(azacyclobutan-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (TFA salt, 198 mg, 0.36 mmol) and 6-bromonicoraldehyde (136 mg, 0.73 mmol) in DMF (4 mL). The mixture was stirred overnight at 80 °C. The reaction was quenched by adding water (10 mL) and extracted with EA (20 mL × 3). The organic layer was washed with brine and concentrated under vacuum. The residue was purified by rapid chromatography (DCM / MeOH = 75 / 15) to give the desired product (100 mg, 50%) as a yellow solid. LC / MS: 553 [M+H] + .
[0689] Step 5: Preparation of (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0690] (S)-2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(piperazin-1-yl)isoindoline-1,3-dionebenzenesulfonic acid (84 mg, 0.17 mmol) and Et3N (17 mg, 0.17 mmol) were added to MeOH (4 mL). The mixture was stirred at room temperature for 10 minutes. Then, N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (95 mg, 0.17 mmol), HOAc (206 mg, 3.44 mmol), and NaBH3CN (65 mg, 1.03 mmol) were added to DCM (4 mL). The mixture was stirred at room temperature for 2 days. The reaction was quenched by adding water (10 mL) and extracted with EA (15 mL × 3). The organic phase was concentrated under vacuum. The residue was purified by preparative HPLC [ACN (15-25%) / water (0.1% FA)] to give the desired product as a white solid (13.8 mg, 9.3%). LC / MS: 865 [M + H] + .
[0691] 1H NMR (400MHz, DMSO) δ10.95 (s, 1H), 8.87 (t, J=6.1Hz, 1H), 8.28 (s, 1H), 8.03 (s, 1H), 7.66 (d, J=8.1Hz, 2H), 7.5 6-7.47 (m, 5H), 7.37-7.30 (m, 1H), 7.18 (dd, J=9.2, 4.3Hz, 1H), 7.04 (d, J=8.3Hz, 2H), 6.50 (d, J=8.4Hz, 1H), 5. 87 (t, J=7.5Hz, 1H), 5.06-5.02 (m, 1H), 4.57 (d, J=6.1Hz, 2H), 4.55-4.37 (m, 4H), 4.35-4.17 (m, 2H), 3.89 (s, 3H ), 3.42(s, 2H), 3.29-3.05(m, 5H), 2.98-2.89(m, 1H), 2.65-2.55(m, 4H), 2.37-2.33(m, 1H), 1.97-1.95(m, 1H).
[0692] Example 55: Preparation of N-(4-(4-amino-1-(1-(5-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeryl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 55)
[0693]
[0694] Step 1: Preparation of tert-butyl 5-hydroxyvalerate
[0695] NaBH4 (630 mg, 16.74 mmol) was added to a solution of 5-(tert-butoxy)-5-oxopentanoic acid (3.00 g, 6.96 mmol) cooled to 0 °C in anhydrous THF (60 mL). The solution was stirred until H2 release ceased, and then BF3·OEt2 (2.71 g, 19.13 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 4 hours. The reaction was quenched by adding H2O (50 mL) at 0 °C. The mixture was extracted with EA (50 mL × 3). The combined organic layers were washed with saturated Na2CO3 solution and brine, and then concentrated under vacuum to give a colorless, oily crude product (2.50 g, 90.0%). LC / MS: 197.2 [M + Na] + .
[0696] Step 2: Preparation of tert-butyl 5-oxovalerate
[0697] PDC (1.62 g, 4.30 mmol) was added to a solution of tert-butyl 5-hydroxyvalerate (500 mg, 2.87 mmol) in DCM (20 mL) stirred at room temperature under argon atmosphere. The mixture was stirred at room temperature for 4 hours. The mixture was filtered and the filtrate was collected. The filter cake was washed with DCM (20 mL). The combined solutions were concentrated under vacuum. The residue was purified by rapid chromatography (0–65% EA / PE) to give the desired product (200 mg, 40.5%) as a colorless oil. LC / MS: 195.0 [M + Na] + .
[0698] Step 3: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)tert-butyl valerate
[0699] NaBH3CN (66 mg, 1.05 mmol) was added to a solution of tert-butyl 5-oxovalerate (90 mg, 0.52 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidin-2,6-dione (254 mg, 0.52 mmol), and NaOAc (51 mg, 0.63 mmol) in MeOH (10 mL). The reaction mixture was stirred overnight at room temperature. The reaction mixture was partitioned between DCM (50 mL) and water (30 mL). The organic layer was evaporated to give the crude product. The crude product was purified by rapid chromatography (0–10% MeOH / DCM) to give the desired product (200 mg, 79.0% yield). LC / MS: 484.9 [M+H] + .
[0700] Step 4: Preparation of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeric acid
[0701] TFA (1 mL) was added to a solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valerate (200 mg, 0.41 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated under vacuum to give the desired product (170 mg, 96.1% yield) as a pale yellow solid. LC / MS: 428.9 [M+H] + .
[0702] Step 5: Preparation of N-(4-(4-amino-1-(1-(5-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeryl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0703] HOBT (61 mg, 0.45 mmol) and EDCI (87 mg, 0.45 mmol) were added to a solution of (S)-5-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)valeric acid (177 mg, 0.41 mmol), N-(4-(4-amino-1-(pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (191 mg, 0.41 mmol) and DIEA (160 mg, 1.24 mmol) in DMF (10 mL). The reaction mixture was stirred overnight at room temperature. The reaction mixture was partitioned between DCM (50 mL) and water (30 mL). The organic layer was evaporated to give the crude product. The crude product was purified by Prep-HPLC (20–22% ACN / H₂O (0.1% FA)) to obtain the desired product (25 mg, 6.64% yield) as a white solid. LC / MS: 872.6 [M+H] + .
[0704] 1 H NMR (400MHz, DMSO) δ10.95 (s, 1H), 8.87 (t, J=5.9Hz, 1H), 8.87-8.26 (m, 1H), 7.63 (dd, J=7.3, 5.3Hz, 2H), 7.55-7.48 (m, 4H), 7.3 4 (td, J=8.7, 3.5Hz, 1H), 7.18 (dd, J=9.1, 4.3Hz, 1H), 7.02 (dd, J=10.7, 7.8Hz, 2H), 5.55-5.39 (m, 1H), 5.10-4.95 (m, 1H), 4.58 ( d, J=6.0Hz, 2H), 4.32 (d, J=15.9Hz, 1H), 4.19 (d, J=16.9Hz, 1H), 4.07-3.87 (m, 4H), 3.87-3.56 (m, 3H), 3.54-3.41 (m, 1H), 3.26- 3.18(m, 4H), 2.95-2.85(m, 1H), 2.60-2.52(m, 1H), 2.48-2.41(m, 4H), 2.39-2.23(m, 6H), 2.00-1.91(m, 1H), 1.59-1.42(m, 4H).
[0705] Example 56: Preparation of N-(4-(4-amino-1-(1-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-3-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 58)
[0706]
[0707] Step 1: Preparation of tert-butyl 3-(toluenesulfonyloxy)pyrrolidine-1-carboxylate
[0708] TsCl (6.1 g, 31.9 mmol) was added to a solution of tert-butyl (3-hydroxypyrrolidone-1-yl)carboxylate (5 g, 26.6 mmol) in pyridine (50 mL) at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with DCM (100 mL) and then washed with water and brine. The organic phase was dried over Na₂SO₄ and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (PE / EA = 3:1) to give the desired product (8 g, 87.9%) as a white solid. LC / MS: 364.0 [M + Na] + .
[0709] Step 2: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)pyrrolidine-1-carboxylate
[0710] N-[(4-{[(4-methylbenzene)sulfonyl]oxy}pyrrolidine-1-yl)carboxylate tert-butyl (2 g, 5.84 mmol) and Cs₂CO₃ (3.8 g, 11.68 mmol) were added to a solution of (3-{[(4-methylbenzene)sulfonyl]oxy}pyrrolidine-1-yl)carboxylate (2 g, 5.84 mmol) in DMF (20 mL) under stirring at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was poured into water (80 mL) and extracted with EA (100 mL x 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄ and concentrated under vacuum to give a crude product. The crude product was purified by rapid chromatography (10% MeOH / DCM) to give the desired product (2.3 g, 70.0%) as a yellow solid. LC / MS: 562.0 [M+H] + .
[0711] Step 3: Preparation of N-(4-(4-amino-1-(pyrrolidone-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0712] A solution of tert-butyl 3-(4-amino-3-(4-(((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)pyrrolidine-1-carboxylate (2.3 g, 4.09 mmol) in TFA / DCM (24 mL, 5:1) was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum. The residue was dissolved in saturated sodium bicarbonate solution (100 mL) and then extracted with DCM (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum to give the desired product (1.2 g, 63.6%) as a brown solid. LC / MS: 462.0 [M+H] + .
[0713] Step 4: Preparation of 5-bromo-2-(dimethoxymethyl)pyridine
[0714] Trimethoxymethane (1.71 g, 16.13 mmol) and TsOH (278 mg, 1.61 mmol) were added to a solution of 5-bromopyridine-2-carboxaldehyde (1 g, 5.37 mmol) in MeOH (10 mL) under stirring at room temperature. The reaction mixture was stirred at 70 °C for 2 hours. The mixture was concentrated under vacuum to give a crude product. The crude product was purified by rapid chromatography (PE / EA = 10:1) to give the desired product (600 mg, 48.1%). LC / MS: 232.0 [M+H] + .
[0715] Step 5: Preparation of N-(4-(4-amino-1-(1-(6-(dimethoxymethyl)pyridin-3-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0716] 5-Bromo-2-(dimethoxymethyl)pyridine (123 mg, 0.53 mmol), BINAP (130 mg, 0.21 mmol), t-BuONa (67 mg, 0.7 mmol), and Pd2(dba)3 (96 mg, 0.105 mmol) were added to a solution of N-({4-[4-amino-1-(pyrrolidone-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (160 mg, 0.35 mmol) in toluene (10 mL) stirred at room temperature under Ar conditions. The reaction mixture was stirred at 80 °C for 12 hours. The mixture was concentrated under vacuum to give a crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (60 mg, 28.2%). LC / MS: 635.0 [M+H] + .
[0717] Step 6: Preparation of N-(4-(4-amino-1-(1-(6-formylpyridin-3-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0718] HCl (0.2 mL) was added to a solution of N-{[4-(4-amino-1-{1-[5-(dimethoxymethyl)pyridin-2-yl]piperidin-4-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (55 mg, 0.09 mmol) in THF (5 mL) under stirring at room temperature. The reaction mixture was stirred at 50 °C for 12 hours. The mixture was poured into H₂O (20 mL), the pH was adjusted to 7–8 with saturated sodium bicarbonate solution, and then extracted with EA (20 mL × 3). The combined organic layers were washed with brine (50 mL), dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (21 mg, 41.1%). LC / MS: 566.9 [M+H] + .
[0719] Step 7: Preparation of N-(4-(4-amino-1-(1-(6-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-3-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0720] TEA (7.5 mg, 0.04 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (21.66 mg, 0.04 mmol), and NaBH3CN (6.99 mg, 0.11 mmol) were added to a solution of N-(4-(4-amino-1-(1-(6-formylpyridin-3-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (21 mg, 0.03 mmol) in MeOH / DMF / HOAc (5 mL, 2:1:0.02). The mixture was stirred at 60 °C for 1 hour. The reaction was quenched by adding water (5 mL) and extracted with DCM (10 mL × 2). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by prep-HPLC (ACN / H₂O (0.1% FA), 10-40%) to give the desired compound (3 mg, 9.2%). LC / MS: 879.6 [M+H] + .
[0721] 1 H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.87 (t, J=6.3Hz, 1H), 8.39-8.27 (m, 2H), 7.91 (s, 1H), 7.62 (d, J=8.0Hz, 2H), 7.4 9 (t, J=9.8Hz, 3H), 7.37,-7.31 (m, 1H), 7.27-7.14 (m, 2H), 7.11-6.93 (m, 3H), 5.68-5.60 (m, 1H), 5.04 (dd, J=13.1, 5. 1Hz, 1H), 4.57 (d, J = 6.2Hz, 2H), 4.32 (d, J = 17.4Hz, 1H), 4.19, (d, J = 17.2Hz, 1H), 3.94-3.82 (m, 4H), 3.69-3.64 (m, 2H ), 3.53-3.50(m, 4H), 3.29-3.25(m, 3H), 2.94-2.86(m, 1H), 2.68-2.52(m, 6H), 2.42-2.28(m, 2H), 1.99-1.90(m, 1H).
[0722] Example 57: Preparation of (S)-N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 59)
[0723]
[0724] Step 1: Preparation of (1-(5-iodopyridin-2-yl)piperidin-4-yl)methanol
[0725] Potassium carbonate (3.7 g, 27.0 mmol) was added to a solution of 2-fluoro-5-iodopyridine (2 g, 9.0 mmol) and piperidin-4-ylmethanol (1.2 g, 10.8 mmol) in DMF (50 mL) under nitrogen atmosphere and stirred at 25 °C. The reaction mixture was stirred at 100 °C for 2 hours. The reaction mixture was evaporated under vacuum to give a crude product, which was purified by silica gel column chromatography (PE:EA = 10:1–1:1) to give the desired product (2 g, 69.8%) as a white solid. LC / MS: 319.0 [M+1] + .
[0726] Step 2: Preparation of 1-(5-iodopyridin-2-yl)piperidine-4-carboxaldehyde
[0727] To a solution of [1-(5-iodopyridin-2-yl)piperidin-4-yl]methanol (1 g, 3.1 mmol) in DCM (50 mL) under nitrogen at 25 °C, DISSI-Martin periodane (2.0 g, 4.6 mmol) was added fractionally. The reaction mixture was stirred at 25 °C for 1 hour. The reaction mixture was quenched with Na₂S₂O₃ (2 M), extracted with DCM (200 mL), dried over sodium sulfate, and evaporated under vacuum to give a crude product. The crude product was purified by silica gel column chromatography (PE:EA = 10:1–1:1) to give the desired product (0.7 g, 70.9%) as a white solid. LC / MS: 317.0 [M+1] + .
[0728] Step 3: Preparation of 2-(4-(dimethoxymethyl)piperidin-1-yl)-5-iodopyridine
[0729] TsOH (40 mg, 0.2 mmol) was added to a solution of 1-(5-iodopyridin-2-yl)piperidine-4-carboxaldehyde (700 mg, 2.2 mmol) in trimethoxymethane (15 mL) under nitrogen atmosphere and stirred at 25 °C. The reaction mixture was stirred at 100 °C for 2 hours. The reaction mixture was evaporated under vacuum to give a crude product. The crude product was purified by silica gel column chromatography (PE:EA = 10:1–1:1) to give the desired product (0.6 g, 75.2%) as a white solid. LC / MS: 362.9 [M+1] + .
[0730] Step 4: Preparation of N-(4-(4-amino-1-(6-(4-(dimethoxymethyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0731] 2-[4-(dimethoxymethyl)piperidin-1-yl]-5-iodopyridine (100 mg, 0.3 mmol), N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (108.3 mg, 0.3 mmol) and N... were stirred under nitrogen at 25 °C. 1 N 1 Dimethylcyclohexane-1,2-diamine (39.3 mg, 0.3 mmol) was added to a solution of cuprous iodide (I) (52.6 mg, 0.3 mmol) and cesium carbonate (269.8 mg, 0.8 mmol) in 10 mL of DMF. The reaction mixture was stirred at 110 °C for 12 hours. The reaction mixture was filtered and evaporated under vacuum to give a crude product. The crude product was purified by silica gel column chromatography (DCM:MeOH = 100:1–10:1) to give the desired product (20 mg, 11.5%) as a yellow solid. LC / MS: 627.0 [M+1] + .
[0732] Step 5: Preparation of N-(4-(4-amino-1-(6-(4-formylpiperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0733] A solution of N-{[4-(4-amino-1-{6-[4-(dimethoxymethyl)piperidin-1-yl]pyridin-3-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (15 mg, 0.023 mmol) in THF / H₂SO₄(2N) (5 mL, 1:1) was stirred at 70 °C for 1 hour. The mixture was diluted with EA (100 mL), neutralized with NaOH (2 M), dried over sodium sulfate, and evaporated under vacuum to give the desired product (10 mg, 71.9%) as a yellow solid. LC / MS: 581.0 [M+1] + .
[0734] Step 6: Preparation of (S)-N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0735] Triethylamine (13.05 mg, 0.13 mmol) and NaBH3CN (8.11 mg, 0.13 mmol) were added to a solution of N-[(4-{4-amino-1-[6-(4-formylpiperidin-1-yl)pyridin-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (15 mg, 0.025 mmol), (3S)-3-[1-oxo-5-(piperazin-1-yl)-3H-isoindol-2-yl]piperidin-2,6-dione (8.47 mg, 0.025 mmol), and acetic acid (62 mg, 0.52 mmol) in CH3OH / DMF (2 mL, 1:1). The reaction mixture was stirred at 60 °C for 1 hour. The reaction mixture was then concentrated under vacuum. The residue was dissolved in EA (50 mL) and washed with water (10 mL × 2). The organic phase was dried over sodium sulfate and evaporated under vacuum to give the crude product. The crude product was purified by prep-HPLC to give the desired product (5 mg, 21.7%) as a white solid. LC / MS: 893.0 [M+1] + .
[0736] 1 H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.90 (t, J=6.1Hz, 1H), 8.72 (d, J=2.5Hz, 1H), 8.32 (s, 1H), 8.24 (s, 1H), 8.12 (d, J =9.2Hz, 1H), 7.73 (d, J = 8.1, Hz, 2H), 7.58-7.48 (m, 3H), 7.40-7.32 (m, 1H), 7.23-7.17 (m, 1H), 7.08-6.96, (m, 3H), 6. 61-6.49 (m, 3H), 5.15-5.01 (m, 1H), 4.60 (d, J=6.1Hz, 2H), 4.44-4.28 (m, 3H), 3.91 (s, 3H), 3.29-3.24 (m, 7H), 3.00-2 .82 (m, 3H), 2.74-2.59 (m, 2H), 2.44-2.31 (m, 2H), 2.29-2.17 (d, J=6.6Hz, 2H), 2.02-1.73 (m, 4H), 1.34-1.05 (m, 2H).
[0737] Example 58: Preparation of N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 60)
[0738]
[0739] Step 1: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0740] 4-fluorobenzaldehyde (121 mg, 0.98 mmol) and K₂CO₃ (180 mg, 1.3 mmol) were added to a solution of N-({4-[4-amino-1-(pyrrolidone-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (300 mg, 0.65 mmol) in DMSO (5 mL) under stirring at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was poured into water (100 mL) and extracted with EA (100 mL × 2). The combined organic layers were washed with water and brine, dried over Na₂SO₄, and then concentrated under vacuum to give the crude product. The crude product was purified by rapid chromatography (DCM / MeOH = 10:1) to give the desired product (100 mg, 27.2%). LC / MS: 566.0 [M+H] + .
[0741] Step 2: Preparation of N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0742] Add (S)-3-(1-oxo-5-(piperazin-1-yl)pyrrolidine-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (100 mg, 0.18 mmol) to a solution of N-[(4-{4-amino-1-[1-(4-formylphenyl)pyrrolidine-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (100 mg, 0.18 mmol) in MeOH / DMF / HOAc (12 mL, 2:1:0.06) (86 mg, 0.18 mmol), Et3N (36 mg, 0.36 mmol), and NaBH3CN (45 mg, 0.72 mmol) to the solution of N-[(4-{4-amino-1-[1-(4-formylphenyl)pyrrolidine-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl]methyl]-2-(4-dione) (86 mg, 0.18 mmol), Et3N (36 mg, 0.36 mmol), and NaBH3CN (45 mg, 0.72 mmol) to the solution of N-[(4-{4-amino-1-[1-(4-formylphenyl)pyrrolidine-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl]methyl]methyl[4-dione](100 mL × 2)to ... The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum to obtain the crude product. The crude product was purified by prep-HPLC to obtain the desired product (19 mg, 12.2%). LC / MS: 900.0 [M + Na] + .
[0743] 1 H NMR (400MHz, DMSO) δ = 10.95 (s, 1H), 8.86 (t, J = 6.0Hz 1H), 8.30 (s, 1H), 8.28 (s, 1H), 7.63 (d, J=8.0Hz, 2H), 7.52-7.47 (m, 5H), 7.36-7.31 (m, 1H), 7.18 (dd, J=9.2, 4.4Hz, 1H), 7.12 (d, J=8.4Hz, 2H), 7.06-7.01 (m, 2H), 6.56 (d, J=8.4Hz, 2H), 5.65-5.60 (m, 1H), 5.04 (dd, J=13.2, 5.2Hz, 1H), 4.57, (d , J=6.0Hz, 2H), 4.32 (d, J=16.8Hz, 1H), 4.19 (d, J=16.8Hz, 1H), 3.89 (s, 3H), 3.84-3.79 (m, 1H), 3.66-3.60 (m, 2H), 3.48- 3.39 (m, 2H), 3.30-3.20 (m, 5H), 2.95-2.83 (m, 2H), 2.64-2.59 (m, 2H), 2.57-2.54 (m, 2H), 2.47 (s, 3H), 1.96-1.90 (m, 1H).
[0744] Example 59: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 61)
[0745]
[0746] Step 1: Preparation of N-(4-(4-amino-1-(1-(4-formylphenyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0747] A mixture of N-(4-(4-amino-1-(azacyclobutan-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (60 mg, 0.13 mmol), 4-fluorobenzaldehyde (25 mg, 0.20 mmol), and K₂CO₃ (56 mg, 0.41 mmol) in DMSO (5 mL) was stirred overnight at 80 °C. The reaction mixture was poured into water (5 mL) and extracted with EA (10 mL × 3). The combined organic layers were washed with water, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by Pre-TLC with DCM / MeOH = 10:1 to give the desired product (20 mg, 80% purity, 21.6% yield). LC / MS: 552.7 [M+H] + .
[0748] Step 2: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0749] To a solution of N-(4-(4-amino-1-(1-(4-formylphenyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (20 mg, 80% purity, 0.029 mmol) in MeOH / , DMF (2:1, 3 mL) under stirring at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidine-2,6-dione (22 mg, 0.045 mmol) and Et3N (7 mg, 0.069 mmol) were added. The mixture was stirred at room temperature for 30 min, and then AcOH (0.1 mL) and NaBH3CN (4 mg, 0.064 mmol) were added. The reaction mixture was stirred at 60 °C for 1 h. The mixture was then concentrated under vacuum. The residue was poured into water (4 mL) and extracted with EA (8 mL × 3). The combined organic layers were washed with brine (10 mL), dried over Na₂SO₄, and concentrated under vacuum to obtain the crude product. The crude product was purified by prep-HPLC to obtain the desired product (8 mg, 31.9%). LC / MS: 864 [M + H] + .
[0750] 1H NMR (400MHz, DMSO) δ10.95 (s, 1H), 8.86 (t, J=6.1Hz, 1H), 8.33-8.20 (m, 2H), 7.65 (d, J=8.1Hz, 2H), 7. 53-7.48 (m, 3H), 7.37-7.31 (m, 1H), 7.24-7.11 (m, 3H), 7.08-6.98 (m, 2H), 6.52 (d, J=8.5Hz, 2H), 5.88 -5.81(m,1H),5.05-5.02(m,1H),4.57(d,J=6.0Hz,2H),4.42-4.16(m,6H),3.89(s,3H),3.42-3.36(m , 4H), 3.28-3.25(m, 5H), 2.97-2.83(m, 2H), 2.69-2.54(m, 2H), 2.41-2.31(m, 2H), 1.98-1.92(m, 1H).
[0751] Example 60: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 62)
[0752]
[0753] Step 1: Preparation of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)tert-butyl benzoate
[0754] TEA (41.51 mg, 0.4 mmol) was added to a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidine-2,6-dione (100 mg, 0.2 mmol) in DMF (10 mL). The mixture was stirred at room temperature under nitrogen for 5 min. Then, tert-butyl 4-formylbenzoate (42.38 mg, 0.2 mmol) and NaBH3CN (38.74 mg, 0.61 mmol) were added. The reaction mixture was stirred at 60 °C for 1 h. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated under vacuum and the residue was purified by rapid column chromatography with DCM:MeOH = 10:1 to provide the desired product (100 mg, 90% purity, 86.7% yield) as a yellow solid. LC / MS: 519.1 [M+H] + .
[0755] Step 2: Preparation of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoic acid
[0756] A solution of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoate tert-butyl ester (100 mg, 90% purity, 0.17 mmol) in DCM (3 mL) and TFA (1 mL) was stirred at room temperature for 2 hours. The mixture was concentrated to give the title compound (70 mg, 80% purity, 69.5% yield) as a yellow oil. LC / MS: 462.8 [M+H] + .
[0757] Step 3: Preparation of tert-butyl 3-(4-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azacyclobutane-1-carboxylate
[0758] To a solution of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (500 mg, 1.27 mmol) in DMF (10 mL), tert-butyl 3-(toluenesulfonyloxy)azacyclobutane-1-carboxylate (502 mg, 1.52 mmol) and Cs₂CO₃ (1.24 g, 3.82 mmol) were added. The reaction mixture was stirred at 80 °C for 16 h. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL × 2). The organic phase was washed with brine and dried over Na₂SO₄. The solution was concentrated under vacuum, and the residue was purified by rapid column chromatography with DCM:MeOH = 10:1 to give the desired product (230 mg, 90% purity, 29.7%) as a yellow oil. LC / MS: 547.8 [M+H] + .
[0759] Step 4: Preparation of N-(4-(4-amino-1-(azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0760] A solution of tert-butyl 3-(4-amino-3-(4-(((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)azacyclobutane-1-carboxylate (230 mg, 90% purity, 0.4 mmol) in DCM (8 mL) and TFA (2 mL) was stirred at room temperature for 2 hours. The solvent was removed under vacuum, and the solution was then dissolved in DCM (20 mL). The mixture was adjusted to pH approximately 10 with saturated Na₂CO₃ solution. The organic phase was concentrated under vacuum to give the title compound (100 mg, 60.3%) as a yellow solid. LC / MS: 448.1, [M+H] + .
[0761] Step 5: Preparation of (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0762] To a solution of 4-[(4-{2-[(3S)-2,6-dioxopiperidin-3-yl]-1-oxo-3H-isoindol-5-yl}piperazin-1-yl)methyl]benzoic acid (44 mg, 80% purity, 0.07 mmol) in THF (5 mL), N-({4-[4-amino-1-(azacyclobutane-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (33.9 mg, 0.07 mmol), 1-hydroxybenzotriazole (15.3 mg, 0.11 mmol), EDCI (21.8 mg, 0.11 mmol), and TEA (22.9 mg, 0.22 mmol) were added. The mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (15 mL) and extracted with DCM (10 mL × 3). The organic phase was washed with brine and dried over Na₂SO₄. The solution was concentrated under vacuum and the residue was purified by prep-HPLC (ACN / H₂O (0.1% FA), 10-40%) to give the desired compound as a white solid (10 mg, 14.3%). LC / MS: 892.6 [M+H] + .
[0763] 1 H NMR (400MHz,) δ10.95 (s, 1H), 8.88 (t, J = 6.0Hz, 1H), 8.27 (s, 1H), 7.68-7.64 (m, 4H), 7.51-7.47 (m, 4H), 7.45-7.40 (m, 2H), 7.34 (td, J=8.5, 3.3Hz, 1H), 7.19 (dd, J=9.1, 4.3Hz, 1H), 7.05 (d, J=8.1Hz, 2H), 5.80-5.71 (m, 1H), 5.05 (d d, J=13.2, 5.0Hz, 1H), 4.93-4.72 (m, 2H), 4.66-4.49 (m, 4H), 4.32 (d, J=16.9Hz, 1H), 4.20 (d, J=16.9Hz, 1H), 3.90 ( s, 3H), 3.59 (s, 2H), 3.32-3.25 (m, 4H), 2.96-2.84 (m, 1H), 2.68-2.56 (m, 4H), 2.44-2.29 (m, 2H), 1.99-1.91 (m, 1H).
[0764] Example 61: Preparation of (N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 63)
[0765]
[0766] Step 1: Preparation of (N-(4-(4-amino-1-(1-(4-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0767] To a solution of (S)-4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)benzoic acid (44 mg, 80% purity, 0.07 mmol) in THF (5 mL), N-(4-(4-amino-1-(pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (34.9 mg, 0.07 mmol), 1-hydroxybenzotriazole (15.3 mg, 0.11 mmol), EDCI (21.8 mg, 0.11 mmol), and TEA (22.9 mg, 0.22 mmol) were added. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched by adding water (10 mL) and extracted with DCM (10 mL × 2). The organic phase was washed with brine and dried over Na₂SO₄. The solution was concentrated under vacuum and the residue was purified by prep-HPLC (ACN / H₂O (0.1% FA), 10-40%) to give the desired compound (4 mg, 6.3%). LC / MS: 906.5 [M+H] + .
[0768] 1H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.94-8.86 (m, 1H), 8.25-8.12, (m, 1H), 7.75-7.28 (m, 11H), 7.25-7.15 (m , 1H), 7.10-6.97 (m, 2H), 5.62-5.35, (m, 1H), 5.05 (d, J = 8.7Hz, 1H), 4.59 (d, J = 5.6Hz, 2H), 4.32 (d, J = 16.2Hz , 1H), 4.19 (d, J = 15.3Hz, 1H), 4.06-3.72 (m, 6H), 3.67 (d, J = 6.4Hz, 1H), 3.55, (d, J = 16.0Hz, 2H), 3.32-3.18 (m, 4H), 2.90 (t, J=12.8Hz, 1H), 2.69-2.53 (m, 4H), 2.48-2.43 (m, 2H), 2.41-2.28 (m, 2H), 2.02-1.86 (m, 1H).
[0769] Example 62: Preparation of N-(4-(4-amino-1-(1-(6-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)hexanoyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 64)
[0770]
[0771] Step 1: Preparation of (S)-6-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)hexanoic acid
[0772] A suspension of 6-bromohexanoic acid (100 mg, 0.51 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindolin-2-yl)piperidin-2,6-dione (168.3 mg, 0.51 mmol), K₂CO₃ (212.3 mg, 1.54 mmol), and KI (85.1 mg, 0.51 mmol) in DMF (3 mL) was stirred overnight at room temperature. The reaction mixture was concentrated under vacuum. The residue was dissolved in EA (50 mL), washed with water (10 mL), dried over Na₂SO₄, and evaporated under vacuum to give the crude product. The crude product was purified by rapid column chromatography (DCM / MeOH = 10:1) to give the desired product (50 mg, purity = 90%, yield = 19.8%) as a white solid. LC / MS: 442.9 [M+H] + .
[0773] Step 2: Preparation of N-(4-(4-amino-1-(1-(6-(4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)hexanoyl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0774] A solution of (S)-6-(4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)hexanoic acid 50 mg, purity = 90%), N-(4-(4-amino-1-(pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (69.9 mg, 0.15 mmol), HATU (86.4 mg, 0.23 mmol), and DIEA (58.7 mg, 0.45 mmol) in DMF (5 mL) was stirred at room temperature for 4 hours. The reaction mixture was concentrated under vacuum. The residue was dissolved in EA (50 mL), washed with water (10 mL), dried over Na2SO4, and evaporated under vacuum to give the crude product. The crude product was purified by Prep-TLC (DCM / MeOH = 10:1) to obtain the desired product (8 mg, 12.5%) as a white solid. LC / MS: 886.1 [M+H] + .
[0775] 1H NMR (400MHz, DMSO) δ10.92 (s, 1H), 8.84 (t, J = 6.0Hz, 1H), 8.24, (d, J = 3.8Hz, 1H), 7.60 (d, J = 8.1Hz, 2H), 7.52 -7.45(m, 4H), 7.33-7.28(m, 1H), 7.17-7.14(m, 1H), 7.10-7.02(m, 2H), 5.51-5.34(m, 1H), 5.06-4.97(m, 1H) , 4.54 (d, J=6.1Hz, 2H), 4.33-4.15 (m, 2H), 4.05-3.57 (m, 8H), 3.50-3.41, (m, 1H), 3.24-3.05 (m, 2H), 2.93-2 .78 (m, 2H), 2.60-2.48 (m, 3H), 2.45-2.14, (m, 9H), 1.96-1.88 (m, 1H), 1.56-1.44 (m, 4H), 1.33-1.17 (m, 3H).
[0776] Example 63: Preparation of N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 65)
[0777]
[0778] Step 1: Preparation of (1-(2-fluoro-4-nitrophenyl)pyrrolidine-3-yl)methanol
[0779] To a solution of 1,2-difluoro-4-nitrobenzene (2 g, 12.57 mmol) in CH3CN (5 mL), pyrrolidine-3-ylmethanol (1.9 g, 13.83 mmol) and DIEA (4.9 g, 37.71 mmol) were added. The reaction mixture was stirred at 80 °C for 3 hours. The solvent was removed under vacuum. The residue was purified by rapid column chromatography using PE:EA = 1:1 to give the desired product (1.8 g, 59.6%) as a yellow solid. LC / MS: 241.1 [M+H] + .
[0780] Step 2: Preparation of (1-(4-amino-2-fluorophenyl)pyrrolidine-3-yl)methanol
[0781] Pd / C (180 mg, 10%) was added to a solution of (1.8 g, 7.49 mmol) in MeOH (20 mL). The reaction mixture was stirred at room temperature for 2 hours under 1 atm H₂. The catalyst was filtered off. The solution was concentrated under vacuum to give the desired product (1.3 g, 82.5%) as a brown oil. LC / MS: 211.1 [M+H] + .
[0782] Step 3: Preparation of (1-(2-fluoro-4-iodophenyl)pyrrolidine-3-yl)methanol
[0783] 1.9 mL of concentrated HCl (1.9 mL) and NaNO2 (630 mg, 9.13 mmol, dissolved in 8 mL H2O) were added to a solution of (1-(4-amino-2-fluorophenyl)pyrrolidine-3-yl)methanol (1.3 g, 6.1 mmol) in CH3CN (30 mL) at 0 °C. The mixture was stirred at 0 °C for 2 h, and then KI (3.16 g, 19.03 mmol) was added. The reaction mixture was stirred at room temperature for 17 h. The reaction was quenched by adding water (20 mL) and extracted with EA (20 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum. The residue was purified by rapid column chromatography using PE:EA = 3:1 to give the desired product (1.5 g, 75.5%) as a yellow solid. LC / MS: 321.9 [M+H] + .
[0784] Step 4: Preparation of 1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carboxaldehyde
[0785] DMSO (1.46 g, 18.68 mmol) was added to a solution of oxaloyl chloride (1.19 g, 9.34 mmol) in DCM (20 mL) at -78 °C. The reaction mixture was stirred at -78 °C for 15 min, and then (1.5 g, 4.67 mmol) methanol (1.5 g, 4.67 mmol) was added. The reaction mixture was stirred at -78 °C for another 15 min. TEA (1.9 g, 18.68 mmol) was added at -78 °C. The final mixture was stirred at -78 °C for 30 min. The reaction mixture was brought to room temperature and stirred for 1 h. The reaction was quenched by adding water (20 mL) and extracted with DCM (20 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum. The residue was purified by rapid column chromatography using PE:EA = 1:1 to give the desired product (1.2 g, 80.5%) as a yellow solid. LC / MS: 319.8 [M+H] + .
[0786] Step 5: Preparation of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine
[0787] Trimethoxymethane (600 mg, 5.46 mmol) and PTSA (97 mg, 1.36 mmol) were added to a solution of 1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carboxaldehyde (1.2 g, 3.76 mmol) in MeOH (20 mL). The reaction mixture was stirred at 60 °C for 12 h. The solvent was removed under vacuum. The residue was dissolved in EA (20 mL), washed with NaHCO3 solution, and dried over Na2SO4. The organic phase was concentrated and purified by rapid column chromatography (PE:EA = 1:1) to give the desired product (720 mg, 41.9%) as a yellow solid. LC / MS: 365.8 [M+H] + .
[0788] Step 6: Preparation of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0789] To a solution of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine (200 mg, 0.55 mmol) in 1,4-dioxane (5 mL), N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (429 mg, 1.09 mmol), Cs₂CO₃ (535 mg, 1.64 mmol), trans-N,N'-dimethylcyclohexane-1,2-diamine (156 mg, 1.09 mmol), and CuI (104 mg, 0.55 mmol) were added. The reaction mixture was stirred at 100 °C for 17 hours under Ar conditions. The solid was filtered off, and the solution was concentrated under vacuum. The residue was purified by pre-TLC with DCM:MeOH = 10:1 to give the desired product as a white solid (100 mg, 60% purity, 17.3% yield). LC / MS: 629.9 [M+H] + .
[0790] Step 7: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidine-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0791] H₂SO₄ (4 mL, 3 M in water) was added to a solution of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (80 mg, 60% purity, 0.076 mmol) in THF (2 mL). The reaction mixture was stirred at 70 °C for 2 hours. The reaction mixture was cooled to 0 °C, neutralized with NaHCO₃ solution, and extracted with EA (10 mL, x, 3). The organic phase was washed with brine and dried over Na₂SO₄. The solution was concentrated under vacuum to give the desired product (40 mg, crude) as a yellow solid. LC / MS: 584.2 [M+H] + .
[0792] Step 8: Preparation of N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0793] TEA (0.2 mL) was added to a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione benzenesulfonic acid (11.26 mg, 0.034 mmol) in DMF (1 mL) and MeOH (1 mL). The mixture was stirred at room temperature for 30 min. Then N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidine-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (40 mg, crude), HOAc (0.5 mL), and NaBH3CN (21.55 mg, 0.343 mmol) were added. The reaction mixture was stirred at room temperature for 1 h. The reaction was quenched by adding H2O (10 mL) and extracted with EA (5 mL × 3). The combined organic phases were washed with brine and dried over Na₂SO₄. The solution was concentrated under vacuum, and the residue was purified by pre-TLC using DCM:MeOH = 10:1 to give the desired product (6.9 mg, 10.1% in two steps) as a white solid. LC / MS: 896.5 [M+H] + .
[0794] 1H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.90 (t, J = 6Hz, 1H), 8.35 (s, 1H), 7.93 (d, J = 15.3Hz, 1H), 7.83 (d, J = 8.8Hz, 1H), 7.73 (d, J = 8.1Hz , 2H), 7.56-7.50 (m, 3H), 7.38-7.31 (m, 1H), 7.23-7.16 (m, 1H), 7.12-7.04 (m, 2H), 6.88 (t, J=9.5Hz, 1H), 5.05 (dd, J=13.3, 5.0Hz, 1 H), 4.60 (d, J = 6.0Hz, 2H), 4.36-4.17 (m, 2H), 3.91 (s, 2H), 3.57-3.49 (m, 1H), 3.48-3.40 (m, 2H), 3.31 (s, 3H), 3.22-3.15 (m, 1H), 2. 93-2.83 (m, 1H), 2.66-2.53 (m, 4H), 2.45-2.30 (m, 3H), 2.13-1.90 (m, 3H), 1.73-1.66 (m, 1H), 1.50-1.40 (m, 1H), 1.27-1.17 (m, 5H).
[0795] Example 64: Preparation of N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 66)
[0796]
[0797] Step 1: Preparation of (1-(5-iodopyridin-2-yl)pyrrolidine-3-yl)methanol
[0798] To a solution of 2-fluoro-5-iodopyridine (2 g, 9 mmol) in DMF (20 mL), pyrrolidine-3-ylmethanol (1.09 g, 10.8 mmol) and potassium carbonate (3.73 g, 2.7 mmol) were added. The reaction mixture was stirred at 100 °C for 2 h. The reaction was quenched by adding water (50 mL) and extracted with EA (50 mL × 3). The organic phase was washed with brine and dried over Na₂SO₄. The solvent was removed under vacuum and the residue was purified by rapid column chromatography using PE:EA = 5:1 to provide the desired product (2 g, 73.0%) as a yellow solid. LC / MS: 304.9 [M+H] + .
[0799] Step 2: Preparation of 1-(5-iodopyridin-2-yl)pyrrolidine-3-carboxaldehyde
[0800] Added fractionally to a solution of [1-(5-iodopyridin-2-yl)pyrrolidine-3-yl]methanol (2 g, 6.6 mmol) in DCM (30 mL) under nitrogen at 0 °C, 4.2 g, 9.9 mmol of DISSYS-Martin periodane was added. The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched by adding water (10 mL). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum to give the title compound (1.5 g, 75.7% yield) as a yellow solid. LC / MS: 302.9 [M+H] + .
[0801] Step 3: Preparation of 2-(3-(dimethoxymethyl)pyrrolidone-1-yl)-5-iodopyridine
[0802] TsOH (90 mg, 0.5 mmol) was added to a solution of 1-(5-iodopyridin-2-yl)pyrrolidine-3-carboxaldehyde (1.5 g, 5.0 mmol) in trimethoxymethane (20 mL) under nitrogen and stirred at 25 °C. The reaction mixture was stirred at 100 °C for 2 hours. The reaction mixture was concentrated under vacuum and the residue was purified by rapid column chromatography with PE:EA = 5:1 to give the desired product (500 mg, 28.0%) as a yellow solid. LC / MS: 348.9 [M+H] + .
[0803] Step 4: Preparation of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidone-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0804] Add N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (135 mg, 0.34 mmol), Cs₂CO₃ (336.8 mg, 1.03 mmol), cuprous iodide (I) (65.3 mg, 0.34 mmol), and N to a solution of 2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine (120 mg, 0.34 mmol) in DMF (20 mL). 1 N 1-Dimethylcyclohexane-1,2-diamine (49.02 mg, 0.34 mmol). The reaction mixture was stirred at 110 °C for 10 hours. The solid was filtered off and washed with DCM (10 mL × 3). The solution was concentrated under vacuum and the residue was purified by rapid column chromatography with DCM:MeOH = 1:0 to 10:1 to provide the desired product (20 mg, 9.4%). LC / MS: 613.0 [M + H] + .
[0805] Step 5: Preparation of N-(4-(4-amino-1-(6-(3-formylpyrrolidone-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0806] A solution of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (15 mg, 0.025 mmol) in H₂SO₄ / , H₂O / THF (1 mL, 1 / 3 / 2) was stirred at 70 °C for 1 hour under nitrogen. The mixture was diluted with EA (50 mL) and neutralized with NaOH (2N). The organic phase was dried over Na₂SO₄. The solvent was removed under vacuum to give the title compound (12 mg, 86.5%) as a yellow solid. LC / MS: 567.0 [M+H] + .
[0807] Step 6: Preparation of N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0808] To a solution of N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (12 mg, 0.02 mmol) in MeOH / DMF / HOAc (2 mL, 2:1:0.02), 2-(2,6-dioxopiperidin-3-yl)-5-(piperazin-1-yl)isoindol-1,3-dione (7 mg, 0.02 mmol), TEA (21.5 mg, 0.21 mmol), and NaBH3CN (6.6 mg, 0.106 mmol) were added. The reaction mixture was stirred at 60 °C for 1 hour. The reaction mixture was cooled to room temperature, quenched by adding water (5 mL), and extracted with DCM (5 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by silica gel column chromatography (DCM:MeOH = 100:1–10:1) to give the desired compound (10 mg, 53.7%). LC / MS: 878.9 [M+H] + .
[0809] 1 H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.90 (m, 1H), 8.67 (d, J = 2.7Hz, 1H), 8.31 (s, 2H), 8.07 (dd, J = 9.0, 2.7Hz, 1H), 7.72 (d, J = 8.2Hz, 2 H), 7.58-7.50 (m, 3H), 7.38-7.30 (m, 1H), 7.21-7.18 (m, 1H), 7.10-7.05 (m, 2H), 6.62 (d, J=9.1Hz, 1H), 5.09-5.03 (m, 1H), 4.60 (d, J= 6.1Hz, 2H), 4.33 (d, J=17.0Hz, 1H), 4.21 (d, J=16.9Hz, 1H), 3.91 (s, 3H), 3.74-3.61 (m, 2H), 3.59-3.53 (m, 2H), 3.32-3.25 (m, 6H), 3 .22-3.14(m, 2H), 2.92-2.85(m, 1H), 2.62-2.55(m, 4H), 2.43-2.31(m, 3H), 2.13-2.10(m, 1H), 2.01-1.91(m, 1H), 1.80-1.72(m, 1H).
[0810] Example 65: Preparation of 1-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 71)
[0811]
[0812] Step 1: Preparation of tert-butyl hexanoate of 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoate
[0813] To a solution of tert-butyl 6-bromohexanoate (200 mg, 0.8 mmol) in DMF (10 mL), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (392 mg, 0.88 mmol) and K₂CO₃ (336 mg, 2.4 mmol) were added. The reaction mixture was stirred at 90 °C for 17 hours. The solvent was evaporated under vacuum, and the residue was purified by rapid column chromatography with PE:EA = 1:2 to give the desired product (100 mg, 23%). LC / MS: 502.8 [M+H] + .
[0814] Step 2: Preparation of 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoic acid
[0815] TFA (1 mL) was added to a solution of tert-butyl hexanoate (100 mg, 0.2 mmol) in DCM (3 mL). The mixture was stirred at room temperature for 2 hours. The solvent was removed under vacuum to give the product (80 mg, crude). LC / MS: 446.7 [M+H] + .
[0816] Step 3: Preparation of 1-(5-(4-(6-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-6-oxohexyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0817] To a solution of 6-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)hexanoic acid (80 mg, crude) in DCM (5 mL), HATU (102 mg, 0.27 mmol) and TEA (54 mg, 0.54 mmol) were added. The mixture was stirred at room temperature for 5 min, and then (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (80 mg, 0.18 mmol) was added. The mixture was stirred at room temperature for 2 h. The mixture was extracted with brine and concentrated under vacuum to give the crude product. The crude product was purified by pre-TLC with DCM:MeOH = 10:1 to give the desired product (19.5 mg, 11% in two steps). LC / MS: 876.1 [M+H] + .
[0818] 1H NMR (400MHz, CDCl3) δ9.12 (d, J=7.4Hz, 1H), 8.37 (s, 1H), 7.46–7.37 (m, 5H), 7.33 (s, 1H), 7.23 (t, J=7.4Hz, 1H), 7.12-7.06(m, 3H), 7.02-6.93(m, 2H), 4.40-4.48(m, 1H), 4.31-4.38(m, 1H), 3.89(s, 3H), 3.77-3.87(m, 2H), 3.71(s, 4H), 3.34(t, J=10.7Hz, 1H), 3.20-3.12(m, 1H), 2.87-2.81(m, 2H), 2.70-2.52(m, 5H), 2.36(t, J=7.5Hz, 2H), 2.11-2.21(m, 2H), 1.53-1.75(m, 8H), 1.40-1.25(m, 2H).
[0819] Example 66: Preparation of 1-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 72)
[0820]
[0821] Step 1: Preparation of tert-butyl 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)valerate
[0822] A solution of tert-butyl 5-bromopentanoate (380 mg, 1.60 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (1.07 g, 3.20 mmol), K₂CO₃ (1.11 g, 8.00 mmol), and KI (266 mg, 1.60 mmol) in DMF (20 mL) was stirred at room temperature for 3 hours. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (50 mL × 3). The combined organic layers were dried over Na₂SO₄, filtered, and evaporated to give the crude compound. The crude product was purified by column chromatography (DCM:MeOH = 10:1) to give the desired product (130 mg, 17%) as a pale yellow solid. LC / MS: 488.7 [M+H]⁺.
[0823] Step 2: Preparation of 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)valeric acid
[0824] A solution of tert-butyl valerate (130 mg, 0.27 mmol) in DCM (12 mL) and TFA (9 mL) was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum to give the desired compound as a yellow oil (115 mg, 98%). LC / MS: 432.8 [M+H]+
[0825] Step 3: Preparation of 1-(5-(4-(5-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-5-oxopentyl)piperazin-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0826] A solution of 5-(4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)valeric acid (115 mg, 0.27 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (133 mg, 0.30 mmol), HATU (154 mg, 0.41 mmol), and N,N-diisopropylethylamine (174 mg, 1.35 mmol) in MeOH / DMF (2:1, 15 mL) was stirred at room temperature for 2 hours. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (40 mg, yield: 17%). LC / MS: 862.1 [M+H]+.
[0827] 1H NMR (301MHz, DMSO) δ12.74 (s, 1H), 10.33 (s, 1H), 8.80 (s, 1H), 8.24, (d, J = 3.6Hz, 1H) , 7.70-7.56 (m, 2H), 7.45 (d, J=7.7Hz, 2H), 7.38-7.29 (m, 2H), 7.28-7.23 (m, 1H), 7.1 9-7.11(m, 4H), 7.02-6.95(m, 1H), 4.31-4.14(m, 3H), 3.90-3.75(m, 4H), 3.58-3.46( m, 6H), 2.70-2., 45 (m, 2H), 2.48-2.19 (m, 8H), 2.10-1.90 (m, 3H), 1.58-1.38 (m, 6H).
[0828] Example 67: Preparation of 1-(5-(4-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidin]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 73)
[0829]
[0830] Step 1: Preparation of benzyl 4-(2-(tert-butoxy)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carboxylate
[0831] MgSO4 (3 g, 25.1 mmol) was added to a solution of tert-butyl 2-(piperidin-4-yl)acetate (500 mg, 2.51 mmol), benzyl 4-oxopiridine-1-carboxylate (584.8 mg, 2.51 mmol), and TEA (507 mg, 5.02 mmol) in DCM (15 mL). The reaction mixture was stirred at room temperature for 1 hour. NaBH(AcO)3 (1.3 g, 6.27 mmol) was added in portions over 3 hours. The reaction mixture was stirred at room temperature overnight. The solid was filtered off and washed with DCM (20 mL × 2). The solution was concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound as a white solid (850 mg, 80% purity, 65.1% yield). LC / MS: 417.2 [M + H] + .
[0832] Step 2: Preparation of tert-butyl 2-([1,4'-bipiperidine]-4-yl)acetate
[0833] Pd / C (100 mg) was added to a solution of 4-(2-(tert-butoxy)-2-oxoethyl)-[1,4'-bipiperidine]-1'-carboxylic acid benzyl ester (850 mg, 80% purity, 1.63 mmol) in anhydrous t-BuOH (20 mL). The mixture was stirred overnight at 20 °C under H2. The catalyst was filtered off. The solution was concentrated under vacuum to give the title product (320 mg, 90% purity, 62% yield) as a white solid. LC / MS: 227.1 [M-55] + .
[0834] Step 3: Preparation of tert-butyl 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-piperidine]-4-yl)acetate
[0835] A solution of 2-([1,4'-bipiperidin]-4-yl)tert-butyl acetate (320 mg, 90% purity, 1.02 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (269 mg, 1.02 mmol), HATU (463.6 mg, 1.22 mmol), and N,N-diisopropylethylamine (197.4 mg, 1.53 mmol) in DMF (15 mL) was stirred at room temperature for 4 hours. The mixture was evaporated under vacuum and purified by Prep-TLC using MeOH:DCM = 1:10 to give the title compound (30 mg, 5.5%) as a white solid. LC / MS: 529.2 [M+H] + .
[0836] Step 4: Preparation of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-piperidine]-4-yl)acetic acid
[0837] A solution of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidine]-4-yl)tert-butyl acetate (30 mg, 0.056 mmol) in DCM (5 mL) and TFA (2 mL) was stirred at room temperature for 2 hours. The mixture was concentrated under vacuum to give the title compound (30 mg, 89.3% purity, 100% yield). LC / MS: 473.1 [M+H] + .
[0838] Step 5: Preparation of 1-(5-(4-(2-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidin]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0839] A solution of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetic acid (30 mg, 0.056 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (27.1 mg, 0.056 mmol), HATU (25.5 mg, 0.067 mmol), and N,N-diisopropylethylamine (11 mg, 0.084 mmol) in DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (15 mg, 29.4%) as a white solid. LC / MS: 901.5 [M+H], + .
[0840] 1 H NMR (400MHz, DMSO) δ12.89 (br, 1H), 10.35 (s, 1H), 9.36 (br, 1H), 9.00-8.92 (m, 1H), 8.29 (s, 1H), 7.68 (s, 1H), 7.58 (d, J=8 .5Hz, 1H), 7.49 (t, J, = 7.6Hz, 2H), 7.42 (d, J = 8.4Hz, 1H), 7.36 (s, 1H), 7.26 (t, J = 7.3Hz, 1H), 7.19, (d, J = 8.1Hz, 3H), 7.03 (d, J=8.3Hz, 1H), 4.39-4.30 (m, 2H), 4.26-4.12 (m, 2H), 3.86 (s, 3H), 3.64-3.57 (m, 2H), 3.44 (d, J=8.7Hz, 2H), 3.33-3.25 (m, 1H), 3.07-2.98 (m, 3H), 2.73-2.65 (m, 2H), 2.40-2.31 (m, 2H), 2.16-1.83 (m, 8H), 1.72-1.31 (m, 8H), 1.27-1.20 (m, 1H).
[0841] Example 68: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 74)
[0842]
[0843] Step 1: Preparation of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidine-4-carboxaldehyde
[0844] Sulfuric acid (2M, 5mL, 10mmol) was added to a solution of (2-chloro-4-phenoxyphenyl)(4-((4-(4-(dimethoxymethyl)piperidin-1-yl)-3-fluorophenyl)amino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) ketone (200 mg, 0.33 mmol) in THF (5 mL). The mixture was stirred at 70 °C for 30 min. The pH was adjusted to 9 with NaOH (1M), and the mixture was extracted with ethyl acetate (20 mL × 3). The combined organic layers were washed with brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product (152 mg, 81%). LC / MS: 569.6 [M + H₂] + .
[0845] Step 2: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0846] MgSO4 (192 mg, 1.6 mmol) was added to a solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-carboxaldehyde (90 mg, 0.16 mmol), 1-(2-methoxy-5-(piperazin-1-carbonyl)phenyl)dihydropyrimidin-2,4(1H,3H)-dione hydrochloride (53.1 mg, 0.16 mmol), and TEA (48.5 mg, 0.48 mmol) in DCM (15 mL). The reaction mixture was stirred at room temperature for 1 hour. NaBH(AcO)3 (101.7 mg, 0.48 mmol) was added in portions over 3 hours. The reaction mixture was stirred at room temperature for 5 hours. The reaction mixture was concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (40 mg, 98% purity, 25% yield). LC / MS: 885.4 [M+H] + .
[0847] 1 H NMR (301MHz, DMSO) δ13.04 (s, 1H), 11.12 (s, 1H), 10.35 (s, 1H), 8.44 (s, 1H), 8.02 (d, J=17.1 Hz, 1H), 7.83 (s, 1H), 7.63 (d, J=8.5Hz, 1H), 7.53,-7.43 (m, 2H), 7.40-7.12 (m, 7H), 7.10-6. 99(m, 2H), 3.83(s, 3H), 3.60-3.35(m, 6H), 3.29-3.20(m, 2H), 2.70-2.55(m, 5H), 2.40-2.32 (m, 3H), 2.21 (d, J=6.4Hz, 2H), 1.80 (d, J=12.3Hz, 2H), 1.70-1.62 (m, 1H), 1.40-1.27 (m, 3H).
[0848] Example 69: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)-1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 75)
[0849]
[0850] Step 1: Preparation of tert-butyl 4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazacycloheptane-1-carboxylate
[0851] HATU (862 mg, 2.268 mmol), DIEA (489 mg, 3.78 mmol), and tert-butyl (1,4-diazacyclohexane-1-yl)formate (380 mg, 1.89 mmol) were added to a solution of 3-(2,4-dioxo-1,3-diazacyclohexane-1-yl)-4-methoxybenzoic acid (500 mg, 1.89 mmol) in DMF (5 mL) at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The mixture was poured into water (45 mL) and extracted with EtOAc (50 mL × 2). The combined organic layers were washed with brine, dried over Na2SO4, and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid chromatography (MeOH / DCM = 1:10) to give the desired product (1 g, 94.7%), LC / MS: 391.2 [M-55]. + .
[0852] Step 2: Preparation of 1-(5-(1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione
[0853] A solution of tert-butyl (4-{[3-(2,4-dioxo-1,3-diazacyclohexane-1-yl)-4-methoxyphenyl]carbonyl}-1,4-diazacycloheptane-1-yl)formate (1 g) in TFA / DCM (1:5, 12 mL) was stirred at room temperature for 2 hours. The solution was concentrated under vacuum. The residue was dissolved in DCM (50 mL) and washed with saturated sodium bicarbonate solution and brine. The organic layer was dried over Na2SO4 and concentrated under vacuum to give the desired product (500 mg, 83.0%), LC / MS: 347.1 [M+H]. + .
[0854] Step 3: Preparation of 1-(5-(4-((1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)methyl)-1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0855] To a solution of 1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-carboxaldehyde (80 mg, 0.14 mmol) in DCM (5 mL), 1-(5-(1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (97 mg, 0.28 mmol), Et3N (28 mg, 0.28 mmol), and MgSO4 (200 mg, 1.66 mmol) were added. The mixture was stirred at room temperature for 30 minutes, followed by the addition of NaBH(OAc)3 (59 mg, 0.28 mmol) in portions. The reaction mixture was stirred at room temperature for 1 hour. The mixture was filtered, and the filtrate was concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH / DCM = 1:10) to obtain the desired product (80 mg, 63.5%). LC / MS: 900.1 [M+H] + .
[0856] 1 H NMR (400MHz, DMSO) δ13.06 (br, 1H), 11.14 (s, 1H), 10.36 (s, 1H), 8.46 (s, 1H), 8.04 (d, J=14 .8Hz, 1H), 7.84 (s, 1H), 7.64 (d, J=8.4Hz, 1H), 7.49, (t, J=7.6Hz, 2H), 7.39-7.30 (m, 3H), 7. 29-7.14(m, 6H), 7.13-7.00(m, 2H), 3.85(s, 3H), 3.65-3.55(m, 4H), 3.45-3.35(m, 2H), 3.2 9-3.25(m, 2H), 2.78-2.55(m, 8H), 2.49-2.20(m, 2H), 1.85-1.75(m, 4H), 1.30-1.25(m, 2H).
[0857] Example 70: Preparation of 1-(5-(4-(2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)ethyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 76)
[0858]
[0859] A solution of 2-(1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)-2-fluorophenyl)piperidin-4-yl)acetaldehyde (140 mg, 0.24 mmol), 1-(2-methoxy-5-(piperazin-1-carbonyl)phenyl)dihydropyrimidin-2,4(1H,3H)-dione (80 mg, 0.24 mmol), TEA (121 mg, 1.2 mmol), and MgSO4 (408 mg, 3.4 mmol) in DCM (20 mL) was stirred at room temperature under nitrogen for 30 min. Sodium triacetoxyborohydride (163 mg, 0.72 mmol) was added in portions at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was filtered. The organic layer was washed with water and concentrated under vacuum to give the crude product. The crude product was purified by Prep-TLC (MeOH:DCM = 1:10) to obtain the desired product (55 mg, 25%) as a yellow solid. LC / MS: 900.0 [M+1] + .
[0860] 1 H NMR (400MHz, DMSO) δ13.06 (br, 1H), 11.14 (s, 1H), 10.36 (s, 1H), 10.05 (br, 1H), 8.46 (s, 1H), 8.04 (d, J=14.8H z, 1H), 7.84 (s, 1H), 7.64 (d, J=8.3Hz, 1H), 7.49 (t, J=7.7Hz, 2H), 7.45-7.37 (m, 1H), 7.33 (d, J=8.1Hz, 1H), 7. 30-7.24(m, 1H), 7.23-7.11(m, 3H), 7.09-7.04(m, 1H), 3.86(s, 2H), 3.67-3.56(m, 2H), 3.52-3.39(m, 2H), 3.3 8-3.24(m, 4H), 3.22-2.96(m, 2H), 2.91-2.56(m, 4H), 2.45-1.88(m, 5H), 1.85-1.45(m, 4H), 1.42-0.87(m, 5H).
[0861] Example 71: Preparation of (R)-1-(5-(4-(2-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidin]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 77)
[0862]
[0863] Step 1: Preparation of (R)-1-(5-(4-(2-(3-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-2-oxoethyl)-[1,4'-bipiperidin]-1'-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0864] A solution of 2-(1'-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-[1,4'-bipiperidin]-4-yl)acetic acid (70 mg, 0.15 mmol), (R)-(2-chloro-4-phenoxyphenyl)(4-(piperidin-3-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (84 mg, 0.15 mmol), HATU (86 mg, 0.23 mmol), and N,N-diisopropylethylamine (116 mg, 0.9 mmol) in DMF (10 mL) was stirred at room temperature for 4 hours. The mixture was evaporated under vacuum and purified by Prep-TLC with MeOH:DCM = 1:10 to give the title compound (14 mg, 10%) as a white solid. LC / MS: 902.4 [M+H] + .
[0865] 1 H NMR (301MHz, DMSO) δ12.86 (br, 1H), 10.37 (s, 1H), 8.87 (br, 1H), 8.32-8.24 (m, 1H), 7.67-7.62 (m, 1H), 7.60-7. 52(m,1H),7.51-7.43(m,2H),7.42-7.34(m,2H),7.29-7.12(m,5H),7.05-6.98(m,1H),4.32-4.21(m,1H),4.20 -4.13(m, 1H), 3.84(s, 3H), 3.63-3.53(m, 3H), 3.33-3.24(m, 2H), 3.21-3.13(m, 1H), 3.07-3.01(m, 1H), 2.94-2 .77 (m, 3H), 2.67 (t, J=6.4Hz, 2H), 2.35-2.23 (m, 2H), 2.10-1.70 (m, 10H), 1.67-1.46 (m, 6H), 1.19-1.15 (m, 1H).
[0866] Example 72: Preparation of 1-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxoheptyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 78)
[0867]
[0868] Step 1: Preparation of 7-bromoheptanoyl chloride
[0869] A solution of 7-bromoheptanoic acid (1 g, 4.8 mmol) in thionyl chloride (20 mL) was stirred at 70 °C for 5 hours. The reaction mixture was evaporated under vacuum to give the desired product as a brown oil (1 g, 91%). LC / MS: 223.0 [M+H] + (Treatment with MeOH).
[0870] Step 2: Preparation of 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one
[0871] 7-Bromoheptanoyl chloride (50 mg, 0.22 mmol) was added to a solution of (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (106 mg, 0.22 mmol) and N,N-diisopropylethylamine (142.16 mg, 1.1 mmol) in 10 mL of ACN under nitrogen atmosphere and stirred at room temperature. The mixture was stirred at room temperature for 5 hours. The solvent was removed under vacuum. The residue was partitioned between EtOAc and H2O. The organic phase was dried over sodium sulfate and concentrated under vacuum to give a crude product. The crude product was purified by silica gel chromatography with CH2Cl2 / MeOH (100:1–10:1) to give the desired compound (60 mg, 41%) as a yellow solid. LC / MS: 637.9 [M+H] + .
[0872] Step 3: Preparation of 1-(5-(4-(7-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-7-oxohepyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0873] 7-bromo-1-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)hepta-1-one (60 mg, 0.09 mmol), 1-{2-methoxy-5-[(piperazin-1-yl)carbonyl]phenyl}-1,3-diazacyclohexane (31.20 mg, 0.09 mmol) and N,N-diisopropylethylamine were stirred at room temperature under nitrogen atmosphere. Potassium iodide (3.1 mg, 0.02 mmol) was added to a solution of ACN (10 mL). The reaction mixture was stirred at 70 °C for 5 hours. The solvent was removed, and the residue was purified by column chromatography (DCM / MeOH = 50:1–10:1) to give a product as a yellow solid (21.3 mg, 0.024 mmol, 26%). LC / MS: 890.3 [M+H] + .
[0874] 1 H NMR (400MHz, DMSO) δ12.77 (s, 1H), 10.36 (s, 1H), 8.82 (d, J=7.4Hz, 1H), 8.26 (s, 1H), 7.64 (s, 1H), 7.60-7.55 (m, 1H), 7.51-7.44(m, 2H), 7.43,-7.31(m, 2H), 7.26(t, J=7.4Hz, 1H), 7.23-7.11(m, 4H), 7.05-7.00(m, 1H), 4.38-4 .33 (m, 1H), 4.19-4.12 (m, 1H), 3.93-3.80 (m, 4H), 3.60 (t, J=6.6Hz, 2H), 3.56-3.40 (m, 3H), 3.22-2.93 (m, 4H), 2 .74-2.66(m,2H), 2.46-2.19(m,5H), 2.19-1.99(m,2H), 1.73-1.64(m,1H), 1.58-1.44(m,4H), 1.43-1.24(m,7H).
[0875] Example 73: Preparation of 1-(5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)-1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 79)
[0876]
[0877] Step 1: Preparation of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazacycloheptane-1-yl)methyl)benzoate
[0878] To a solution of 1-(5-(1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidine-2,4(1H,3H)-dione (80 mg, 0.23 mmol) in DMF (5 mL), tert-butyl 4-(bromomethyl)benzoate (69 mg, 0.25 mmol) and K₂CO₃ (64 mg, 0.46 mmol) were added. The reaction mixture was stirred at 75 °C for 17 hours. The solvent was removed under vacuum, and the residue was purified by Pre-TLC with PE:EA = 1:1 to provide the desired product (72 mg, 58%). LC / MS: 537.2 [M+H] + .
[0879] Step 2: Preparation of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazacycloheptane-1-yl)methyl)benzoic acid
[0880] TFA (1 mL) was added to a solution of tert-butyl benzoate (72 mg, 0.13 mmol) in DCM (3 mL). The reaction mixture was stirred at room temperature for 2 hours. The solvent was removed under vacuum to give the product (80 mg), which could be used in the next step without further purification. LC / MS: 481.0 [M+H] + .
[0881] Step 3: Preparation of 1-(5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)-1,4-diazacycloheptane-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0882] To a solution of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-1,4-diazacycloheptane-1-yl)methyl)benzoic acid (80 mg, crude) in DCM (5 mL), HATU (114 mg, 0.3 mmol) and DIEA (97 mg, 0.75 mmol) were added. The mixture was stirred at room temperature for 5 min, and (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl ketone (73 mg, 0.15 mmol) was added. The mixture was stirred at room temperature for 2 h. The mixture was washed with brine and concentrated under vacuum to give the crude product. The crude product was purified by pre-TLC with DCM:MeOH = 10:1 to give the desired product (25 mg, 21% in two steps). LC / MS: 910.1 [M+H] + .
[0883] 1 H NMR (400MHz, DMSO) δ12.77 (s, 1H), 10.34 (s, 1H), 8.85 (d, J=6.8Hz, 1H), 8.25 (s, 1H), 7.64 (s, 1H), 7.58 (d, J=8.4Hz, 1H), 7.48 (t, J=7.2Hz, 2H), 7.44-7.31 (m, 6H), 7.26 (t, J=7.6Hz, 1H), 7.23-7.17 (m, 3H), 7.16-7. 11 (m, 1H), 7.03 (d, J=8.8Hz, 1H), 4.42-4.20 (m, 2H), 3.83 (s, 3H), 3.68-3.53 (m, 6H), 3.46 (s, 2H), 3.27-3. 13 (m, 2H), 2.75-2.60 (m, 4H), 2.59-2.53 (m, 1H), 2.23-1.92 (m, 3H), 1.86-1.66 (m, 3H), 1.60-1.48 (m, 2H).
[0884] Example 74: Preparation of 1-(5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione (Compound 80)
[0885]
[0886] Step 1: Preparation of tert-butyl 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoate
[0887] A mixture of tert-butyl 4-(bromomethyl)benzoate (150 mg, 0.55 mmol), 1-(2-methoxy-5-(piperazine-1-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (548 mg, 1.7 mmol), and DIEA (213 mg, 1.8 mmol) in DCM (20 mL) was stirred at room temperature for 4 hours. The solvent was removed under vacuum to give the crude product. The crude product was purified by pre-TLC to give a product as a yellow solid (160 mg, 50%). LC / MS: 522.8 [M+H] + .
[0888] Step 2: Preparation of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoic acid
[0889] TFA (6 mL) was added to a solution of tert-butyl benzoate (160 mg) in DCM (20 mL). The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under vacuum to give crude compound (180 mg), which was used in the next step without further purification. LC / MS: 466.7 [M+H] + .
[0890] Step 3: Preparation of 1-(5-(4-(4-((5-(2-chloro-4-phenoxybenzoyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)benzyl)piperazine-1-carbonyl)-2-methoxyphenyl)dihydropyrimidin-2,4(1H,3H)-dione
[0891] A solution of 4-((4-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperazin-1-yl)methyl)benzoic acid (83 mg, purity: 70%, 0.12 mmol), (2-chloro-4-phenoxyphenyl)(4-(piperidin-4-ylamino)-7H-pyrrolo[2,3-d]pyrimidin-5-yl) methyl ketone (60 mg, 0.12 mmol), HATU (57 mg, 0.15 mmol), and DIEA (48 mg, 0.37 MMOL) in DMF (10 mL) was stirred at room temperature for 3 hours. The solvent was removed under vacuum to give the crude product. The crude product was purified by pre-TLC to give the title product (24 mg, 22%) as a white solid. LC / MS: 895.5 [M+H] + .
[0892] 1 H NMR (400MHz, DMSO) δ12.75 (s, 1H), 10.33 (s, 1H), 8.85 (d, J=7.5, Hz, 1H), 8.26 (s, 1H), 7.63 (s, 1H), 7.58 (d, J=8.4Hz, 1H), 7.50-7.46 (m, 2H), 7.42-7.36 (m, 4H), 7.34 (s, 1H), 7.26 (t, J=7.4Hz, 1H), 7.2 2-7.10(m, 4H), 7.05,-7.00(m, 1H), 4.36-4.31(m, 2H), 3.84(s, 3H), 3.65-3.45(m, 8H), 3.32(s, 3H) , 3.29-3.17(m, 2H), 2.67(t, J=6.5Hz, 2H), 2.46-2.37(m, 3H), 2.15-2.00(m, 2H), 1.62-1.52(m, 2H).
[0893] Example 75: Preparation of (S)-N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 85)
[0894]
[0895] Step 1: Preparation of (1-(2-fluoro-4-nitrophenyl)azacyclobutane-3-yl)methanol
[0896] A mixture of 1,2-difluoro-4-nitrobenzene (2.0 g, 12.6 mmol), aziridine-3-ylmethanol (1.3 g, 15.1 mmol), and DIEA (4.9 g, 37.8 mmol) in ACN (15 mL) was stirred at 80 °C for 3 hours. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography with PE:EA = 1:1 to provide the desired product (2.5 g, 88.1%). LC / MS: 227.0 [M+H] + .
[0897] Step 2: Preparation of (1-(4-amino-2-fluorophenyl)azacyclobutane-3-yl)methanol
[0898] Pd / C (0.25 g, 10%) was added to a solution of (2.5 g, 11.1 mmol) in MeOH (30 mL). The mixture was stirred overnight at room temperature under 1 atm H₂. The catalyst was filtered off and the solution was concentrated under vacuum to give the product (2 g, 91.8%). LC / MS: 197.1 [M+H] + .
[0899] Step 3: Preparation of (1-(2-fluoro-4-iodophenyl)azacyclobutane-3-yl)methanol
[0900] A solution of NaNO2 (0.91 g, 13.2 mmol) in water (4 mL) was added to a solution of (2.0 g, 10.2 mmol) in ACN (40 mL) and concentrated HCl (3.5 mL) at 0 °C. The mixture was stirred at 0 °C for 2 hours, and then a solution of KI (4.3 g, 25.5 mmol) in water (6 mL) was added dropwise. The mixture was stirred overnight at room temperature. The mixture was diluted with water (15 mL) and extracted with DCM (40 mL × 3). The combined organic layers were concentrated under vacuum, and the residue was purified by rapid column chromatography using PE:EA = 2:1 to give the desired product (1.0 g, 31.3%). LC / MS: 308.0 [M+H] + .
[0901] Step 4: Preparation of 1-(2-fluoro-4-iodophenyl)azacyclobutane-3-carboxaldehyde
[0902] A solution of (1-(2-fluoro-4-iodophenyl)azacyclobutane-3-yl)methanol (1.0 g, 3.3 mmol) in DCM (10 mL) was added fractionally to a solution of DCM (10 mL) under nitrogen atmosphere at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched by adding water (10 mL). The organic phase was washed with brine and dried over Na₂SO₄. The solvent was removed under vacuum to give the desired product (0.8 g, 78.7% yield). LC / MS: 306.0 [M+H] + .
[0903] Step 5: Preparation of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)azacyclobutane
[0904] Acetyl chloride (310 mg, 3.9 mmol) was added to a solution of 1-(2-fluoro-4-iodophenyl)azacyclobutane-3-carboxaldehyde (800 mg, 2.6 mmol) in MeOH (10 mL) under nitrogen and stirred at 0 °C. The mixture was stirred at 25 °C for 2 h. The reaction was quenched by adding TEA (1 mL). The solvent was removed under vacuum, and the residue was purified by rapid column chromatography with PE:EA = 5:1 to give the desired product (500 mg, 53.8%). LC / MS: 352.0 [M+H] + .
[0905] Step 6: Preparation of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0906] To a solution of 3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)azacyclobutane (400 mg, 1.14 mmol) in DMSO (10 mL), N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (536.3 mg, 1.37 mmol), K₂CO₃ (472.3 mg, 3.41 mmol), cuprous iodide (I) (119.3 mg, 0.62 mmol), and N,N-dimethylglycine (129.2 mg, 1.25 mmol) were added. The reaction was stirred at 110 °C for 16 h. The solid was filtered off and washed with DCM (20 mL × 3). The combined solutions were concentrated under vacuum and the residue was rapidly purified by DCM:MeOH = 10:1 to provide the desired product (200 mg, 80% purity, 22.8% yield). LC / MS: 616.2 [M+H] + .
[0907] Step 7: Preparation of N-(4-(4-amino-1-(3-fluoro-4-(3-formylazonylbutane-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0908] THF:H₂O:H₂SO₄ (6 mL, 2:3:1) was added to a solution of N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (200 mg, 80% purity, 0.26 mmol). The mixture was stirred overnight at room temperature. The solvent was removed under vacuum and the residue was diluted with DCM (20 mL). The organic phase was washed with saturated NaHCO₃ solution and brine and dried over Na₂SO₄. The solvent was removed under vacuum. The residue was purified by silica gel chromatography using PE / EA = 1:1 to give the desired product (100 mg, 67.5%). LC / MS: 570.1, [M+H] + .
[0909] Step 8: Preparation of (S)-N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0910] To a solution of N-(4-(4-amino-1-(3-fluoro-4-(3-formylazonylbutane-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (100 mg, 0.17 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (63.4 mg, 0.19 mmol), and TEA (88 mg, 0.87 mmol) in MeOH / DMF (6 mL, 2:1), AcOH (0.5 mL) and NaBH3CN (44.1 mg, 0.70 mmol) were added. The mixture was stirred at 60 °C for 1 hour. The reaction mixture was cooled to room temperature and quenched by adding water (5 mL). The mixture was extracted with DCM (15 mL × 3). The organic phase was washed with brine and dried over Na₂SO₄. The solvent was removed, and the compound was purified by prep-HPLC to give the desired compound (50 mg, 98.7% purity, 32.9% yield). LC / MS: 882.3 [M+H] + .
[0911] 1H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.90 (t, J=6.2Hz, 1H), 8.35 (s, 1H), 7.93-7.89 (m, 1H), 7.85-7.83 (m, 1H), 7.73 (d, J=8.1Hz, 2H), 7.55-7.52, (m, 4H), 7.38-7.33 (m, 1H), 7.21-7.18 (m, 1H), 7.10-7.06 (m, 2H), 6.72 (t, J=9.3Hz, 1H), 5. 08-5.03 (dd, 1H), 4.60 (d, J=6.1Hz, 2H), 4.34 (d, J=17.2Hz, 1H), 4.22 (d, J=17.2Hz, 1H), 4.12-4.10 (m, 2H), 3.91 (s, 3 H), 3.69-3.63(m, 2H), 3.32-3.27(m, 3H), 3.04-2.85(m, 3H), 2.68-2.55(m, 6H), 2.39-2.33(m, 2H), 1.96-1.91(m, 1H).
[0912] Example 76: Preparation of N-(4-(4-amino-1-(1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 92)
[0913]
[0914] Step 1: Preparation of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0915] To a solution of N-({4-[4-amino-1-(pyrrolidone-3-yl)pyrazolo[3,4-d]pyrimidin-3-yl]phenyl}methyl)-5-fluoro-2-methoxybenzamide (200 mg, 0.43 mmol) in DMSO (5 mL) under stirring at room temperature, 6-bromopyridine-3-carboxaldehyde (121 mg, 0.65 mmol) and K₂CO₃ (120 mg, 0.86 mmol) were added. The reaction mixture was stirred at 80 °C for 12 hours. The reaction mixture was poured into water (100 mL) and extracted with EA (100 mL × 2). The combined organic layers were washed with water and brine, dried over Na₂SO₄, and concentrated under vacuum to give the crude product. The crude product was purified by rapid column chromatography (DCM / MeOH = 10:1) to give the desired product (150 mg, 61.1%). LC / MS: 566.9 [M + H] + .
[0916] Step 2: Preparation of N-(4-(4-amino-1-(1-(5-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0917] Et3N (36 mg, 0.36 mmol), (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (86 mg, 0.18 mmol), and NaBH3CN (45 mg, 0.72 mmol) were added to a solution of N-(4-(4-amino-1-(1-(5-formylpyridin-2-yl)pyrrolidine-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (130 mg, 0.23 mmol) in MeOH / DMF / HOAc (12 mL, 2:1:0.05) stirred at room temperature. The reaction mixture was stirred at 60 °C for 1 hour. The mixture was concentrated under vacuum and then poured into water (50 mL) and extracted with EA (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum to obtain the crude product. The crude product was purified by prep-HPLC to obtain the desired product (18 mg, 8.9%). LC / MS: 879.0 [M+H] + .
[0918] 1H NMR (400MHz, DMSO) δ = 10.94 (s, 1H), 8.85 (t, J = 6.0Hz, 1H), 8.28, (s, 1H), 8.18 (s, 1H), 7.99 (d, J = 2.0Hz, 1H), 7.61 (d, J = 8.0Hz, 2H), 7.53 -7.45, (m, 5H), 7.36-7.31 (m, 1H), 7.18 (dd, J=9.2, 4.4Hz, 1H), 7.05 (s, 1H), 7.03 (s, 1H), 6.50 (d, J=8.4Hz, 2H), 5.62-5.57 (m, 1H), 5.04 ( dd, J=13.2, 5.2Hz, 1H), 4.57 (d, J=6.0Hz, 2H), 4.32 (d, J=16.8Hz, 1H), 4.19 (d, J=16.8Hz, 1H), 4.01-3.91 (m, 2H), 3.89 (s, 3H), 3.86-3.7 2 (m, 3H), 3.65-3.55 (m, 2H), 3.38 (s, 2H), 3.32-3.25 (m, 4H), 2.94-2.84 (m, 2H), 2.62-2.58 (m, 1H), 2.56-2.52 (m, 3H), 1.98-1.92 (m, 1H).
[0919] Example 77: Preparation of N-(4-(4-amino-1-(6-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 93)
[0920]
[0921] Compound 93 was prepared using a procedure similar to that described for compound 66.
[0922] LC / MS: 878.8 [M+H] + .
[0923] 1H NMR (400MHz, DMSO) δ10.96 (s, 1H), 8.93-8.86 (m, 1H), 8.67 (s, 1H), 8.31 (s, 1H), 8.08 (d, J = 7.6Hz, 1H), 7.72 (d, J = 7.9Hz, 2H), 7.59- 7.49 (m, 4H), 7.38-7.32 (m, 1H), 7.20 (dd, J=9.1, 4.2Hz, 1H), 7.14-7.04 (m, 2H), 6.62 (d, J=9.0Hz, 1H), 5.06 (dd, J=13.0, 4.7Hz, 1H) , 4.60 (d, J = 5.9Hz, 2H), 4.34, (d, J = 17.2Hz, 1H), 4.21 (d, J = 16.7Hz, 1H), 3.91 (s, 3H), 3.71-3.50 (m, 3H), 3.49-3.36 (m, 3H), 3.27-3 .15 (m, 2H), 2.89 (d, J=11.8Hz, 1H), 2.70-2.53 (m, 6H), 2.48-2.41 (m, 4H), 2.17-2.10 (m, 1H), 1.99-1.94 (m, 1H), 1.80-1.72 (m, 1H).
[0924] Example 78: Preparation of N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 94)
[0925]
[0926] Step 1: Preparation of 4-((5-fluoro-2-methoxybenzamido)methyl)benzoic acid
[0927] LiOH-H₂O (4.7 g, 111.9 mmol) was added to a solution of methyl 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoate (7.1 g, 22.37 mmol) in THF / water (100 mL, 1:1) under stirring at room temperature. The reaction mixture was stirred at room temperature for 12 hours. The mixture was concentrated under vacuum to 50 mL and then acidified with HCl (5 M) until pH 5–6. The solid was filtered, washed with water, and dried under vacuum to give the desired product (6 g, 88.42%). LC / MS: 304.0 [M+H₂] + .
[0928] 1H NMR (400MHz, DMSO) δ=8.89 (t, J=6.0Hz, 1H), 7.91 (d, J=8.0Hz, 2H), 7.50 (dd, J=9.2, 3.2Hz, 1H), 7.43 (d, J=8.0Hz, 2H), 7.37-7.31 (m, 1H), 7.18 (dd, J=9.2, 4.4Hz, 1H), 4.56 (d, J=6.0Hz, 2H), 3.89 (s, 3H).
[0929] Step 2: Preparation of 4-((5-fluoro-2-methoxybenzamido)methyl)benzoyl chloride
[0930] Oxaloyl chloride (2.2 mL, 25.72 mmol) was added to a solution of 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoic acid (3.9 g, 12.86 mmol) in DCM (50 mL) under stirring at room temperature. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under vacuum to give the title compound (4.0 g, crude product) as a brown oil.
[0931] Step 3: Preparation of N-(4-(2,2-dicyanoacetyl)benzyl)-5-fluoro-2-methoxybenzamide
[0932] NaOH (4 mL, 39.26 mmol, 40%) was slowly added to a solution of 4-{[(5-fluoro-2-methoxyphenyl)formamido]methyl}benzoyl chloride (4 g, crude) and malononitrile (960 mg, 14.54 mmol) in acetone (40 mL) under stirring at 5 °C. The reaction mixture was stirred at room temperature for 2 hours. The mixture was diluted with water (40 mL) and HCl (5 M) was added to adjust the pH to 2–3. The solid was filtered, washed with water, and dried under vacuum to give the desired product (3.8 g, 84.10% in two steps) as a white solid. LC / MS: 351.8 [M+H] + .
[0933] 1 H NMR (400MHz, DMSO) δ=10.89 (s, 1H), 8.86 (t, J=6.0Hz, 1H), 7.57 (d, J=8.0Hz, 2H), 7.50 (dd, J=9.2 , 3.2Hz, 1H), 7.37-7.30 (m, 3H), 7.17 (dd, J=9.2, 4.4Hz, 1H), 4.52 (d, J=6.0Hz, 2H), 3.88 (s, 3H).
[0934] Step 4: Preparation of N-(4-(2,2-dicyano-1-methoxyvinyl)benzyl)-5-fluoro-2-methoxybenzamide
[0935] To a solution of N-{[4-(2,2-dicyanoacetyl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (3.14 g, 8.94 mmol) in dioxane (40 mL) under stirring at room temperature, NaHCO3 (6.0 g, 71.52 mmol) and dimethyl sulfate (8.45 g, 67.05 mmol) were added. The reaction mixture was stirred at 100 °C for 2.5 h. The mixture was poured into water (60 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na2SO4, and concentrated under vacuum to give the title compound (3.5 g, crude) as a brown oil. LC / MS: 366.0 [M+H] + .
[0936] Step 5: Preparation of N-(4-(5-amino-4-cyano-1H-pyrazol-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0937] Hydrazine (1.4 g, 34.16 mmol, 80%) was added to a solution of N-{[4-(2,2-dicyano-1-methoxyeth-1-en-1-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (6.2 g, crude) in MeOH / water (20 mL, 2:1) in a sealed tube under stirring at room temperature. The reaction mixture was stirred at 100 °C for 12 h. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum. The residue was purified by rapid chromatography (DCM:MeOH = 10:1) to give the desired product (2.36 g, 36.1% in two steps). LC / MS: 366.0 [M+H] + .
[0938] 1 H NMR (400MHz, DMSO) δ = 12.12 (s, 1H), 8.84 (s, 1H), 7.74 (d, J = 7.6, Hz, 2H), 7.51 (dd, J = 9.2, 3.2Hz, 1H), 7.42-7 .38 (m, 2H), 7.36-7.30 (m, 1H), 7.18 (dd, J=9.2, 4.4Hz, 1H), 6.46 (s, 1H), 4.53 (d, J=6.0Hz, 2H), 3.89 (s, 3H).
[0939] Step 6: Preparation of N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0940] N-{[4-(5-amino-4-cyano-1H-pyrazol-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (2.36 g, 6.46 mmol) was stirred in formamide (30 mL) at 160 °C for 2 hours. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum. The residue was purified by rapid chromatography (DCM:MeOH = 10:1) to give the desired product (2.1 g, 82.8%). LC / MS: 393.0 [M+H] + .
[0941] Step 7: Preparation of (R)-(1-(5-iodopyridin-2-yl)pyrrolidine-3-yl)methanol
[0942] (3R)-pyrrolidine-3-ylmethanol (2.04 g, 20.18 mmol) and K₂CO₃ (5.6 g, 40.36 mmol) were added to a solution of 2-fluoro-5-iodopyridine (3 g, 13.45 mmol) in DMF (30 mL) under stirring at room temperature. The reaction mixture was stirred at 100 °C for 12 h. The mixture was poured into water (100 mL) and extracted with EtOAc (100 mL × 2). The combined organic layers were washed with brine (200 mL), dried over Na₂SO₄, and concentrated under vacuum. The residue was purified by rapid chromatography (PE:EtOAc = 3:1) to give the desired product (3.0 g, 73.3%). LC / MS: 304.8 [M+H] + .
[0943] Step 8: Preparation of (R)-1-(5-iodopyridin-2-yl)pyrrolidine-3-carboxaldehyde
[0944] DMSO (3 g, 38.14 mmol) was slowly added over 15 minutes to a solution of oxaloyl chloride (2.42 g, 19.07 mmol) in DCM (30 mL) stirred at -78 °C. Then, a solution of [(3R)-1-(5-iodopyridin-2-yl)pyrrolidine-3-yl]methanol (2.9 g, 9.54 mmol) in DCM (5 mL) was slowly added. After 15 minutes, Et3N (3.86 g, 38.14 mmol) was added. The reaction mixture was stirred at -78 °C for 30 minutes, then heated to room temperature and stirred for 1 hour. The mixture was diluted with DCM (65 mL), washed with brine, dried over Na2SO4, and concentrated under vacuum to give the title compound (3.0 g, crude) as a brown solid. LC / MS: 302.7 [M+H] + .
[0945] Step 9: Preparation of (R)-2-(3-(dimethoxymethyl)pyrrolidone-1-yl)-5-iodopyridine
[0946] Acetyl chloride (1.56 g, 19.86 mmol) was added to a solution of (3R)-1-(5-iodopyridin-2-yl)pyrrolidine-3-carboxaldehyde (3 g, crude) in MeOH (30 mL) under stirring at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with Et3N (2 mL) and concentrated under vacuum. The residue was purified by rapid chromatography (PE:EtOAc = 5:1) to give the desired product (2.6 g, 78.3%). LC / MS: 348.7 [M+H] + .
[0947] 1 H NMR (400MHz, CDCl3) δ=8.28 (d, J=2.4Hz, 1H), 7.61 (dd, J=8.8, 2.4Hz, 1H), 6.21 (d, J=8.8Hz, 1H), 4.29 (d, J=7.6Hz, 1H), 3. 59-3.51 (m, 2H), 3.42-3.34 (m, 7H), 3.25 (dd, J=10.8, 7.6Hz, 1H), 2.73-2.63 (m, 1H), 2.16-2.05 (m, 1H), 1.94-1.84 (m, 1H).
[0948] Step 10: Preparation of (R)-N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0949] To a solution of (R)-2-(3-(dimethoxymethyl)pyrrolidin-1-yl)-5-iodopyridine (300 mg, 0.86 mmol) in DMSO (10 mL) under nitrogen at 25 °C, N-(4-(4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (337 mg, 0.86 mmol), Na₂CO₃ (182 mg, 1.72 mmol), cuprous iodide (I) (82 mg, 0.43 mmol), and N,N-dimethylglycine (89 mg, 0.86 mmol) were added. The reaction mixture was stirred at 110 °C for 16 hours. The mixture was filtered and washed with DCM. The solution was concentrated under vacuum, and the residue was purified by rapid column chromatography (DCM:MeOH = 10:1) to give the desired product (460 mg, 87.2%) as a yellow solid. LC / MS: 612.7 [M+H] + .
[0950] Step 11: Preparation of (R)-N-(4-(4-amino-1-(6-(3-formylpyrrolidone-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0951] To a solution of (R)-N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)pyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (460 mg, 0.75 mmol) in anhydrous THF (2.5 mL), HCl (4,N, 2.5 mL in dioxane) was added. The reaction mixture was stirred at room temperature for 4 hours. The solvent was removed under vacuum, and the residue was dissolved in DCM. The organic phase was washed with NaHCO3 and brine, dried over Na2SO4, and concentrated under vacuum to give the title compound (300 mg, crude) as a yellow solid. LC / MS: 566.8 [M+H] + .
[0952] Step 12: Preparation of N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0953] To a solution of (R)-N-(4-(4-amino-1-(6-(3-formylpyrrolidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (300 mg, crude) in MeOH / DMF (12 mL, 2:1) under stirring at room temperature, (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (260 mg, 0.53 mmol) and Et3N (107 mg, 1.06 mmol) were added. The mixture was stirred at room temperature for 30 minutes, and then AcOH (1 mL) and NaBH3CN (134 mg, 2.12 mmol) were added. The reaction mixture was stirred at 60 °C for 1 hour under nitrogen. The mixture was diluted with water and extracted with DCM. The organic phase was washed with brine, dried over Na₂SO₄, and concentrated under vacuum. The residue was purified by prep-HPLC to give the desired compound (30.5 mg, 6.9%). LC / MS: 878.8 [M+H] + .
[0954] 1H NMR (400MHz, DMSO) δ=10.98 (s, 1H), 8.92 (t, J=6.0Hz, 1H), 8.70 (d, J=2.4Hz, 1H), 8.37 (s, 1H), 8.18 (d, J=8.8Hz, 1H), 7.73 (d, J=8.0Hz, 2 H), 7.61 (d, J = 8.4Hz, 1H), 7.57-7.50 (m, 3H), 7.39-7.33 (m, 1H), 7.23-7.15 (m, 3H), 6.71 (d, J = 8.8Hz, 1H), 5.07 (dd, J = 13.2, 4.8Hz, 1H), 4.61 (d, J=6.0Hz, 2H), 4.37 (d, J=17.2, 1H), 4.25 (d, J=17.2, 1H), 4.10-4.02 (m, 2H), 3.91 (s, 3H), 3.41-3.37 (m, 2H), 3.27-3.22 (m, 4H), 2.95-2.85 (m, 2H), 2.77 (d, J=5.2Hz, 2H), 2.65-2.55 (m, 1H), 2.45-2.30 (m, 2H), 2.27-2.24 (m, 2H), 1.98-1.93 (m, 2H), 1.91-1.85 (m, 2H).
[0955] Example 79: Preparation of N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 95)
[0956]
[0957] Step 1: Preparation of (S)-(1-(2-fluoro-4-nitrophenyl)pyrrolidine-3-yl)methanol
[0958] (3S)-pyrrolidine-3-ylmethanol hydrochloride (1.91 g, 13.8 mmol) and DIEA (4.89 g, 37.8 mmol) were added to a solution of 1,2-difluoro-4-nitrobenzene (2.0 g, 12.6 mmol) in CH3CN (30 mL). The reaction was stirred at 80 °C for 3 h, then quenched by adding water. The mixture was extracted with EA, washed with brine, and dried over Na2SO4. The solvent was removed under vacuum, and the residue was rapidly purified with PE:EA = 1:1 to give the desired product as a yellow solid (2.8 g, 90% purity, 82.5% yield). LC / MS: 241.1 [M+H] + .
[0959] Step 2: Preparation of (S)-(1-(4-amino-2-fluorophenyl)pyrrolidine-3-yl)methanol
[0960] Pd / C (0.28 g, 10%) was added to a solution of (S)-(1-(2-fluoro-4-nitrophenyl)pyrrolidine-3-yl)methanol (2.8 g, 90% purity, 10.5 mmol) in methanol (40 mL). The reaction was stirred at 25 °C for 16 h under a H₂ atmosphere of 1 atm. The catalyst was filtered off and washed with MeOH. The solution was concentrated under vacuum to give the desired product (2.2 g, 99.6%) as a brown oil. LC / MS: 211.1 [M+H] + .
[0961] Step 3: Preparation of (S)-(1-(2-fluoro-4-iodophenyl)pyrrolidine-3-yl)methanol
[0962] Concentrated HCl (2.5 mL) and NaNO2 (827 mg, 11.98 mmol, dissolved in 5 mL H2O) were added to a solution of (S)-(1-(4-amino-2-fluorophenyl)pyrrolidine-3-yl)methanol (2.1 g, 9.98 mmol) in CH3CN (30 mL) at 0 °C. The mixture was stirred at 0 °C for 2 h and KI (4.14 g, 24.97 mmol) was added. The reaction mixture was stirred at room temperature for 17 h. The reaction was quenched by adding water (40 mL) and extracted with EA (40 mL × 3). The organic phase was washed with brine and dried over Na2SO4. The solvent was removed under vacuum. The residue was rapidly purified with PE:EA = 3:1 to give the desired product (2 g, 62.3%) as a yellow solid. LC / MS: 321.8 [M+H] + .
[0963] Step 4: Preparation of (S)-1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carboxaldehyde
[0964] Add Desmond-Martin periodane (3.75 g, 8.8 mmol) to a solution of (S)-(1-(2-fluoro-4-iodophenyl)pyrrolidine-3-yl)methanol (1.9 g, 5.9 mmol) in DCM (20 mL). Stir the reaction at 25 °C for 2 h. Quench the reaction with saturated Na₂S₂O₃ solution and then extract with EA. Wash the organic phase with brine and dry over Na₂SO₄. Remove the solvent under vacuum and purify the residue rapidly with PE:EA = 1:1 to give the desired product as a white solid (2 g, 80% purity, 84.9% yield). LC / MS: 319.8 [M+H] + .
[0965] Step 5: Preparation of (S)-3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine
[0966] Acetyl chloride (1.04 g, 13.2 mmol) was added to a solution of (S)-1-(2-fluoro-4-iodophenyl)pyrrolidine-3-carboxaldehyde (2.0 g, 80% purity, 5.0 mmol) in MeOH (20 mL) under nitrogen and stirred at 0 °C. The reaction was stirred at 25 °C for 2 h. The reaction was quenched with TEA and the solvent was removed under vacuum. The residue was purified by rapid column chromatography using PE:EA = 1:1 to give the desired product (1.0 g, 90% purity, 49.2% yield) as a white solid. LC / MS: 365.7 [M+H] + .
[0967] Step 6: Preparation of (S)-N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0968] N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (257.89 mg, 0.65 mmol), Na₂CO₃ (127.72 mg, 1.2 mmol), cuprous iodide (I) (57.37 mg, 0.3 mmol), and N,N-dimethylglycine (62.13 mg, 0.6 mmol) were added to a solution of (S)-3-(dimethoxymethyl)-1-(2-fluoro-4-iodophenyl)pyrrolidine (220 mg, 90% purity, 0.54 mmol) in DMSO (10 mL) under nitrogen atmosphere and stirred at 25 °C. The reaction was stirred at 110 °C for 16 h. The mixture was filtered and washed with DCM. The solvent was removed under vacuum, and the residue was rapidly purified with DCM:MeOH = 10:1 to give the desired product as a yellow solid (170 mg, 90% purity, 44.1% yield). LC / MS: 629.8 [M+H] + .
[0969] Step 7: Preparation of (S)-N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidine-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0970] HCl (4N in dioxane, 4 mL) was added to a solution of (S)-N-(4-(4-amino-1-(4-(3-(dimethoxymethyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (170 mg, 90% purity, 0.24 mmol) in DCM (4 mL) under nitrogen atmosphere and stirred at 25 °C. The reaction mixture was stirred at 25 °C for 4 hours. The mixture was alkalized with saturated NaHCO3 solution and extracted with DCM. The organic phase was washed with brine and dried over Na2SO4. The solution was concentrated under vacuum to give the desired product (160 mg, crude) as a yellow solid. LC / MS: 583.8 [M+H] + .
[0971] Step 8: Preparation of N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0972] Add (S)-N-(4-(4-amino-1-(3-fluoro-4-(3-formylpyrrolidine-1-yl)phenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (150 mg, 0.25 mmol), TEA (52 mg, 0.51 mmol), and NaBH3CN (48 mg, 0.77 mmol) to a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidin-2,6-dione (150 mg, 0.3 mmol) in MeOH / DMF / AcOH (5 mL, 2:1:0.02). The reaction mixture was stirred at 60 °C for 1 hour. The reaction mixture was cooled to room temperature and then quenched with water. The mixture was extracted with DCM, washed with brine, dried over Na2SO4, and concentrated under vacuum. The residue was purified by Prep-TLC using DCM:MeOH = 10:1 to give the desired product (60 mg, 26.0%) as a white solid. LC / MS: 896.7 [M+H] + .
[0973] 1H NMR (400MHz,) δ10.92 (s, 1H), 8.86 (t, J=6.1Hz, 1H), 8.32 (,s, 1H), 7.89 (dd, J=15.2, 2.5Hz, 1H), 7.79 (dd, J=8.8, 2.0Hz, 1H), 7.69 (d, J=8.2H z, 2H), 7.52-7.47 (m, 4H), 7.34-7.28 (m, 1H), 7.16 (dd, J=9.1, 4.3Hz, 1H), 7.03, (d, J=8.2Hz, 2H), 6.84 (t, J=9.5Hz, 1H), 5.02 (dd, J=13.3, 5.1 Hz, 1H), 4.57, (d, J=6.1Hz, 2H), 4.30 (d, J=17.0Hz, 1H), 4.17 (d, J=17.0Hz, 1H), 3.88 (s, 3H), 3.51-3.45 (m, 1H), 3.42-3.37 (m, 2H), 3.27-3.25 (m, 3H), 3.21-3.11 (m, 2H), 2.90-2.81 (m, 1H), 2.60-2.52 (m, 6H), 2.41 -2.24 (m, 4H), 2.07-2.01 (m, 1H), 1.95-1.89 (m, 1H), 1.69-1.62 (m, 1H).
[0974] Example 80: Preparation of N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 96)
[0975]
[0976] Compound 96 was prepared using a procedure similar to that described for compound 95.
[0977] LC / MS: 896.6 [M+H] + .
[0978] 1H NMR (400MHz, DMSO) δ10.98 (s, 1H), 9.61 (bs, 1H), 8.93-8.90 (m, 1H), 8.38 (s, 1H), 7.99-7.85 (m, 2H), 7.73 (d, J = 8.2Hz , 2H), 7.63-7.50 (m, 4H), 7.39-7.33 (m, 1H), 7.20 (m, 3H), 6.94-6.89 (m, 1H), 5.07 (m, 1H), 4.61 (d, J=6.1Hz, 2H), 4.39- 4.35 (m, 1H), 4.26-4.22 (m, 1H), 4.08-4.02 (m, 2H), 3.91 (s, 3H), 3.74-3.63 (m, 3H), 3.54-3.36 (m, 4H), 3.28-3.13 (m, 5 H), 2.95-2.76(m,3H), 2.64-2.56(m,1H), 2.43-2.34(m,1H), 2.26-2.18(m,1H), 2.00-1.94(m,1H), 1.82-1.74(m,1H).
[0979] Example 81: Preparation of (S)-N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide (Compound 97)
[0980]
[0981] Step 1: Preparation of (1-(5-iodopyridin-2-yl)azacyclobutane-3-yl)methanol
[0982] A solution of 2-fluoro-5-iodopyridine (2.2 g, 9.86 mmol) in DMA (100 mL) under argon atmosphere at room temperature was supplemented with aziridine-3-ylmethanol (1.2 g, 9.86 mmol) and potassium carbonate (4.1 g, 29.59 mmol). The reaction mixture was stirred overnight at 100 °C. The reaction was quenched by adding water (50 mL) and extracted with DCM (50 mL × 3). The organic phase was washed with brine and dried over Na₂SO₄. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography with PE:EA = 5:1 to give the desired product (1.5 g, 52.4%) as a yellow solid. LC / MS: 290.8 [M + H] + .
[0983] Step 2: Preparation of 1-(5-iodopyridin-2-yl)azacyclobutane-3-carboxaldehyde
[0984] Add Desmond-Martin periodane (3 g, 7.24 mmol) to a solution of [1-(5-iodopyridin-2-yl)azacyclobutane-3-yl]methanol (1.4 g, 4.82 mmol) in DCM (80 mL) under stirring at room temperature. Stir the reaction mixture at room temperature for 4 hours. Remove the solvent under vacuum, and purify the residue rapidly with PE:EA = 5:1 to give the desired product (700 mg, 50.3%) as a yellow solid. LC / MS: 306.7 [M + H₂O] + .
[0985] Step 3: Preparation of 2-(3-(dimethoxymethyl)azacyclobutane-1-yl)-5-iodopyridine
[0986] Acetyl chloride (381 mg, 4.859 mmol) was added to a solution of 1-(5-iodopyridin-2-yl)azacyclobutane-3-carboxaldehyde (700 mg, 2.42 mmol) in MeOH (10 mL) under argon atmosphere and stirred at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched with TEA (1 mL). The solvent was removed under vacuum, and the residue was purified by rapid column chromatography with PE:EA = 5:1 to give the desired product (400 mg, 49.2%). LC / MS: 334.8 [M+H] + .
[0987] Step 4: Preparation of N-(4-(4-amino-1-(6-(3-(dimethoxymethyl)azacyclobutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0988] To a solution of 2-[3-(dimethoxymethyl)azacyclobutan-1-yl]-5-iodopyridine (200 mg, 0.59 mmol) in DMSO (13 mL) under nitrogen at 25 °C, N-[(4-{4-amino-1H-pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (282 mg, 0.71 mmol), Na₂CO₃ (139.5 mg, 1.31 mmol), cuprous iodide (I) (63 mg, 0.32 mmol), and N,N-dimethylglycine (67.89 mg, 0.65 mmol) were added. The reaction mixture was stirred overnight at 110 °C. The reaction was quenched by adding water (50 mL) and extracted with DCM (50 mL × 3). The organic phase was washed with brine and dried over Na₂SO₄. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography with DCM:MeOH = 10:1 to give the desired product (200 mg, 55.8%) as a white solid. LC / MS: 599.2 [M+H] + .
[0989] Step 5: Preparation of N-(4-(4-amino-1-(6-(3-formylazonylbutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0990] HCl / dioxane (10 mL) was added to a solution of N-{[4-(4-amino-1-{6-[3-(dimethoxymethyl)azacyclobutan-1-yl]pyridin-3-yl}pyrazolo[3,4-d]pyrimidin-3-yl)phenyl]methyl}-5-fluoro-2-methoxybenzamide (100 mg, 0.16 mmol) in DCM (10 mL) under stirring at room temperature. The reaction mixture was stirred overnight at room temperature. The solution was concentrated under vacuum to give the title compound (110 mg, crude) as a yellow solid. LC / MS: 553.2 [M+H] + .
[0991] Step 6: Preparation of (S)-N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide
[0992] TEA (37 mg, 0.36 mmol) and N-[(4-{4-amino-1-[6-(3-formylazonyl-1-yl)pyridinol-3-yl]pyrazolo[3,4-d]pyrimidin-3-yl}phenyl)methyl]-5-fluoro-2-methoxybenzamide (100 mg, 0.181 mmol) were added to a solution of (S)-3-(1-oxo-5-(piperazin-1-yl)isoindoline-2-yl)piperidine-2-dione (105.6 mg, 0.217 mmol) in MeOH (6 mL) / DMF (3 mL) stirred at room temperature under argon atmosphere. Then NaBH3CN (34 mg, 0.54 mmol) and AcOH (0.5 mL) were added. The reaction mixture was stirred at 60 °C for 1 hour. The reaction mixture was cooled to room temperature and quenched by adding water (10 mL). The mixture was extracted with DCM (10 mL × 3). The combined organic phases were washed with brine and dried over Na₂SO₄. The solvent was removed under vacuum, and the residue was purified by rapid chromatography with DCM:MeOH = 10:1 to give the desired product as a white solid (30 mg, 97.65% purity, 18.7% yield). LC / MS: 864.5 [M + H₂] + .
[0993] 1 H NMR (400MHz, DMSO) δ10.97 (s, 1H), 8.93 (t, J=6.0Hz, 1H), 8.69 (s, 1H), 8.32 (s, 1H), 8.17-8.10 (m, 1H), 7.72 (d, J =8.4Hz, 2H), 7.59-7.48 (m, 4H), 7.38-7.32 (m, 1H), 7.20 (dd, J=9.2, 4.3Hz, 1H), 7.15-7.00 (m, 2H), 6.56 (d, J=9.2 Hz, 1H), 5.06 (dd, J=13.2, 5.1Hz, 1H), 4.60 (d, J=6.0Hz, 2H), 4.40-4.05 (m, 5H), 3.91 (s, 3H), 3.80-3.62 (m, 2H), 3 .35-3.25(m, 3H), 3.20-2.80(m, 4H), 2.73-2.55(m, 4H), 2.43-2.35(m, 2H), 2.11-1.88(m, 2H), 1.25-1.20(m, 1H).
[0994] Testing the BTK activity of compounds
[0995] Example 82. BTK degradation activity of exemplary compounds of this disclosure in RAMOS cell lines.
[0996] RAMOS (ATCC) cells at 8 × 105 Cells / well were seeded in 24-well plates in RPMI growth medium containing 10% heat-inactivated FBS and 1x penicillin-streptomycin, and then incubated overnight at 37°C. The next day, the test compound was applied to the cells using 1000x compound stock solutions of different concentrations prepared in DMSO. After compound application, the cells were incubated at 37°C for 6 hours.
[0997] After completion, cells were collected by centrifugation and lysed in Laemmli sample buffer (1x; VWR International). Proteins in the cell lysates were separated by SDS-PAGE and used... ThermoFisher dry blot transfer system was used to transfer the membrane to an Odyssey nitrocellulose membrane (Licor). Nonspecific binding was blocked by incubating the membrane with intercept blocking buffer (Licor) at room temperature with gentle shaking for 1 hour. The membrane was then incubated overnight at 4°C with anti-BTK (cell signaling, catalog #8547) and anti-GAPDH (cell signaling, catalog #5179) primary antibodies diluted in intercept blocking buffer containing 0.1% Tween 20. After three washes with TBS-T, the membrane was... 800CW goat anti-mouse IgG (1:20,000, Licor) or Incubate with 800CW goat anti-rabbit IgG (1:20,000, Licor) for 1 hour. After TBS-T washing, rinse the membrane in TBS and... Scanning on a CLx imaging system (Licor). Using Image Studio. TM The software (Licor) quantifies the bands.
[0998] Figure 1 and Figure 2 The exemplary compounds 13, 25, 34, 42, 48, 49, 51, 53, 54, 78, 93 and 96 of this disclosure are shown to exhibit BTK degradation activity in the RAMOS cell line 6 hours after administration.
[0999] Table 3 summarizes the BTK degradation activity of the exemplary compounds of this disclosure in the RAMOS cell line 6 hours after administration. DC was calculated. 50 Value (i.e., the concentration of the test compound at which 50% of the target protein is degraded). The label "A" corresponds to a DC value less than 10 nM. 50 Value. The label "B" corresponds to a DC value greater than or equal to 10 nM and less than 100 nM. 50 Value. The label "C" corresponds to a DC value greater than or equal to 100 nM. 50 value.
[1000] Table 3
[1001]
[1002]
[1003]
[1004] Example 83.REC-1BTK C481S cell line generation
[1005] The BTK gene in the REC-1 cell line (ATCC) was edited using CRISPR-Cas9 technology to create a C-to-S point mutation at residue 481 of the BTK protein. For gene editing, Alt-R, CRISPR-Cas9, tracrRNA, and crRNA were first used to generate the BTK gene. C481S (5'-GUAGUUCAGGAGGCAGCCAU-3') (IDT-integrated DNA technology) was used to prepare a gRNA complex, and then BTK was prepared using the gRNA complex and Alt-R Sp Cas9 nuclease V3 (IDT-integrated DNA technology). C481S Ribonuclear protein (RNP) complex. Next, BTK is used. C481S RNP complex, Alt-R Cas9 electroporation enhancer, and BTKC481S Ultramer DNAOligo (5'-AGCTGCTGAGTCTGGAAGCGGTGGCGCATCTCCCTCAGATAGTTCAGGAGGGAGCCGTTGGCCATGTACTCAGTGATGATGAAGATGGGGCGCTGCTTGGTGCAG-3') (IDT-Integrated DNA Technology) were used with the Neon transfection system (Thermo Fisher) at 1400V, 10ms, and 3 pulses to transfect 1x10 5 REC-1 cells were electroporated. Cells were then placed in 96-well plates for 10 days and selected for 5 passages with 10 nM ibrutinib. The C481S mutation in BTK was further validated by Sanger sequencing using gDNA extracted from these cells.
[1006] Exemplary compounds of this disclosure in BTK-dependent REC-1 and REC-1BTK C481S Growth inhibitory activity in cell lines.
[1007] REC-1 (ATCC) and...
Claims
1. A compound or a pharmaceutically acceptable salt thereof, wherein the compound is selected from: (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(1-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)phenyl)azacyclobutane-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; (S)-N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide; and (S)-N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide.
2. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
3. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(4-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
4. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(1-(5-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyridin-2-yl)piperidin-4-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
5. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(6-(4-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)piperidin-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
6. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(4-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
7. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(6-(3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
8. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(4-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
9. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(6-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
10. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(6-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
11. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(4-((R)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
12. The compound of claim 1, wherein the compound is N-(4-(4-amino-1-(4-((S)-3-((4-(2-((S)-2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)pyrrolidine-1-yl)-3-fluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
13. The compound of claim 1, wherein the compound is (S)-N-(4-(4-amino-1-(6-(3-((4-(2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)piperazin-1-yl)methyl)azacyclobutane-1-yl)pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-3-yl)benzyl)-5-fluoro-2-methoxybenzamide, or a pharmaceutically acceptable salt thereof.
14. A pharmaceutical composition comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof and at least one additional component selected from pharmaceutically acceptable carriers, pharmaceutically acceptable mediators and pharmaceutically acceptable excipients.
15. The pharmaceutical composition of claim 14, wherein the compound or a pharmaceutically acceptable salt thereof is present in a therapeutically effective amount.
16. Use of the compound of any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of claim 14 or 15 in the preparation of a medicament for treating a condition regulated by Bruton's tyrosine kinase (BTK), wherein the condition is selected from B-cell malignancies.
17. The use according to claim 16, wherein the B-cell malignant tumor is selected from B-cell lymphoma and mantle cell lymphoma.
Citation Information
Patent Citations
Transdermal delivery of enantiomers of phenylpropanolamine
US4818541A
Transdermal delivery of pharmaceuticals
US5114946A
Pyrazolopyrimidine derivatives as BTK inhibitors for the treatment of cancer
CN108431007A
BTK inhibitor ring derivative, preparation method therefor and pharmaceutical application thereof
WO2020239103A1