A fusion protein with stable regulatory t cell differentiation, recombinant lentivirus and application

Abstract

The application provides a fusion protein with stable regulatory T cell differentiation, a recombinant lentivirus and application. The fusion protein comprises three domains, the first domain is a chemokine ligand, the second domain is an intermediate bridging domain, and the third domain is a bZIP factor of human T cell lymphotropic virus-1; the chemokine ligand is CCL17 or CCL22, the intermediate bridging domain is a flexible (GGGGS) 3 sequence; and the bZIP factor of human T cell lymphotropic virus-1 is HBZ. The fusion protein and the recombinant lentivirus both have the ability to promote the differentiation of initial T cells into Treg cells and promote the proliferation of Treg cells, and have application potential in the aspects of in vitro Treg cell culture expansion and the treatment of autoimmune diseases.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a fusion protein with stable regulatory T cell differentiation, a recombinant lentivirus, and their applications. Background Technology

[0002] Autoimmune diseases are difficult to cure. Once contracted, most patients require long-term or even lifelong medication, and some diseases (such as lupus nephropathy) are highly dangerous, severely impacting patients' quality of life and threatening their lives. Common autoimmune diseases include systemic lupus erythematosus, rheumatoid arthritis, type 1 diabetes, multiple sclerosis, autoimmune liver disease, and ankylosing spondylitis. Treatment for autoimmune diseases typically involves broad-spectrum immunosuppressants, such as corticosteroids. These immunosuppressants have significant side effects, including the risk of serious infections and tumor susceptibility. The complexity and heterogeneity of autoimmune responses pose a significant challenge to their clinical treatment.

[0003] Studies have shown that autoimmune diseases are closely related to the disorder of the number and function of regulatory T cells (Tregs), and many autoimmune diseases exhibit defects in Treg function and a reduction in their number. Tregs are a subset of CD4+ T cells that control autoimmune responses in the body, accounting for approximately 4%-12% of the peripheral CD4+ T cell population. Phenotypic characteristics include high expression of CD25 (the α subunit of the IL-2 receptor) and the transcription factor Forkhead box protein P3 (Foxp3), molecules that are crucial for Treg development, function, and stability. Tregs exert immunosuppressive effects through various mechanisms, including producing inhibitory cytokines IL-10, IL-35, and TGF-β to inhibit the activation of conventional T cells (Tcon) and dendritic cells, inhibiting T cell proliferation, inhibiting antigen-presenting cell (APC) expression of antigen-presenting molecules, and expressing inhibitory receptors such as CTLA-4, PD1, and TIGIT to block antigen-presenting cell maturation and T cell activation.

[0004] In recent years, numerous clinical trials have confirmed the safety and feasibility of Treg-based cell therapy for the treatment of autoimmune diseases. Treg cell therapy aims to increase the number of Tregs to regulate the body's immune homeostasis. It is estimated that this inhibitory effect requires the infusion of millions to billions of Treg cells. However, the main obstacle to the clinical application of Tregs in humans is their low circulating number in peripheral blood. Therefore, in vitro expansion of the small number of obtained Treg cells is a crucial prerequisite for the successful implementation of cell therapy. However, in vitro expansion of Treg cells faces two main problems: first, due to the instability of Tregs, the expansion efficiency is low, and it is impossible to obtain large quantities of stable Tregs in vitro; second, due to the plasticity of Tregs, infused Tregs may transform into other T cell subsets. Therefore, from a technical perspective, finding a more cost-effective method for in vitro Treg expansion is currently a major challenge in the development of Treg cell therapy technology.

[0005] Human T-cell troponin-1 (HTLV-1) is a retrovirus that causes adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy. The HTLV-1 basic leucine zipper protein (HTLV-1bZIP, HBZ) is a synthetic antisense transcript encoded by the 3′LTR of its negative genome, constitutively expressed in all ATL cases and HTLV-1 infected individuals. In vitro and in vivo experiments have shown that the HBZ gene promotes T-cell proliferation and increases T-cell numbers. In HBZ transgenic mice, the number of CD4+ T cells expressing FoxP3 is significantly increased. HBZ induces FoxP3 gene transcription through interactions with Smad2 / 3 and the co-stimulatory molecule p300, thereby increasing the number of CD4+FoxP3+ T cells. The HBZ protein contains three functional domains: (1) the N-terminal activation domain (HBZ-AD), which is the region that binds to transcription factors; (2) the central domain (HBZ-CD), which is the region that binds to Foxp3; and (3) the bZIP domain, located at the C-terminus, which is responsible for interacting with DNA and other bZIP transcription factors.

[0006] The N-terminal activation domain of HBZ can activate TGF-β / Smad signaling, further inducing Foxp3 expression. Studies have shown that HTLV-1 virus mainly infects CD4+ T cells, giving infected cells effector regulatory T cell (eTreg)-like characteristics, i.e., expressing immune markers such as CD4+, CD25+, CCR4, TIGIT, and Foxp3. HBZ can also induce infected cells to transform into Treg-like cells capable of secreting IL-10 through IL-10 / STAT signaling, promoting Treg proliferation. Treg cells highly express the chemokine CCR4 receptor, while CC chemokine ligands 17 (CCL17) and 22 (CCL22) are ligands of CCR4. CCL17, CCL22, and CCR4 play important roles in homeostasis and inflammation, and previous studies have shown that IL-4 gene therapy can enhance the production of CCL1, CCL17, and CCL22 and increase the recruitment of protective Tregs. Studies have found that IFN-γ production is increased in both HTLV-1 infected cells and HBZ transgenic (HBZ-Tg) mice, and can increase T cell infiltration through the IFN-γ-CCL17 / 22-CCR4 cascade. This suggests that the CCL17 / CCL22-CCR4 signaling response plays a crucial role in the further immune function of Tregs. Summary of the Invention

[0007] To address the problems existing in the prior art, the present invention aims to provide a fusion protein with stable regulatory T cell differentiation, a recombinant lentivirus, and its applications.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] This invention provides a fusion protein with stable regulatory T cell differentiation. The fusion protein includes three domains: the first domain is a chemokine ligand, the second domain is an intermediate bridging domain, and the third domain is the bZIP factor of human T-cell troponin virus-1.

[0010] The chemokine ligand is CCL17 or CCL22, and the intermediate bridging domain is a flexible (GGGGS)3 sequence; the human T-cell troponin-1 bZIP factor is HBZ.

[0011] Preferably, the third structural domain is the full length or a segment of HBZ.

[0012] Preferably, the chemokine ligand is CCL22, the fusion protein is a CCL22-HBZ fusion protein, and the amino acid sequence of the CCL22-HBZ fusion protein is shown in SEQ ID NO:2.

[0013] The present invention provides a gene encoding the fusion protein.

[0014] Preferably, the gene sequence encoding the CCL22-HBZ fusion protein is shown in SEQ ID NO:1.

[0015] The present invention provides a recombinant lentiviral expression vector obtained based on the gene, wherein the recombinant lentiviral expression vector contains the HBZ gene.

[0016] Preferably, the method for obtaining the HBZ gene is as follows:

[0017] (1) The CCL22-HBZ gene was synthesized in its entirety, and after double enzyme digestion, it was ligated into the pET32a expression vector to construct the recombinant expression vector pET32a-CCL22-HBZ;

[0018] (2) Using the recombinant expression vector pET32a-CCL22-HBZ as a template, primers were designed and the HBZ gene was obtained by PCR amplification.

[0019] The present invention provides a recombinant lentivirus comprising the recombinant lentivirus expression vector.

[0020] This invention provides an application of the fusion protein or recombinant lentivirus in the differentiation of stable regulatory T cells.

[0021] This invention provides the use of the fusion protein or recombinant lentivirus in the preparation of a medicament for treating immune diseases.

[0022] Beneficial effects:

[0023] This invention fuses the complete HBZ protein with the CCR4 ligand CCL22 to obtain the fusion protein CCL22-HBZ. The CCL22-HBZ fusion protein includes three domains: the first domain is CCL22 (chemokine ligand 22), the second domain is an intermediate bridging domain, namely (GGGGS)3, and the third domain is the full length of HBZ (i.e., the HTLV-1bZIP factor) or any part of the HBZ domain.

[0024] The fusion protein and recombinant lentivirus of this invention both have the ability to promote the differentiation of naive T cells into Treg cells and to promote the proliferation of Treg cells, and have potential applications in the in vitro Treg cell culture and expansion and in the treatment of autoimmune diseases. Attached Figure Description

[0025] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. Wherein:

[0026] Figure 1 This is a schematic diagram of the CCL22-HBZ protein structure of the present invention;

[0027] Figure 2 The results of agarose gel electrophoresis were used to detect the recombinant plasmid pET32a-CCL22-HBZ digested with BamHI and XhoI.

[0028] Among them, 1: DL 2000 DNA Marker, 2-5: the results of double digestion of clones 1-4 of the pET32a-CCL22-HBZ recombinant plasmid with BamHI and XhoI, all 4 clones were digested and yielded target bands of about 1000bp.

[0029] Figure 3 The results of SDS-PAGE analysis of the induction expression of CCL22-HBZ fusion protein in E. coli BL21(DE3) were used to analyze the expression of the protein.

[0030] Among them, 1-9 are, in order, the molecular weight standard of the unstained protein, the cytoplasmic precipitation fraction of clone 1 + IPTG, the cytoplasmic precipitation fraction of clone 1 (without IPTG), the cytoplasmic precipitation fraction of clone 2 + IPTG, the cytoplasmic precipitation fraction of clone 2 (without IPTG), the soluble cytoplasmic fraction of clone 1 + IPTG, the soluble cytoplasmic fraction of clone 1 (without IPTG), the soluble cytoplasmic fraction of clone 2 + IPTG, and the soluble cytoplasmic fraction of clone 2 (without IPTG). Among them, the target protein band is found at about 55kDa in the precipitation fractions of lanes 2 and 4.

[0031] Figure 4 SDS-PAGE analysis of CCL22-HBZ protein extraction results;

[0032] Among them, 1-5 are the molecular weight standard of unstained protein, the supernatant of ultrasonic disruption, the first wash of cytoplasmic precipitation, the second wash of cytoplasmic precipitation, and the inclusion body component, respectively.

[0033] Figure 5 SDS-PAGE analysis was performed to isolate and purify CCL22-HBZ protein using affinity chromatography.

[0034] Among them, 1 is the molecular weight standard of non-prestained protein, and 2-10 are the inclusion body protein sample, permeation solution, Binding buffer washing component, Washing buffer washing component, Elution 1, Elution 2, Elution 3, Elution 4, and Elution 5 components, respectively.

[0035] Figure 6Western blot analysis of CCL22-HBZ protein isolated and purified by affinity chromatography column;

[0036] Among them, 1-11 are respectively the prestained protein molecular weight standard, Elution 5, Elution 4, Elution 3, Elution 2, Elution 1, washing buffer, binding buffer, permeation solution, inclusion body protein sample, and prestained protein molecular weight standard.

[0037] Figure 7 Results of SDS-PAGE analysis of refolded and concentrated CCL22-HBZ protein;

[0038] Among them, 1: non-prestained protein molecular weight standard, 2: 15μl concentrated CCL22-HBZ protein solution;

[0039] Figure 8 A standard curve for protein concentration determination using the BCA method;

[0040] Figure 9 To detect the effect of CCL22-HBZ protein on the differentiation of Treg cells in vitro by flow cytometry;

[0041] Among them, Group A: Anti-CD3 / Anti-CD28 / IL-2 / TGF-β stimulation group, and Group B: Anti-CD3 / Anti-CD28 / IL-2 / TGF-β + (0.2pg / cell) CCL22-HBZ protein co-stimulation group;

[0042] Figure 10 Image of the pTRIP-CMV-pur lentiviral vector;

[0043] Figure 11 The results of double enzyme digestion of the recombinant lentiviral vector pTRIP-CMV-pur-HBZ were detected by agarose gel electrophoresis.

[0044] Among them, 1 is the DL 2000 DNA Marker, and 2-5 are the EcoRI and BamHI digestion results of clones 1-4 of the pTRIP-CMV-pur-HBZ plasmid, respectively. The target fragment was digested at about 600bp in all four clones.

[0045] Figure 12 The results of RT-PCR detection of HBZ recombinant lentivirus titer were analyzed by agarose gel electrophoresis.

[0046] Among them, 1 is the DL 2000 DNA Marker, and 2-7 are the control group and 10, respectively. 1 10 0 10-1 10 -2 10 -3 Amplification results of HBZ and actin genes at different dilutions. Actin gene was used as an internal control gene.

[0047] Figure 13 The results of quantitative real-time PCR were used to detect the expression level of HBZ in naïve CD4+ T cells after infection with recombinant HBZ lentivirus.

[0048] Figure 14 To detect the effect of HBZ recombinant lentiviral protein on the differentiation of Treg cells in vitro by flow cytometry;

[0049] Group A: Anti-CD3 / anti-CD28 / IL2 / TGF-β+ empty lentivirus; Group B: Anti-CD3 / anti-CD28 / IL2 / TGF-β+ recombinant HBZ lentivirus. Detailed Implementation

[0050] The technical solutions in the embodiments of the present invention will be clearly and completely described below.

[0051] The fusion protein provided by this invention will be implemented through the following specific embodiments, described in detail with reference to the accompanying drawings. It is worth noting that, because CCR4 exists on the surface of regulatory T cells, and both CCL22 and CCL17 are ligands of CCR4, the fusion protein CCL22-HBZ of this invention utilizes the binding of CCL22 to CCR4 to deliver the HBZ protein into regulatory T cells. Therefore, CCL17 can also achieve this purpose. Furthermore, the experiments of this invention involve the full-length HBZ, but some fragments also have similar functions. Therefore, fusion genes combining CCL17 / CCL22 with the full-length HBZ or any fragment thereof are all within the scope of protection of this invention, and all similar modifications are included in this invention.

[0052] The present invention will now be described in detail with reference to embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of the present invention can be combined with each other.

[0053] To address the existing problems, this invention provides a fusion protein with stable regulatory T cell differentiation. The fusion protein includes three domains: the first domain is a chemokine ligand, the second domain is an intermediate bridging domain, and the third domain is the bZIP factor of human T-cell troponin virus-1.

[0054] The chemokine ligand is CCL17 or CCL22, and the intermediate bridging domain is a flexible (GGGGS)3 sequence; the human T-cell troponin-1 bZIP factor is HBZ.

[0055] In a preferred embodiment of the present invention, the chemokine ligand is CCL22, the fusion protein is a CCL22-HBZ fusion protein, and the third domain is the full length or a fragment of HBZ.

[0056] In a preferred embodiment of the present invention, the amino acid sequence of the CCL22-HBZ fusion protein is shown in SEQ ID NO:2.

[0057] The present invention provides a gene encoding the fusion protein.

[0058] In a preferred embodiment of the present invention, the gene sequence encoding the CCL22-HBZ fusion protein is shown in SEQ ID NO:1.

[0059] The present invention provides a recombinant lentiviral expression vector containing the HBZ gene.

[0060] In a preferred embodiment of the present invention, the method for obtaining the HBZ gene is as follows:

[0061] (1) The CCL22-HBZ gene was synthesized in its entirety, and after double enzyme digestion, it was ligated into the pET32a expression vector to construct the recombinant expression vector pET32a-CCL22-HBZ;

[0062] (2) Using the pET32a-CCL22-HBZ recombinant expression vector as a template, primers were designed and the HBZ gene was obtained by PCR amplification.

[0063] The present invention provides a recombinant lentivirus comprising the recombinant lentivirus expression vector.

[0064] This invention provides the application of a fusion protein or recombinant lentivirus in the differentiation of stable regulatory T cells.

[0065] This invention provides the application of a fusion protein or recombinant lentivirus in the preparation of a drug for treating immune diseases.

[0066] This invention was obtained through the following experimental methods:

[0067] The CCL22-HBZ gene was synthesized and, after double enzyme digestion, ligated into the pET32a expression vector to construct the recombinant expression vector pET32a-CCL22-HBZ. This recombinant plasmid was then transformed into *E. coli* BL21(DE3), and the expression of the CCL22-HBZ fusion protein was induced by the addition of IPTG. The expression of the CCL22-HBZ fusion protein was detected as inclusion bodies in the cytoplasm of *E. coli* cytoplasm. Large-scale fermentation of *E. coli* containing the pET32a-CCL22-HBZ plasmid was performed. The bacterial cells were collected by centrifugation, and the bacteria were sonicated and then processed using Nitrogen peroxide (NiO2). 2+CCL22-HBZ protein was purified by affinity chromatography, and finally, an active, soluble protein was obtained by stepwise refolding.

[0068] Effect of CCL22-HBZ protein on Treg-induced differentiation: CCL22-HBZ protein was isolated from mouse spleens using immunomagnetic bead sorting. CD4+ T cells, in vitro In the CD4+ T cell culture experiment, CCL22-HBZ protein was added, and the proportion of Treg cells was detected by flow cytometry. The expression level of Foxp3 in Treg cells was detected by real-time quantitative PCR.

[0069] Construction of recombinant lentivirus containing the HBZ gene and its effect on Treg-induced differentiation: The HBZ gene was amplified by PCR and introduced into EcoRI and BamHI restriction sites. After double digestion, it was inserted into the pTRIP-CMV-pur vector to construct the recombinant expression vector pTRIP-CMV-pur-HBZ. This vector, along with the pMD2.G and psPAX2 packaging plasmids, was co-transfected into 293T cells to obtain packaged mature recombinant lentivirus. The lentivirus was then used to infect and isolate cells from mouse spleens. CD4+ T cells, the proportion of Treg cells was detected by flow cytometry.

[0070] The following detailed description of a fusion protein with stable regulatory T cell differentiation, a recombinant lentivirus, and its applications, through specific embodiments, illustrates the present invention.

[0071] Example 1: Construction of recombinant expression plasmid pET32a-CCL22-HBZ

[0072] 1.1 Cloning of the CCL22-HBZ gene

[0073] The CCL22-HBZ fusion protein in this embodiment consists of three domains, such as Figure 1 As shown, from the N-terminus to the C-terminus are chemokine ligand 22 (CCL22), linker peptide (GGGGS)3, and HTLV-1bZIP factor (HBZ).

[0074] Based on the protein sequences of CCL22 (GenBank ID: EAW82918.1) and HBZ (GenBank ID: QTW97412.1) in GenBank, the CCL22-HBZ gene sequence was designed. After codon optimization for E. coli preferred codons, the CCL22-HBZ gene was synthesized by Beijing New Era Biotechnology Co., Ltd., and BamHI and XhoI restriction enzyme sites were introduced. The gene was double-digested with BamHI and XhoI, and the pET32a plasmid was also double-digested with BamHI and XhoI. The digestion products were subjected to agarose gel electrophoresis, and the target band was then excised and recovered. The recovered pET32a fragment was ligated into the CCL22-HBZ gene to construct the recombinant expression plasmid pET32a-CCL22-HBZ, which was then transformed into E. coli DH5α competent cells.

[0075] 1.2 Transformation of *E. coli* DH5α competent cells with the pET32a and CCL22-HBZ ligation products:

[0076] Remove 100 μl of E. coli DH5α competent cells from a -80°C freezer and place them on ice for 10 minutes to completely thaw. Add the pET32a and CCL22-HBZ ligation products to the thawed competent cells, mix gently, and then place them back on ice for 30 minutes. Then heat in a 42°C water bath for 90 seconds, followed by an ice bath for 3 minutes to obtain the transformation culture.

[0077] Add 900 μl of SOC medium to the transformed bacterial culture and mix well. Then, incubate at 37°C and 190 rpm for 1 hour. Spread 200 μl of the bacterial culture onto LB solid medium containing ampicillin (Amp) and incubate upside down at 37°C for 16 hours. Observe the colony growth on the plates to obtain pET32a-CCL22-HBZ single clones.

[0078] 1.3 Extraction and Identification of pET32a-CCL22-HBZ Recombinant Plasmid

[0079] Four pET32a-CCL22-HBZ monoclonal antibodies were randomly selected from the plate and inoculated into 10 ml of LB medium containing ampicillin (50 μg / ml). The cultures were incubated overnight at 37°C with shaking at 190 rpm. The pET32a-CCL22-HBZ recombinant plasmid was extracted using a plasmid mini-extraction kit from Tiangen Biotech. 100 ng of the extracted pET32a-CCL22-HBZ recombinant plasmid was then double-digested with BamHI and XhoI for verification.

[0080] The results are as follows Figure 2 As shown, four pET32a-CCL22-HBZ monoclonal antibodies ( Figure 2 Each of the recombinant plasmids (numbered 2-5) yielded a fragment of approximately 1000 bp, indicating successful construction of the recombinant plasmid. One of the recombinant plasmids, pET32a-CCL22-HBZ, was randomly selected and sent to BGI Genomics for sequencing to confirm the accuracy of the final expression vector.

[0081] Sequencing results showed that the successfully constructed CCL22-HBZ gene (SEQ ID NO:1) is 948 bp in length, including a 276 bp CCL22 gene, a 45 bp linker peptide, a 615 bp HBZ gene, and a 12 bp restriction enzyme site. The CCL22-HBZ protein (SEQ ID NO:2) encoded by this gene consists of 316 amino acids and has a molecular weight of 36047 Da.

[0082] When expressed, the CCL22-HBZ protein carries a Trx tag, a hexahistine tag, and an S tag from the pET32a vector at its N-terminus, and a hexahistine tag from the pET32a vector at its C-terminus. Therefore, the mature protein consists of 485 amino acids, and its amino acid sequence is shown in SEQ ID NO:3. Its molecular weight is 54429 Da.

[0083] SEQ ID NO:1

[0084] GGATCCGCACGCCTGCAGACCGCACTGCTGGTTGTTCTGGTTCTGCTGGCAGTTGCACTGCAGGCCACCGAAGCAGGTCCGTATGGTGCAAATATGGAAGATAGCGTTTTGTTGCCGTGATTATGTTCGTTATCGTCTGCCG CTGCGTGTTGTTAAACACTTTTATTGGACCAGCGATAGCTGTCCGCGTCCGGGTGTTGTTCTCTGACCTTTCGTGATAAAGAAATTTGTGCAGATCCGCGTGTTCCGTGGGTTAAAATGATTCTGAATAAACTGAGCCAA GGTGGTGGTGGTAGCGGT GGTGGCGGTTCAGGTGGCGGTGGTTCAGCAGCAAGCGGTCTGTTTCGTTGTCTGCCGGTTCCGTGTCCGGAAGATCTGCTGGTAGAAGAACTGGTTGATGGTCTGCTGAGCCTGGAAGAGGAACTGAAAGATAAAGAAGAAGAGGAAGCCGTTCTGGACGGTCTGCTGTCACTTGAAGAAGA AAGTCGCGGTCGTCTGCGTCGTGGTCCGCCTGGTGAAAAGCACCGCCTCGTGGTGAAACCCATCGTGATCGTCAGCGTCGCGCAGAAGAAAAACGTAAACGTAAAAGAACGCGAAAGGAGGAAGAAAAGCAGATTGCCGAATACCTGAAAC GCAAAGAAGAAGAAAGCACGTCGTCGTATGCAGGCAGAAAAAAAAGCAGCAGATGTTGCACCGCGTAAACAAGAGGAACAAGAACGTCGTGAACGTAAATGGCGTCAGGGTGCAGAAAGCCAAACAGCATAGCGCACGTAAAGAAAAAATG CAAGAACTGGGTATTGATGGCTATACCCGTCAGCTGGAAGGTGAAGTTGAAAGTCTGGAAGCCGAACGTCGTAAACTGCTGCAAGAAAGAAGATCTGATGGGCGAAGTGAATTATTGGCAGGGTCGCCTGGAAGCAATGTGGCTGCAGCTCGAG

[0085] SEQ ID NO:2

[0086] GSARLQTALLVVLVLLAVALQATEAGPYGANMEDSVCCRDYVRYRLPLRVVKHFYWTSDSCPRPGVVLLTFRDKEICADPRVPWVKMILNKLSQGGGGSGGGGSGGGGSAASGLFRCLPVPCPEDLLVEELVDGLLSLEEELKDKEEEEAVLDGLLSLEEESRGRLRRGPPGEKAPPRGETHRDRQRRAEEKRKRKKEREKEEEKQIAEYLKRKEEEKARRRMQAEKKAADVAPRKQEEQERRERKWRQGAEKAKQHSARKEKMQELGIDGYTRQLEGEVESLEAERRKLLQEKEDLMGEVNYWQGRLEAMWLQLE

[0087] SEQ ID NO:3

[0088]

[0089]

[0090] In SEQ ID NO:3, the straight underlined parts are the N-terminal Trx tag, hexahistine tag, and S tag, respectively; the wavy underlined part is the CCL22-HBZ protein; and the dashed underlined part is the C-terminal hexahistine tag.

[0091] Example 2: Induction of expression of fusion protein CCL22-HBZ in Escherichia coli

[0092] 2.1 Transformation of the pET32a-CCL22-HBZ recombinant plasmid into E. coli BL21(DE3) competent cells:

[0093] Take 100 μl of one E. coli BL21(DE3) competent cell from a -80°C freezer and place it on ice for 10 minutes to completely thaw the competent cells. Add 100 ng of the pET32a-CCL22-HBZ recombinant plasmid (obtained in Example 1) to the thawed competent cells, mix gently, and then place it on ice again for 30 minutes. Then heat in a 42°C water bath for 90 seconds, followed by an ice bath for 3 minutes to obtain the transformation culture.

[0094] Add 900 μl of SOC medium to the transformed bacterial culture and mix well. Then, incubate at 37°C and 190 rpm for 1 hour. Spread 100 μl of the bacterial culture onto LB agar plates containing ampicillin and incubate upside down at 37°C for 16 hours. Observe the colony growth on the plates to obtain single colonies.

[0095] Two single clones were picked from the plate and inoculated into LB medium containing ampicillin (50 μg / ml). After incubation at 37°C and 190 rpm overnight, the bacterial culture (i.e., the bacterial culture containing the pET32a-CCL22-HBZ recombinant plasmid) was stored at -80°C.

[0096] 2.2 Low-level induction of CCL22-HBZ protein expression

[0097] The bacterial culture containing the pET32a-CCL22-HBZ recombinant plasmid was removed from the -80℃ freezer, thawed, and 100 μl was inoculated into 10 ml of LB liquid medium containing ampicillin. The culture was incubated overnight at 37℃ with shaking at 190 rpm. The next day, the bacterial culture was transferred to 100 ml of LB liquid medium containing ampicillin at a volume ratio of 1:100 and incubated at 37℃ with shaking until OD600 = 1.0. The bacterial culture was then aliquoted into two Erlenmeyer flasks. One flask was treated with IPTG to a final concentration of 1 mmol / L, while the other was not treated with IPTG. Both flasks were incubated at 37℃ with shaking for 4 h.

[0098] 2.3 Localization analysis of CCL22-HBZ fusion protein in Escherichia coli:

[0099] Centrifuge the bacterial culture, whether IPTG-induced or not, at 4°C and 5000 rpm for 10 min, and discard the supernatant. Resuspend the bacterial pellet in 10 ml of 20 mmol / L Tris-HCl (pH 7.5), and sonicate on ice for 30 min at 260 W for 6 seconds, stop for 6 seconds, then centrifuge at 4°C and 10,000 rpm for 10 min. Transfer the supernatant to a new centrifuge tube and store at 4°C for later use (ultrasonic disruption supernatant). Resuspend the pellet in 10 ml of 1% (wt) SDS (sodium dodecyl sulfate) to obtain the ultrasonic disruption pellet.

[0100] Take 200 μl each of the sonication supernatant (cytoplasmic soluble protein fraction) and the sonication precipitate (cytoplasmic insoluble protein fraction), add 50 μl of 5×SDS loading buffer, mix well, and denature in a boiling water bath for 5 min. Take 40 μl of each sample for SDS-PAGE electrophoresis. After electrophoresis, stain with Coomassie Brilliant Blue R250. After staining, destain repeatedly with destaining solution until the protein bands are clear.

[0101] The results are as follows Figure 3 As shown, a specific protein band of approximately 55 kDa appeared in the ultrasonically disrupted sample (i.e., cytoplasmic precipitate + IPTG) after IPTG induction. This is because the N-terminus of the CCL22-HBZ protein is also fused with a Trx tag (approximately 12 kDa), a hexahistine tag (approximately 0.7 kDa), and an S tag (approximately 1.7 kDa) from the pET32a vector. This indicates that the fusion protein CCL22-HBZ is expressed in the form of insoluble inclusion bodies.

[0102] Example 3: Large-scale induction and extraction of CCL22-HBZ fusion protein

[0103] Escherichia coli containing the pET32a-CCL22-HBZ recombinant plasmid (obtained in 2.1 of Example 2) was inoculated into 200 ml of LB / c ampicillin medium and cultured overnight at 37°C with shaking at 190 rpm. The next day, 200 ml of the bacterial culture was transferred to 2000 ml of LB / c ampicillin medium and cultured at 37°C with shaking at 190 rpm until OD600 = 1.0. IPTG was added to a final concentration of 1 mmol / L, and the culture was continued at 37°C with shaking at 190 rpm for 4 hours.

[0104] Transfer the bacterial culture in batches to centrifuge tubes and centrifuge at 5000 rpm for 10 min at 4°C. Discard the supernatant. Weigh the bacterial pellet and resuspend it in sonication buffer at a ratio of 10 ml per gram of bacterial pellet (the sonication buffer consists of: 20 mmol / L Tris-HCl (pH 7.5), 1 mmol / L EDTA, 500 mmol / L NaCl, and 5% (v / v) glycerol).

[0105] The inclusion bodies were sonicated on ice at 260W for 6 seconds, followed by a 6-second pause, for a total of 50 minutes. The mixture was then transferred to a centrifuge tube and centrifuged at 10,000 rpm for 15 minutes at 4°C. The supernatant was retained for later use (ultrasonication supernatant). The precipitate was resuspended in an equal volume of inclusion body washing buffer (20 mmol / L Tris-HCl (pH 7.5), 1 mmol / L EDTA, 500 mmol / L NaCl, 1% Triton X-100, 2 mol / L urea). The inclusion bodies were then washed, and the mixture was centrifuged at 10,000 rpm for 15 minutes at 4°C. The supernatant was retained for later use (first wash supernatant). The precipitate was washed a second time with inclusion body washing buffer, centrifuged at 10,000 rpm for 15 min at 4 °C, and the supernatant was kept for later use (second wash supernatant). The precipitate was resuspended in 100 ml of binding buffer (binding buffer includes: 20 mmol / L Tris-HCl (pH 7.5), 500 mmol / L NaCl, 10 mmol / L imidazole, 8 mol / L urea) to obtain the bacterial suspension resuspended in binding buffer.

[0106] Take 200 μl each of the sonicated supernatant, the first wash supernatant (first wash fraction of cytoplasmic pellet), the second wash supernatant (second wash fraction of cytoplasmic pellet), and the bacterial suspension resuspended in binding buffer (inclusion body fraction). Add 50 μl of 5×SDS loading buffer and mix well. Denature in a boiling water bath for 5 min. Take 40 μl of each sample for SDS-PAGE electrophoresis. After electrophoresis, stain with Coomassie Brilliant Blue R250. After staining, destain repeatedly with destaining solution until the protein bands are clear.

[0107] The results are as follows Figure 4 As shown, CCL22-HBZ protein was present in the precipitate sample after ultrasonic disruption. After washing twice with inclusion body washing buffer, most of the impurities were washed away, and a small amount of the target CCL22-HBZ protein was also washed away. Finally, the inclusion body protein was resuspended in binding buffer containing 8 mol / L urea to prepare a protein sample. The sample had a high content of the target protein and few impurities, which is beneficial for the next step of purification.

[0108] Example 4: Purification of CCL22-HBZ fusion protein

[0109] Since the CCL22-HBZ protein has hexahistine tags at both the N-terminus and C-terminus, Ni is used for the purification of the target protein. 2+ Affinity chromatography. The protein sample (obtained in Example 3) dissolved in the binding buffer was filtered through a disposable filter with a pore size of 0.45 μm, and the filtered protein sample was stored for later use.

[0110] Connect the HisTrap HP column (GE Healthcare) to the peristaltic pump. First, rinse the affinity chromatography column with 25 ml of deionized water, then rinse it with 25 ml of binding buffer containing 10 mmol / L imidazole. Then, load the filtered protein sample onto the column; the liquid that flows out at this point is labeled as the permeate.

[0111] The column was washed with 25 ml of binding buffer (20 mmol / L Tris-HCl (pH 7.5), 500 mmol / L NaCl, 10 mmol / L imidazole, 8 mol / L urea). The effluent was labeled as the Binding buffer wash fraction.

[0112] The column was washed with 25 ml of washing buffer (20 mmol / L Tris-HCl (pH 7.5), 500 mmol / L NaCl, 50 mmol / L imidazole, 8 mol / L urea), and the effluent was labeled as the Washing Buffer.

[0113] The target protein adsorbed on the column was eluted using 30 ml of elution buffer (20 mmol / L Tris-HCl (pH 7.5), 500 mmol / L NaCl, 500 mmol / L imidazole, 8 mol / L urea). The eluent was collected in 5 tubes, each containing approximately 6 ml. The fractions were labeled Elution 1, Elution 2, Elution 3, Elution 4, and Elution 5, respectively.

[0114] Finally, rinse the column thoroughly with approximately 50 ml of deionized water. If the column will not be used for an extended period, it should be kept with an appropriate amount of 20% ethanol. Take 120 μl of each of the following: protein sample, collected permeation buffer, binding buffer wash fraction, washing buffer wash fraction, and solutions 1, 2, 3, 4, and 5. Simultaneously, add 30 μl of 5×SDS-PAGE loading buffer to each solution and denature in a boiling water bath for 5 min. Perform SDS-PAGE electrophoresis on 40 μl of each sample. After electrophoresis, stain with Coomassie Brilliant Blue R250. After staining, destain repeatedly with destaining solution until the protein bands are clear.

[0115] The results are as follows Figure 5 As shown, the target protein CCL22-HBZ in the sample was adsorbed onto the HisTrap HP column when it flowed through the column, therefore the target protein was not present in the permeate. After washing with binding buffer and washing buffer, other proteins were washed away, and finally the target CCL22-HBZ protein was eluted with elution buffer containing 500 mmol / L imidazole.

[0116] Example 5: Western blot identification of CCL22-HBZ fusion protein

[0117] The protein sample, collected permeation buffer, binding buffer wash fraction, washing buffer elution fraction, and Elutions 1, 2, 3, 4, and 5 (obtained in Example 4) were subjected to SDS-PAGE electrophoresis. The protein was then electrotransferred onto a PVDF membrane. The membrane was first blocked in 5% skim milk for 2 hours, then incubated overnight at 4°C with mouse anti-His-tag monoclonal antibody (1:1000 v / v). The PVDF membrane was then washed three times in TBST buffer for 10 minutes each time. The membrane was then incubated with HRP-labeled goat anti-mouse IgG secondary antibody (1:5000 v / v) at room temperature for 1 hour, followed by washing three times in TBST buffer for 10 minutes each time. Immobilon Western HRP substrate (Millipore) solutions A and B were mixed at a volume ratio of 1:1 and then dropped onto the membrane to cover the entire PVDF membrane. The membrane was then placed into a chemiluminescent gel imaging system AI680 (GE) for imaging and photography.

[0118] The results are as follows Figure 6 As shown, the CCL22-HBZ protein can be recognized by the anti-His-tag monoclonal antibody, and its molecular weight is consistent with the expectation, indicating that the purified protein is the target CCL22-HBZ protein.

[0119] Example 6: Refolding and Concentration of CCL22-HBZ Fusion Protein

[0120] Since the CCL22-HBZ protein exists in the form of inclusion bodies, it is denatured after purification by dissolving it in a urea solution containing 8 mmol / L. After denaturation, it needs to be renatured to obtain a correctly folded, soluble, and active protein.

[0121] The refolding process employed a stepwise dialysis method, gradually reducing the concentration of urea and adding reagents to promote proper protein folding, ultimately yielding soluble protein. First, β-mercaptoethanol was added to the purified CCL22-HBZ protein solution dissolved in elution buffer to a final concentration of 10 mmol / L, and the mixture was slowly stirred at room temperature for 30 minutes to break the disulfide bonds in the protein.

[0122] The protein solution was then transferred to a dialysis bag, which was then placed in a 2L refolding buffer solution containing 4M urea (50mmol / L Tris-HCl (pH 7.5), 1mmol / L EDTA, 200mmol / L NaCl, 4mol / L urea). Dialysis was performed at 4°C for 12 hours with slow stirring during the process.

[0123] The dialysis bag was transferred into a refolding buffer solution containing 2L of 2M urea (50mmol / L Tris-HCl (pH 7.5), 1mmol / L EDTA, 200mmol / L NaCl, 2mol / L urea), and dialyzed at 4°C for 12h.

[0124] The dialysis bag was transferred to 2L of refolding buffer containing 1M urea (50mmol / L Tris-HCl (pH 7.5), 1mmol / L EDTA, 200mmol / L NaCl, 1mol / L urea). Oxidized glutathione and L-arginine were added to a final concentration of 750μmol / L and dialyzed at 4°C for 12h.

[0125] The dialysis bag was transferred to a urea-free refolding buffer (50 mmol / L Tris-HCl (pH 7.5), 1 mmol / L EDTA, 200 mmol / L NaCl), and dialyzed at 4°C for 12 h. Then, the bag was dialyzed twice with PBS for 12 h each time.

[0126] Transfer the protein solution from the dialysis bag to a centrifuge tube, centrifuge at 10,000g for 20 minutes at 4°C, and transfer the supernatant in batches to a 30K ultrafiltration tube (Millipore). Centrifuge at 4,000g for 20 minutes at 4°C. Concentrate the protein to an appropriate volume and freeze at -80°C.

[0127] Example 7: Quality Detection of CCL22-HBZ Fusion Protein

[0128] 7.1 Stability Detection of CCL22-HBZ Fusion Protein

[0129] The stability of CCL22-HBZ protein was tested using a freeze-thaw experiment. The CCL22-HBZ protein (the concentrated protein obtained in Example 6) stored at -80℃ was removed and placed in an ice-water bath for 5-10 minutes to thaw slowly. After thawing, it was placed in a 4℃ freezer for 30 minutes. The results showed no abnormalities, indicating that the freeze-thaw experiment was normal.

[0130] 7.2 CCL22-HBZ fusion protein purity detection

[0131] Take 40 μl of renatured CCL22-HBZ protein (the concentrated protein obtained in Example 6), add 10 μl of 5×SDS loading buffer, denature in a boiling water bath for 5 min, then take 15 μl for SDS-PAGE electrophoresis. After electrophoresis, stain with Coomassie Brilliant Blue R250, and destain repeatedly with destaining solution until the protein bands are clear. Photograph the destaining gel using a gel imaging system (GE), and perform grayscale analysis using ImageJ software.

[0132] The results are as follows Figure 7 As shown, the CCL22-HBZ protein has high purity, calculated to be greater than 80%, which meets the experimental requirements.

[0133] 7.3 Detection of CCL22-HBZ fusion protein concentration

[0134] The purified and refolded CCL22-HBZ protein was quantified using the BCA method. The BCA protein quantification kit was purchased from Beijing Dingguo Biotechnology Co., Ltd. First, following the instructions, the protein standards were serially diluted, and the CCL22-HBZ protein (the concentrated protein obtained in Example 6) was also diluted 2-fold, 5-fold, and 10-fold. 10 μl of each concentration of protein standards and CCL22-HBZ protein was added to a 96-well plate. 200 μl of BCA quantification reagent solution A and solution B were mixed at a volume ratio of 50:1 and added to each well of the 96-well plate containing the protein sample. The plate was incubated at 37°C for 30 min, and the absorbance at 490 nm was measured using a microplate reader. A standard curve was plotted with the protein standard concentration on the x-axis and the absorbance at 490 nm on the y-axis (e.g., ...). Figure 8 As shown in the figure, the concentration of CCL22-HBZ protein was calculated based on the standard curve and the fitted formula. It was calculated that approximately 3 mg of soluble CCL22-HBZ protein could be obtained per liter of bacterial culture.

[0135] Example 8: Effect of CCL22-HBZ fusion protein on regulatory T cell differentiation.

[0136] 8.1 Preparation of mouse spleen cell suspension:

[0137] Six- to eight-week-old C57BL / 6N mice were sacrificed via cervical dislocation and sterilized in 75% (v / v) alcohol. The abdomen of the mice was cut open with sterile scissors, and the spleen was removed. The spleen was washed in Buffer 1 (DPBS + 1% fetal bovine serum + 2 mmol / L EDTA), removing as much excess connective tissue as possible. 3 ml of Buffer 1 was added to a 6 cm cell culture dish beforehand. A 40 μm filter was placed in the dish, and the washed mouse spleen was placed on the filter screen. The spleen was thoroughly ground using the plunger of a 1 ml disposable sterile syringe. The ground solution was transferred to a 15 ml centrifuge tube and centrifuged at 400 g for 6 min at room temperature. The cell pellet was collected. The cell pellet was resuspended in 5 ml of erythrocyte lysis buffer and allowed to stand at room temperature for 5 min. Then, 6 ml of Buffer 2 (DPBS + 2% fetal bovine serum) was added to terminate lysis, and the mixture was centrifuged at 400 g for 6 min at room temperature. The supernatant was discarded. Resuspend the cell pellet in 1 ml Buffer 2, filter the cell suspension using a 40 μm pore size filter from BD, and store for later use. A small amount of cells was aspirated from the cell suspension and stained with trypan blue to assess cell viability.

[0138] 8.2 Sorting of naive CD4+ T cells in mice:

[0139] Naïve CD4+ T cells were isolated from mouse spleen cells using the magnetic bead method (Mitentech's Naïve CD4+ T Cell Isolation Kit, mouse).

[0140] Mouse spleen cell suspension was centrifuged at 400g for 6 minutes at room temperature, and the supernatant was discarded. Every 10... 7 Resuspend cells in 40 μl Buffer 3 (DPBS + 0.5% fetal bovine serum + 2 mmol / L EDTA), and add 10 μl Biotin-Antibody Cocktail. Mix well and incubate at 4°C for 5 minutes. Add 20 μl Buffer 3 per 10⁷ cells, followed by 20 μl Anti-Biotin MicroBeads. Add 10 μl CD44 MicroBeads per 10⁷ cells. Mix well and incubate at 4°C for 10 minutes.

[0141] Place the LS column in the magnetic field of a suitable MACS separator and wash the LS column with 3 ml of Buffer 3. Gently add the mouse spleen cell suspension treated as described above onto the LS column and collect the eluent cells; this cell suspension is the enriched LS column. CD4+ T cells. Wash the LS column again with 3 ml buffer 3 and collect. CD4+ T cells.

[0142] 8.3. In vitro stimulation of regulatory T cell (Treg) differentiation by CCL22-HBZ protein:

[0143] First, rinse the 24-well plate with PBS. Then, dilute the anti-CD3 antibody to a working concentration of 5 μg / ml with 1×PBS. Add 300 μl of the diluted CD3 antibody to each well and incubate the plate overnight at 4°C. After overnight incubation, remove the 24-well plate pre-coated with anti-CD3 antibody, aspirate excess CD3 antibody, and wash the cell culture plate once with 1×PBS. Then, sort the cells... CD4+ T cells (obtained in 8.2 of Example 8) were centrifuged at 400g for 6 min, the supernatant was discarded, and the cells were resuspended in X-VIVO15 culture medium for counting. CD4+ T cells were added at 1 million per well to wells pre-coated with anti-CD3 antibody. They were divided into two groups based on the addition of different stimulating factors: A: CD3 / CD28 / IL-2 / TGF-β stimulation group; B: CD3 / CD28 / IL-2 / TGF-β + (0.2 pg / cell) CCL22-HBZ protein group. After mixing, the cells were incubated at 37°C for 4 days. The cell status and culture medium color changes were observed regularly, and cell culture medium was replenished as needed.

[0144] 8.4 Flow cytometry analysis of the proportion of T cells (Tregs):

[0145] Prepare a surface antibody mixture in advance by diluting the CD5, CD4, and CD25 surface antibodies 800 times each, and set aside for later use.

[0146] Collect the cells (groups A and B) cultured for 4 days as described in section 8.3 into 15 ml centrifuge tubes, centrifuge at 1500 rpm for 5 minutes at room temperature, and discard the supernatant. Resuspend the cell pellet in 1 ml of FACS Buffer (DPBS + 2% fetal bovine serum + 2 mmol / L EDTA), centrifuge at 1500 rpm for 5 minutes at room temperature, and discard the supernatant. Add 50 μl of diluted surface antibody mixture to each sample and incubate at 4°C in the dark for 30 minutes. Add 1 ml of FACS Buffer to each tube, mix well, centrifuge at 1500 rpm for 5 minutes at room temperature, and discard the supernatant. Add 200 μl of cell membrane pore-dissolving agent to each tube and incubate at 4°C in the dark for 20 minutes. Add 500 μl of 1×Perm Wash Buffer to each tube, mix well, centrifuge at 1800 rpm for 5 minutes, discard the supernatant, and repeat this step once. Dilute the Foxp3-PE antibody 400-fold with 1×Perm Wash Buffer, then add 50 μl of the diluted antibody to each tube and incubate at 4°C in the dark for 45 min. Add 500 μl of 1×Perm Wash Buffer to each tube, gently resuspend the cell suspension, centrifuge at 1800 rpm for 5 min at room temperature, and discard the supernatant. Finally, add 350 μl of FACS Buffer to each tube and analyze the cells using flow cytometry.

[0147] The results are as follows Figure 9 As shown, the proportion of Treg cells in the stimulation group (group B) with added CCL22-HBZ protein was significantly increased, which was significantly different from the group without added protein (group A).

[0148] Example 9: Preparation of recombinant lentivirus containing the HBZ gene

[0149] 9.1 Construction of the recombinant lentiviral vector pTRIP-CMV-pur-HBZ:

[0150] Using the pET32a-CCL22-HBZ recombinant plasmid (obtained in Example 1) as a template, and Eco-HBZ-S and BamHBZ-A as primers, PCR was performed to amplify the HBZ gene. The primer sequences are as follows (where the underlined parts are the EcoRI and BamHI restriction sites, respectively).

[0151] Eco-HBZ-S:CG GAATTC GCAGCAAGCGGTCTGTTTCG (SEQ ID NO: 4);

[0152] BamHBZ-A: CGAT GGATCC CTGCAGCCACATTGCTTCCA (SEQ ID NO: 5).

[0153] PCR amplification was performed using Takara's PrimeSTAR high-fidelity enzyme. In a 0.2 ml sterile PCR tube, the following were added sequentially: 10 μl of 5×PrimeSTAR buffer, 4 μl of dNTP mix (2.5 mM each), 100 ng of pET32a-CCL22-HBZ recombinant plasmid, 1 μl each of Eco-HBZ-S (10 μM) and BamHBZ-A (10 μM), 0.5 μl of PrimeSTAR HS DNA Polymerase, and sterile ddH2O was added to bring the volume to 50 μl.

[0154] After mixing all the above components, place them in a PCR instrument and set the reaction program as follows: 98℃ for 5 min; 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 1 min; 30 cycles, 72℃ for 5 min.

[0155] After PCR, the obtained HBZ gene was double-digested with EcoRI and BamHI, and then ligated into the pTRIP-CMV-pur vector, which had undergone the same double-digestion. The pTRIP-CMV-pur vector is stored in our laboratory, and its map is shown below. Figure 10 As shown. The ligation product was transformed into *E. coli* DH5α competent cells according to the method in 1.2 of Example 1. Four single clones were randomly selected from the plate, and recombinant plasmids (pTRIP-CMV-pur-HBZ) were extracted using the plasmid miniprep kit from Tiangen Biotech. The recombinant plasmids were identified by double digestion with EcoRI and BamHI.

[0156] The results are as follows Figure 11 As shown, each of the four plasmids yielded a band of approximately 600 bp, indicating the successful construction of the recombinant lentiviral plasmid pTRIP-CMV-pur-HBZ. One plasmid was randomly selected from the four and sequenced by BGI Genomics, verifying the correct insertion of the HBZ gene.

[0157] 9.2 Large-scale extraction of recombinant lentiviral vector pTRIP-CMV-pur-HBZ and packaging plasmids pMD2.G and psPAX2

[0158] Recombinant lentiviral plasmids pTRIP-CMV-pur-HBZ, pMD2.G, and psPAX2 were extracted using the endotoxin-free plasmid extraction kit from Kangwei Century Biotechnology Co., Ltd. Both pMD2.G and psPAX2 were obtained from Addgene. For detailed operating procedures, please refer to the kit instructions.

[0159] The concentrations and purities of the three plasmids were then determined using an ultra-micro spectrophotometer. The concentrations of pTRIP-CMV-pur-HBZ were 670 ng / μl, pMD2.G was 410 ng / μl, and psPAX 2 was 750 ng / μl. The A260 / 280 ratios of all three plasmids were approximately 1.9. The endotoxin content of the extracted plasmids was determined using the Limulus Amebocyte Lysate (LAL) assay. The results showed that the endotoxin content of all three plasmids was <50 EU / mg, and no colonies grew after plating on LB agar plates, meeting the sterility requirements.

[0160] 9.3, 293T cell resuscitation and passage

[0161] Preheat the water bath to 37°C, and preheat the cell culture medium to 37°C as well. Remove the frozen 293T cells from the liquid nitrogen container and immediately place them in the 37°C water bath, gently agitating to thaw them quickly. Sterilize the cryovials with 75% (v / v) ethanol, place them in a laminar flow hood, and transfer them to centrifuge tubes containing 10 ml of cell culture medium. Centrifuge at 1000 rpm for 5 minutes at room temperature, discarding the supernatant. Resuspend the cell pellet in a small amount of fresh culture medium, transfer it to a cell culture flask, add fresh cell culture medium, and gently agitate to disperse the cells evenly. Take a suitable amount of cells for counting and viability testing, maintaining a cell density of 3-4 × 10⁻⁴ cells / mL. 5 Cells / mL, viability greater than 95%, are cultured in an incubator at 37°C and 5% CO2. After 2-3 days of culture, when cells reach 80% confluence, they need to be passaged. Discard the culture medium in the culture flask, add 1 ml of sterile PBS, gently agitate to wash the cells, and discard the PBS. Add 1 ml of 0.25% trypsin to digest the cells. After observing under a microscope that the cells have become rounded, quickly add 4 ml of serum-containing culture medium to stop the digestion. Gently pipette to detach the cells from the flask wall and form a single-cell suspension. Centrifuge at 1000 rpm for 5 minutes at room temperature and discard the supernatant. Resuspend the cell pellet in 4 ml of fresh culture medium, transfer to a cell culture flask, and continue culturing in an incubator at 37°C and 5% CO2. Cell density and viability should be monitored daily.

[0162] 9.4 Recombinant Lentiviral Packaging:

[0163] First, trypsin was used to digest the 293T cells in the logarithmic growth phase. Then, the 293T cells were counted and seeded into 6-well plates at a density of 300,000 per well. The plates were then incubated at 37°C with 5% CO2 for 24 hours. When the cells reached 70%-80% confluence and showed good growth, they could be used for transfection experiments.

[0164] Transfection was performed using the Lipofectamine 3000 liposome transfection kit (Invitrogen). Two hours before transfection, the culture medium in the 6-well plates was replaced with serum-free DMEM medium. 125 μl of Opti-MEM medium and 3.75 μl of Lipofectamine 3000 reagent were added to a sterile EP tube and mixed well. In another sterile EP tube, 2 μg of pTRIP-CMV-pur-HBZ plasmid, 1 μg of pMD2.G plasmid, and 1 μg of psPAX2 plasmid (extracted in 9.2 of Example 9) were added sequentially, followed by 8 μl of P3000 reagent (2 μl of P3000 reagent per 1 μg of DNA). Opti-MEM medium was then added to bring the total volume to 125 μl. The solutions in both EP tubes were mixed and incubated at room temperature for 15 min. The transfection solution was then slowly added to the culture medium of 293T cells in the 6-well plates and gently mixed. Sixteen hours after transfection, the culture medium containing the transfection solution was aspirated, and the cells were washed once with PBS. 2 ml of cell culture medium containing 3% fetal bovine serum was added to each well, and the cells were incubated at 37°C in a 5% CO2 incubator. Counting from transfection time (0 hours), the cell culture supernatant was collected after 48 hours of incubation. The supernatant was centrifuged at 4°C and 4000g for 10 minutes to remove cell debris. The supernatant contained the packaged lentivirus, which was aliquoted and stored at -80°C for later use.

[0165] 9.5. Determination of recombinant lentivirus titer:

[0166] 293T cells were seeded into 24-well plates at 100,000 cells per well and cultured at 37°C in a 5% CO2 incubator until the cells reached 80% confluence. The recombinant lentivirus (obtained in Example 9.4) stored at -80°C was removed and serially diluted 10-fold in five steps, labeled as 10-10. 0 10 1 10 -1 10 -2 10 -3 .

[0167] Aspirate 90 μl of culture medium from each of the 293T cell culture wells, then add diluted lentivirus solution accordingly, and include one control well without lentivirus. Incubate at 37°C and 5% CO2 for 48 hours, then add 500 μl of fresh culture medium to each well. After 4 days of culture, collect cells from each well and extract total RNA.

[0168] RNA was extracted using the Trizol method, and the purity and concentration of the extracted RNA were determined using a micro-spectrophotometer. Total RNA extracted from each well was reverse transcribed into cDNA using a Takara cDNA first-strand synthesis kit. The HBZ gene was then amplified by RT-PCR, with actin used as an internal control gene, to semi-quantitatively determine the titer of the recombinant lentivirus in each well.

[0169] The results are as follows Figure 12 As shown, 10 0 10 1 The dilution of recombinant lentivirus amplified the HBZ band (approximately 600 bp), indicating that the recombinant lentivirus containing HBZ was successfully packaged.

[0170] Example 10: Effects of recombinant lentivirus containing the HBZ gene on regulatory T cell (Treg) differentiation and FoxP3 expression.

[0171] 10.1 Infection of naive CD4+ T cells in mice with recombinant lentivirus containing the HBZ gene:

[0172] Following the method in 8.3 of Example 8, 12-well cell culture plates were pre-coated with anti-CD3 monoclonal antibody. Initial CD4+ T cells were sorted from mouse spleen cells according to the method in 8.2 of Example 8 and seeded into the 12-well plates pre-coated with anti-CD3 monoclonal antibody at a density of 3 million cells / well. Anti-CD28 monoclonal antibody and IL-2 were added to each well to a final concentration of 1 μg / ml and 100 ng / ml, respectively.

[0173] After culturing at 37°C and 5% CO2 for 24 hours, undiluted recombinant HBZ lentivirus solution (obtained in 9.4 of Example 9) was added to each well for infection, while empty lentivirus solution (obtained in 9.4 of Example 9) was added to the control wells. Polybrene, an infection-promoting reagent, was added to all wells to a final concentration of 6 μg / ml, followed by centrifugation at 32°C and 3000 rpm for 1 hour. After infection, the supernatant was discarded, and fresh culture medium containing 100 ng / ml IL-2 was added. Cells were then cultured for another 5 days at 37°C and 5% CO2 before collection.

[0174] Detection by real-time PCR Expression of HBZ in CD4+ T cells. Results are as follows: Figure 13 As shown, the expression level of HBZ in the experimental group was 40 times that in the control group, indicating that the recombinant HBZ lentiviral solution can infect naïve CD4+ T cells.

[0175] 10.2. Effects of recombinant lentivirus containing the HBZ gene on regulatory T cell (Treg) differentiation and FoxP3 expression:

[0176] First, 24-well plates were pre-coated with anti-CD3 antibody at a working concentration of 3 μg / ml and incubated overnight at 4°C. Naïve CD4+ T cells were isolated from the spleens of C57BL / 6N mice and seeded at 1.2 million cells / well into 24-well plates pre-coated with anti-CD3 monoclonal antibody. The cells were divided into two groups: Group A: anti-CD3 / anti-CD28 / IL2 / TGF-β+ empty lentivirus; Group B: anti-CD3 / anti-CD28 / IL2 / TGF-β+ recombinant HBZ lentivirus. Each well contained 1 μg / ml anti-CD28 monoclonal antibody, 5 ng / ml TGF-β, and 100 ng / ml IL-2.

[0177] After 24 hours of cell culture, 10 μl of recombinant HBZ lentivirus stock solution or 10 μl of empty lentivirus solution (obtained in 9.4 of Example 9) was added to each well, along with the infection-promoting reagent polybrene (final concentration 6 μg / ml). The cell culture plate was then centrifuged at 32°C and 3000 rpm for 1 hour. After infection, the cell-containing culture medium was transferred to a 1.5 ml EP tube and centrifuged at 1000 rpm for 5 minutes at room temperature. The supernatant was discarded, and fresh culture medium containing 1 μg / ml CD28, 100 ng / ml IL-2, and 5 ng / ml TGF-β was added according to the experimental groups. The cells were resuspended and transferred to a new cell culture plate pre-coated with anti-CD3 antibody. The plate was incubated at 37°C for 5 days. The cell status and culture medium color changes were observed regularly each day, and appropriate replenishment of culture medium was made as needed.

[0178] Flow cytometry was used to detect the proportion of Treg cells in each group. Results are as follows: Figure 14 As shown, the proportion of Fopx3+ Treg cells in the anti-CD3 / anti-CD28 / IL2 / TGF-β+ recombinant HBZ lentivirus group (group B) was significantly higher than that in the empty vector lentivirus group (group A), with a significant difference between the two. This indicates that HBZ can significantly promote Fopx3 expression and has a promoting effect on the induced differentiation of Treg cells.

[0179] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A fusion protein with stable regulatory T cell differentiation, characterized in that, The fusion protein comprises three domains: the first domain is a chemokine ligand, the second domain is an intermediate bridging domain, and the third domain is the bZIP factor of human T-cell viral-1. The chemokine ligand is CCL22, and the intermediate bridging domain is a flexible (GGGGS)3 sequence; the human T-cell troponin-1 bZIP factor is HBZ. The fusion protein is a CCL22-HBZ fusion protein, and the amino acid sequence of the CCL22-HBZ fusion protein is shown in SEQ ID NO:

2.

2. A gene encoding the fusion protein as described in claim 1.

3. The gene as described in claim 2, characterized in that, The gene sequence encoding the CCL22-HBZ fusion protein is shown in SEQ ID NO:

1.

4. The recombinant lentiviral expression vector for gene acquisition according to claim 3, characterized in that, The recombinant lentiviral expression vector contains the HBZ gene.

5. A recombinant lentivirus comprising the recombinant lentiviral expression vector of claim 4.

Images