Rice endosperm-specific transcription factor OsMYB4, and encoding protein and application thereof

Abstract

The application discloses a rice endosperm-specific transcription factor OsMYB4, an encoding protein thereof and application. The gene OsMYB4 is a DNA molecule as described in the following 1), 2), 3) or 4): 1) a DNA molecule shown in SEQ ID NO. 1; 2) a DNA molecule shown in SEQ ID NO. 2; 3) a DNA molecule hybridized with the DNA sequence defined in 1) or 2) under stringent conditions and encoding the protein; and 4) a DNA molecule having more than 90% homology with the DNA sequence defined in 1), 2) or 3) and encoding a plant endosperm development-related protein. The application further provides a protein encoded by the gene, wherein the protein affects the development of a plant endosperm, and overexpression of a coding gene of the protein in a plant with normal endosperm development can cultivate a transgenic plant with increased grains. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a rice endosperm-specific transcription factor OsMYB4, its encoded protein, and its applications. Background Technology

[0002] Rice (Oryza sativa L.) is the staple food for over 50% of the world's population and is also a crucial food crop in my country, playing a vital role in the national economy. The rice we consume daily is the endosperm of the rice plant, which primarily contains starch and protein. The starch content and characteristics determine the appearance, cooking quality, and nutritional value of the rice, while the protein content affects its taste and nutritional quality. The formation and development of the endosperm directly impact rice yield and quality; therefore, in-depth research on rice endosperm development is of great significance.

[0003] Scientists have discovered some transcription factors that regulate the formation of rice quality through long-term research on rice. They have studied the synthesis of endosperm starch and storage proteins through pathways such as enzyme metabolism and protein transport. However, the transcriptional regulatory mechanism, interaction network, and external environmental influences (such as high temperature) of rice quality formation are not clear. This requires us to study more genes to further reveal the mechanism of rice endosperm development. Summary of the Invention

[0004] The purpose of this invention is to disclose a rice endosperm-specific transcription factor OsMYB4, its encoded protein, and its applications.

[0005] The gene OsMYB4 provided by this invention is a DNA molecule as described in 1) or 2) or 3) or 4) below:

[0006] 1) The DNA molecule shown in SEQ ID NO.1;

[0007] 2) The DNA molecule shown in SEQ ID NO.2;

[0008] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein;

[0009] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant endosperm development.

[0010] The present invention also provides a protein encoded by the above-mentioned gene OsMYB4.

[0011] Specifically, the protein provided by this invention is selected from any one shown in (a) or (b):

[0012] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.3;

[0013] (b) A protein derived from SEQ ID NO.3 with one or more amino acid residues substituted and / or deleted and / or added, and which is related to endosperm development.

[0014] This invention also provides a recombinant knockout vector, expression cassette, transgenic cell line, or recombinant bacteria containing the aforementioned gene OsMYB4. Recombinant expression vectors containing any of the above-described genes also fall within the scope of protection of this invention.

[0015] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.

[0016] The plant expression vectors include CRISPR-Cas9 knockout vectors, etc.

[0017] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by incorporating antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.) or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0018] The recombinant knockout vector was constructed using CRISPR-Cas9 technology. The OsMYB4 knockout vector was named CRISPR-OsMYB4.

[0019] The recombinant overexpression vector can be a recombinant plasmid obtained by inserting the gene (OsMYB4) into the recombination site of the vector pGluc, which is double-digested with restriction endonucleases SmaI and SacI. pGluc containing OsMYB4 is named pGluc-OsMYB4.

[0020] Expression cassettes, transgenic cell lines, and recombinant bacteria containing any of the genes (OsMYB4) described above are all within the scope of protection of this invention.

[0021] Primer pairs that knock out the gene (OsMYB4) are also within the scope of protection of this invention, and the preferred primer pairs are Primer1 / Primer2 and Primer3 / Primer4.

[0022] Primer pairs that amplify the full length or any fragment of the gene (OsMYB4) are also within the scope of protection of this invention, and the preferred primer pairs are Primer5 / Primer6 and Primer7 / Primer8.

[0023] The present invention also provides the application of at least one of the said gene, the said protein, the said recombinant knockout / expression vector, expression cassette, transgenic cell line or recombinant bacteria in plant breeding.

[0024] This invention also provides a method for targeted knockout of a target gene using GRISPR-Cas9 technology. Specifically, the recombinant knockout vector can be introduced into wild-type plants with normal endosperm development to knock out the OsMYB4 gene at a specific site.

[0025] This invention also provides a method for cultivating transgenic plants with enlarged seeds, which involves overexpressing the OsMYB4 gene in the endosperm to obtain transgenic plants with enlarged seeds. Specifically, the gene can be introduced into plants with normal endosperm development via the recombinant overexpression vector to increase the expression level of OsMYB4.

[0026] By using any vector capable of guiding the expression of exogenous genes in plants, the gene encoding the stated protein can be introduced into plant cells to obtain transgenic cell lines and transgenic plants. The expression vector carrying the stated gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed can be either monocotyledonous or dicotyledonous, such as tobacco, birdsfoot, Arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0027] Beneficial effects:

[0028] This invention is the first to discover that an endosperm-specific transcription factor, OsMYB4, and its associated protein affect the endosperm development process in plants. Inhibiting the expression of the gene encoding this protein can lead to impaired endosperm development in plant seeds, thereby enabling the cultivation of transgenic plants with endosperm variations. Overexpression of the gene encoding this protein in the endosperm can produce plants with larger seeds. The protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description

[0029] Figure 1 The grain phenotypes of wild-type Ningjing 7 and myb4 knockout line are shown.

[0030] Figure 2 Scanning electron microscopy observation of seeds of wild-type Ningjing 7 and myb4 knockout line.

[0031] Figure 3 The grouting rate was determined for wild-type Ningjing 7 and myb4 knockout lines.

[0032] Figure 4The thousand-grain weight was determined for wild-type Ningjing 7 and the myb4 knockout line.

[0033] Figure 5 This is the knockout mutation site for myb4.

[0034] Figure 6 The seed phenotype of pGluC:OsMYB4 T1 generation transgenic plants.

[0035] Figure 7 The thousand-grain weight of pGluC:OsMYB4 T1 generation transgenic plants was determined. Detailed Implementation

[0036] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0037] Example 1: Obtaining and Identifying Transgenic Plants

[0038] I. Knockout Vector Construction

[0039] 1. Knockout Primer Design

[0040] (1) On the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), select Oryza sativa (RAP-DB) in the targetgenome option;

[0041] (2) Enter the gene accession number in the Locus Tag;

[0042] (3) Click submit to run the program and wait for the results to appear;

[0043] (4) Select primers located on the CDS that are close to the ATG start site and have a high score to replicate the first 20 bp; perform blast analysis and select primers with high specificity;

[0044] (5) Primer synthesis: The back primer needs to be reverse complementary to the 20 bp sequence before adding AAAC at the 5' end, while the front primer directly adds GGCA at the 5' end of the 20 bp sequence;

[0045] After primer design and synthesis, the knockout vector CRISPR-OsMYB4 was constructed.

[0046] The knockout primer sequences are as follows:

[0047] Primer1:

[0048] 5' GGCACGCCAGCACCTCGTCCTCCT 3';

[0049] Primer2:

[0050] 5' AAACAGGAGGACGAGGTGCTGGCG 3';

[0051] Primer3:

[0052] 5' CCCACCGACCATTTCCTCTC 3';

[0053] Primer4:

[0054] 5' ATCAGCGACCACCTACAAGC 3';

[0055] 2. Knockout vector construction

[0056] (1) Add 1 μL of the left and right primer stock solution (100 μM) to a 200 μL PCR tube, and then add 8 μL of ddH2O; incubate at 95℃ for 5 min, and then allow to cool to room temperature naturally.

[0057] (2) Preparation of reaction system: ATP 1 μL, carrier 1 μL, buffer 1 μL, oligo 0.2 μL, AarⅠ 0.2 μL, T4ase 0.2 μL, ddH2O 5.5 μL, (1) mixture 1 μL;

[0058] (3) Reaction program: 37℃ for 5 min; 20℃ for 5 min; 4℃ for 30 min (1×10 cycles).

[0059] Transformation of competent *E. coli* cells: Add 10 μL of ligation vector, gently pipette to mix, and incubate on ice for 30 min; incubate in a 42°C water bath for 45 s, then immediately incubate on ice for 2 min; add 700 μL of LB broth (antibiotic-free), and incubate at 37°C for 45 min using a shaker at 220 rpm; spread the bacterial culture evenly on LB broth (containing appropriate antibiotics), place in a clean bench for approximately 30 min, and after the culture medium has completely dried, invert it and incubate overnight at 37°C; after obtaining colonies, perform colony PCR detection. Primers used are sgRNA-F paired with its own right primer. Select 1-2 positive colonies for sequencing. After successful sequencing alignment, plasmid extraction is performed.

[0060] II. Construction of Recombinant Overexpression Vectors

[0061] Using cDNA from Ninggeng 7 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, PCR amplification was performed using Primer5 / 6 to obtain the full-length CDS of the OsMYB4 gene (SEQ ID NO.2).

[0062] The OsMYB4 gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0063] Primer5:

[0064] 5' AGGATCGATCCCCGGGATGAAGCGGAAGCGGCCGGC 3';

[0065] Primer 6:

[0066] 5' TGCCTTGGGTGAGCTCTTACTGTTTGGATTCCATGA 3'.

[0067] Primer7:

[0068] 5' AGTGTGCACTAGCTTAACCCC 3';

[0069] Primer8:

[0070] 5' CTTGATCTCGTTGTCCGTGC 3'.

[0071] The PCR product was recovered and purified. The product was cloned into the pGluC vector using the INFUSION recombination kit (Takara, Japan). The INFUSION recombination reaction system (10 μL) consisted of: 2.0 μL PCR product, 5.0 μL pGluC, 2.0 μL 5× infusion buffer, and 1 μL infusion enzyme mix. After brief centrifugation, the mixture was incubated at 37°C for 15 minutes, followed by incubation at 50°C for 15 minutes. 2.5 μL of the reaction mixture was then used to transform *E. coli* DH5α competent cells (Tiangen, Beijing; CB101) using the heat shock method. All transformed cells were evenly spread on LB agar containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant overexpression vector containing the gene shown in SEQ ID NO.2 was obtained. The pGluC containing OsMYB4 was named pGluC-OsMYB4. The OsMYB4 gene fragment was inserted between the SmaI and SacI restriction sites of the vector using the INFUSION recombination kit (Takara Corporation, Japan).

[0072] III. Obtaining Recombinant Agrobacterium

[0073] Agrobacterium strain EHA105 was transformed using the freeze-thaw transformation method. A commercial Agrobacterium competent strain (EHA105) was taken out and thawed on ice. 2-3 μL of transformation plasmid was added, and the mixture was mixed by pipetting. The mixture was then rapidly frozen in liquid nitrogen for 5 min. Immediately afterward, it was placed in a 37°C water bath for heat shock for 5 min. The strain was then removed and placed on ice. 1 mL of antibiotic-free LB medium was added, and the mixture was placed in a shaker at 28°C for 3-4 h. The bacterial culture was then evenly spread on LB medium (containing the corresponding antibiotic), air-dried in a clean bench, and then inverted in a 28°C incubator for 2-3 days.

[0074] IV. Obtaining Transgenic Plants

[0075] The CRISPR-OsMYB4 and pGluC-OsMYB4 strains were transformed into wild-type Ningjing No. 7. The specific method was as follows:

[0076] (1) CRISPR-OsMYB4 and pGluC-OsMYB4 strains (or empty vector control strains) were cultured at 28℃ for 16 hours, the bacterial cells were collected and diluted in N6 liquid medium (Sigma, C1416) to a concentration of OD600 ≈ 0.5 to obtain bacterial solution;

[0077] (2) Mix the mature embryonic callus of rice Ningjing 7, which has been cultured for one month, with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0078] (3) The callus from step (2) was inoculated onto N6 solid selection medium containing 100 mg / L hygromycin for the first screening (16 days).

[0079] (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0080] (5) Select healthy callus and transfer it to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days;

[0081] (6) Select resistant callus and transfer it to differentiation medium for differentiation; obtain T0 generation positive plants that have differentiated into seedlings.

[0082] V. Identification of Transgenic Plants

[0083] 1. PCR molecular identification

[0084] Genomic DNA was extracted from the T0 generation plants of CRISPR-OsMYB4 (myb4) and pGluC-OsMYB4 obtained in step four. Genomic DNA extracted from the myb4 T0 generation plants was amplified using Primer3 and Primer4, and genomic DNA extracted from the pGluC-OsMYB4 T0 generation plants was amplified using Primer7 and Primer8.

[0085] PCR reaction system: DNA (20 ng / μL) 2 μL, Primer3 (10 pmol / μL) and Primer4 (10 pmol / μL) 2 μL each or Primer7 (10 pmol / μL) and Primer8 (10 pmol / μL) 2 μL, 10xBuffer (MgCl2 free) 2 μL, dNTP (10 mM) 0.4 μL, MgCl2 (25 mM) 1.2 μL, rTaq (5 U / μL) 0.4 μL, ddH2O 10 μL, total volume 20 μL.

[0086] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, 35 cycles; 72℃ for 10 min.

[0087] PCR products were separated using 8% non-denaturing PAGE gel and silver-stained. Transgenic positive plants were identified.

[0088] 2. Phenotypic identification

[0089] T0 generation CRISPR-OsMYB4 positive plants (myb4 knockout mutation site as follows) were respectively transfected Figure 5 As shown), pGluC:OsMYB4 positive plants and Ningjing 7 were planted in a transgenic field at the Tuqiao Rice Breeding Base of Nanjing Agricultural University. After the seeds matured, the seeds of each material were collected, and chalky white seeds were observed in the seeds of the myb4 plants. Figure 1 The cross-sectional scanning electron microscopy results showed that the abdominal starch granules were mostly loosely arranged polyhedral crystalline structures. Figure 2 Meanwhile, the grain-filling rate of myb4 plants was significantly lower than that of the wild type. Figure 3 The corresponding thousand-grain weight was significantly reduced ( Figure 4 The seeds of the pGluC:OsMYB4 plant are transparent and larger than those of the wild-type Ninggeng 7. Figure 6 The corresponding thousand-grain weight increased significantly ( Figure 7 ).

Claims

1. The application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the protein shown in SEQ ID NO.3, and a recombinant expression vector, expression cassette, or recombinant bacteria containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in cultivating rice with increased grain size, characterized in that... The gene shown in SEQ ID NO.1 or SEQ ID NO.2 was transferred into normal rice to obtain rice with larger grains.

2. A method for cultivating transgenic rice with enlarged grains, comprising introducing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with normal endosperm development to obtain transgenic rice with enlarged grains.

3. The method according to claim 2, characterized in that: The gene shown in SEQ ID NO.1 or SEQ ID NO.2 was introduced into rice with normal endosperm development via a recombinant expression vector.

Images