Rice endosperm flour-related gene osflo26, and encoded protein and application thereof

Abstract

The application discloses a rice endosperm powdery related gene OsFLO26, and an encoding protein and application thereof. The gene OsFLO26 is a DNA molecule as described in the following 1), 2), 3) or 4): 1) a DNA molecule shown in SEQ ID NO. 1; 2) a DNA molecule shown in SEQ ID NO. 2; 3) a DNA molecule hybridized with the DNA sequence defined in 1) or 2) under stringent conditions and encoding the protein; and 4) a DNA molecule having more than 90% homology with the DNA sequence defined in 1), 2) or 3) and encoding a plant endosperm development related protein. The application further provides a protein encoded by the gene, the protein affects the development of a plant endosperm, and the introduction of a coding gene of the protein into a plant with abnormal endosperm development can cultivate a transgenic plant with normal endosperm development. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a rice endosperm flour-related gene OsFLO26, its encoded protein, and its applications. Background Technology

[0002] Rice is the staple food for over 50% of the world's population and is also a crucial food crop in my country, holding a vital position in the national economy. The rice we consume daily is the endosperm of the rice plant, which primarily contains starch and protein. The starch content and characteristics determine the appearance, cooking taste, and nutritional quality of the rice, while the protein content affects its flavor and nutritional value. The formation and development of the endosperm directly impact rice yield and quality; therefore, in-depth research on rice endosperm development is of great significance.

[0003] During the ripening process, rice seed endosperm accumulates a large amount of starch, accounting for approximately 60-80% of the seed's dry weight. The content and characteristics of starch determine the quality of rice. Starch biosynthesis is a complex and precisely regulated process, requiring the participation of many starch synthesis-related enzymes and regulatory factors. Ultimately, it is stored in starch molecule form as amylose and amylopectin. Currently, scientists have cloned some genes that directly or indirectly regulate starch synthesis during rice endosperm development, but our understanding of the mechanisms of starch synthesis and regulation is not yet complete. This necessitates the location and cloning of more genes to further elucidate the process. Summary of the Invention

[0004] The purpose of this invention is to disclose a rice endosperm flour-related gene OsFLO26, its encoded protein, and its applications.

[0005] The gene OsFLO26 provided by this invention is a DNA molecule as described in 1) or 2) or 3) or 4) below:

[0006] 1) The DNA molecule shown in SEQ ID NO.1;

[0007] 2) The DNA molecule shown in SEQ ID NO.2;

[0008] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein;

[0009] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant endosperm development.

[0010] The present invention also provides a protein encoded by the above-mentioned gene OsFLO26.

[0011] Specifically, the protein provided by this invention is selected from any one shown in (a) or (b):

[0012] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.3;

[0013] (b) Proteins derived from SEQ ID NO.3 that are associated with endosperm development and are modified by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO.3.

[0014] This invention also provides a recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria containing the aforementioned gene OsFLO26. Recombinant expression vectors containing any of the above-described genes also fall within the scope of protection of this invention.

[0015] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.

[0016] The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. These vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).

[0017] When constructing recombinant plant expression vectors using the aforementioned genes, any type of enhancing promoter or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter, can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0018] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0019] The recombinant overexpression vector can be a recombinant plasmid obtained by inserting the gene (OsFLO26) into the recombination site of the vector pCAMBIA1390, which is double-digested with restriction endonucleases HindIII and BamHI. pCAMBIA1390 containing OsFLO26 is named pCAMBIA1390-OsFLO26.

[0020] Expression cassettes, transgenic cell lines, and recombinant bacteria containing any of the genes (OsFLO26) described above are all within the scope of protection of this invention.

[0021] Primer pairs that amplify the full length or any fragment of the gene (OsFLO26) are also within the scope of protection of this invention, and the preferred primer pairs are Primer1 / Primer2, Primer3 / Primer4 and Primer5 / Primer6.

[0022] The primers used in the fine mapping of this gene are shown in Table 1. The InDel primers were designed by the author for this experiment and are also within the scope of protection of this invention.

[0023] The present invention also provides the application of at least one of the said gene, the said protein, the said recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria in plant breeding.

[0024] The present invention also provides the use of at least one of the said gene, the said protein, the said recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria in the cultivation of transgenic plants with normal endosperm development.

[0025] The present invention also provides a method for cultivating transgenic plants with normal endosperm development, which involves introducing the gene into plants with abnormal endosperm development to obtain transgenic plants with normal endosperm development.

[0026] Specifically, the gene can be introduced into plants with abnormal endosperm development via the recombinant expression vector.

[0027] The present invention also provides a method for cultivating transgenic plants with abnormal endosperm development, which involves knocking out or silencing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in a normal plant to obtain a transgenic plant with abnormal starch synthesis; preferably, the plant is rice.

[0028] This invention also provides the application of a method for cultivating transgenic plants with abnormal endosperm development in plant heritage improvement or research.

[0029] By using any vector capable of guiding the expression of exogenous genes in plants, the gene encoding the stated protein can be introduced into plant cells to obtain transgenic cell lines and transgenic plants. The expression vector carrying the stated gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed can be either monocotyledonous or dicotyledonous, such as tobacco, birdsfoot, Arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0030] Beneficial effects:

[0031] This invention is the first to discover, locate, and clone the gene OsFLO26, a novel plant endosperm mealy protein. This plant endosperm mealy protein affects the endosperm development process in plants. Inhibiting the expression of the gene encoding this protein can lead to impaired endosperm development in plant seeds, thereby enabling the cultivation of transgenic plants with endosperm variations. Introducing the gene encoding this protein into plants with abnormal endosperm development can cultivate plants with normal endosperm development. This protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description

[0032] Figure 1 The seed phenotypes of wild-type N22 and mutant k219 are shown.

[0033] Figure 2 Scanning electron microscopy observation of seeds of wild-type N22 and mutant k219.

[0034] Figure 3 The thousand-grain weight was determined for wild-type N22 and mutant k219.

[0035] Figure 4 The starch content of wild-type N22 and mutant k219 was determined.

[0036] Figure 5 This shows the fine location of the mutated gene on chromosome 10.

[0037] Figure 6The T1 grain phenotype is derived from pCAMBIA1390-OsFLO26. Detailed Implementation

[0038] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0039] Example 1: Discovery of rice endosperm development-related loci and their encoding genes

[0040] I. Phenotypic and genetic analysis of the rice endosperm mealy mutant k219

[0041] An endosperm-rich mutant was screened from the progeny of tissue culture of the indica rice variety N22 and named k219.

[0042] Figure 1 The left image shows the whole and cross-sectional scans of a mature N22 seed, showing a phenotype with a completely transparent endosperm. The right image shows the whole and cross-sectional scans of a mature K219 seed, showing a phenotype with an opaque endosperm.

[0043] Scanning electron microscopy was performed on cross-sections of wild-type and K219 mutant seeds. The starch granules in wild-type seeds were tightly packed and uniform in size. Figure 2 The starch granules in the seeds of the K219 mutant are loosely arranged and mostly round, causing light scattering and resulting in an opaque appearance for the K219 seeds. Figure 2 ).

[0044] The thousand-seed weight of mature k219 mutant seeds is significantly lower than that of N22 ( Figure 3 Meanwhile, the amylose content of K219 was significantly lower than that of the wild type. Figure 4 ).

[0045] II. Map-based cloning of mutant gene sites

[0046] 1. Location of the mutated gene

[0047] First, a hybrid F1 was created by crossing the mutant k219 with another wild-type 9311. After one generation of self-pollination, F2 seeds were obtained. The F2 seeds were planted and F3 seeds were harvested. Ten seeds with an extremely powdery and opaque phenotype were selected from the F3 segregating population for preliminary gene linkage, and the target gene was located on rice chromosome 10.

[0048] Subsequently, using both shared primers from the laboratory and primers of our own design, 269 extremely powdery, opaque seeds were selected from the F3 segregating families for fine mapping. Ultimately, the target gene was located between markers K10-22 and K10-18, with a region size of 488 kb. Figure 5 ).

[0049] The method for SSR marker analysis described above is as follows:

[0050] (1) Extract DNA from the selected extreme dry seeds as a template. The specific method is as follows:

[0051] ① Crush the dried seeds with pliers and place them in a 2.0 mL Eppendorf tube. Place a steel ball in the tube and crush the sample for 1 min on a GENO / GRINDER 2000 instrument.

[0052] ② Add 660 μL of extraction buffer (a solution containing 100 mM Tris-HCl (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl, and 0.2 g / mL CTAB), vortex vigorously to mix, and incubate on ice for 30 min.

[0053] ③ Add 40 μL of 20% SDS, incubate at 65°C for 10 minutes, and gently invert the container every two minutes to mix.

[0054] ④ Add 100 μL of 5M NaCl and mix gently.

[0055] ⑤ Add 100 μL of 10×CTAB, incubate at 65℃ for 10 min, and gently invert intermittently to mix.

[0056] ⑥ Add 900 μL of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 3 min.

[0057] ⑦ Transfer the supernatant to a 1.5 mL Eppendorf tube, add 600 μL of isopropanol, mix well, and centrifuge at 12000 rpm for 5 min.

[0058] ⑧ Discard the supernatant, rinse the precipitate once with 70% (volume percentage) ethanol, and let it air dry at room temperature.

[0059] ⑨ Add 100 μL of 1×TE (a solution obtained by dissolving 121g Tris in 1 liter of water and adjusting the pH to 8.0 with hydrochloric acid) to dissolve the DNA.

[0060] ⑩ Take 2 μL of DNA for electrophoresis to detect DNA quality and determine the concentration using a DU800 spectrophotometer (Beckman Instrument Inc., USA).

[0061] (2) Dilute the extracted DNA to approximately 20 ng / μL and use it as a template for PCR amplification;

[0062] PCR reaction system (10 μL): DNA (20 ng / μL) 1 μL, upstream primer (2 pmol / μL) 1 μL, downstream primer (2 pmol / μL) 1 μL, 10×Buffer (MgCl2 free) 1 μL, dNTP (10 mM) 0.2 μL, MgCl2 (25 mM) 0.6 μL, rTaq (5 U / μL) 0.1 μL, ddH2O 5.1 μL, total 10 μL.

[0063] PCR reaction program: denaturation at 94.0℃ for 3 min; denaturation at 94.0℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min; storage at 10℃. PCR reactions were performed in an MJ Research PTC-225 thermal cycler.

[0064] (3) Detection of SSR-labeled PCR products

[0065] The amplification products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. A 50 bp DNA ladder was used as a control to compare the molecular weight of the amplification products, and silver staining was performed for color development.

[0066] The primer development process is as follows:

[0067] (1) SSR tag development

[0068] SSR markers from public maps were integrated with rice genome sequences, and BAC / PAC clone sequences near mutation sites were downloaded. Potential SSR sequences (repeat count ≥ 6) in clones were searched using SSRhunter (Li Qiang et al., Genetics, 2005, 27(5):808-810) or the online SSRIT software (http: / / archive.gramene.org / db / markers / ssrtool). These SSRs and their adjacent 400–500 bp sequences were compared online with the corresponding 9311 sequence using the BLAST program on NCBI. If there was a difference in the number of SSR repeats, it was preliminarily inferred that the PCR product of the SSR primer exhibited polymorphism between N22 and 9311. SSR primers were then designed using Primer Premier 5.0 software and synthesized by Nanjing Genscript Biotech Co., Ltd. The self-designed SSR paired primers were mixed in equal proportions, and their polymorphism between 9311 and N22 was detected. Polymorphic primers were used as molecular markers for fine mapping. Molecular markers used for fine mapping are shown in Table 1.

[0069] Table 1 Molecular markers used for fine localization

[0070]

[0071] 2. Obtaining the starch gene

[0072] Comparison of the resequencing sequences of N22 and k219 within the 488kb region revealed a two-base deletion in the OsFLO26 gene.

[0073] Primers were designed based on sequences published online, as follows:

[0074] Primer1: 5'ATGGCGAGCAGCGGGGCGGT 3';

[0075] Primer2: 5'TCAGTTGGGCTTGGAGCTTG 3'.

[0076] Using Primer1 and Primer2 as primers and N22 developing endosperm DNA as a template, PCR amplification was performed to obtain the target gene. The amplification reaction was conducted on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 4 min, 35 cycles; 72℃ for 10 min. The PCR product was recovered, purified, and ligated into pMD18-T (Takara, Japan), transformed into *E. coli* DH5α competent cells (Tiangen CB101, Beijing), and positive clones were selected for sequencing.

[0077] Sequencing results showed that the fragment obtained by PCR had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 339 amino acid residues (see SEQ ID NO.3 in the sequence listing). The protein shown in SEQ ID NO.3 was named OsFLO26, and the gene encoding the protein shown in SEQ ID NO.3 was named OsFLO26.

[0078] Example 2: Obtaining and Identifying Transgenic Plants

[0079] I. Construction of Recombinant Expression Vectors

[0080] Using genomic DNA from N22 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, the promoter portion of the OsFLO26 gene was obtained by PCR amplification using Primer 3 / 4. Using cDNA from N22 as a template, the full-length CDS of the OsFLO26 gene was obtained by PCR amplification using Primer 5 / 6.

[0081] The OsFLO26 gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0082] Primer3:

[0083] 5'CCGGCGCGCCAAGCTTGGCTAGAGTAAGGCTCTACA3';

[0084] Primer4:

[0085] 5'CCCCGCTGCTCGCCATTGCCGCCGCCCACCTCGATC 3';

[0086] Primer5:

[0087] 5'GAGGTGGGCGGCGGCAATGGCGAGCAGCGGGCGGT 3';

[0088] Primer 6:

[0089] 5'GAATTCCCGGGGATCCTCAGTTGGGCTTGGAGCTTG 3'.

[0090] Primers 3 and 4 are located 2 kb upstream of the gene shown in SEQ ID NO. 2. The amplified product is the promoter of this gene. PCR product 1 was recovered and purified. Primers 5 and 6 were then used to amplify the full-length CDS of this gene, and PCR product 2 was recovered and purified. The two PCR products were cloned into the vector pCAMBIA1390 using the INFUSION recombination kit (Takara, Japan). The INFUSION recombination reaction system (10 μL) consisted of: 1.0 μL PCR product, 1.0 μL pCAMBIA1390, 2.0 μL 5× infusion buffer, and 1 μL infusion enzyme mix. After brief centrifugation, the mixture was incubated at 37°C for 15 minutes, followed by incubation at 50°C for 15 minutes. 2.5 μL of the reaction mixture was then used to transform *E. coli* DH5α competent cells (Tiangen, Beijing; CB101) using the heat shock method. All transformed cells were evenly spread on LB solid medium containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant expression vector containing the gene shown in SEQ ID NO.1 was obtained. pCAMBIA1390 containing OsFLO26 was named pCAMBIA1390-OsFLO26. The OsFLO26 gene fragment was inserted between the HindIII and BamHI restriction sites of the vector using the INFUSION recombination kit (Takara Corporation, Japan).

[0091] II. Obtaining Recombinant Agrobacterium

[0092] pCAMBIA1390-OsFLO26 was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using an electroporation method to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain that was correctly identified by PCR and enzyme digestion was named EH-pCAMBIA1390-OsFLO26.

[0093] Agrobacterium EHA105 strain was transformed using pCAMBIA1390 as a control vector, and the same method was used to obtain the control strain with empty vector.

[0094] III. Obtaining Transgenic Plants

[0095] The EH-pCAMBIA1390-OsFLO26 strain was transformed into the rice mutant k219. The specific method was as follows:

[0096] (1) Incubate EH-pCAMBIA1390-OsFLO26 (or control strain with empty vector) at 28℃ for 16 hours, collect the bacterial cells, and dilute them in N6 liquid medium (Sigma, C1416) to a concentration of OD600≈0.5 to obtain bacterial solution;

[0097] (2) Mix the mature embryonic callus tissue of K219 rice cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0098] (3) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (16 days).

[0099] (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0100] (5) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days.

[0101] (6) Select resistant callus and transfer it to differentiation medium for differentiation; obtain T0 generation positive plants that have differentiated into seedlings.

[0102] IV. Identification of Transgenic Plants

[0103] 1. PCR molecular identification

[0104] Genomic DNA was extracted from the T0 generation plants obtained in step 3, and amplified using Primer5 and Primer6 as primers, with the genomic DNA as a template.

[0105] PCR reaction system: DNA (20ng / μL) 2μL, Primer 5 (10pmol / μL) 2μL, Primer 6 (10pmol / μL) 2μL, 10x Buffer (MgCl2 free) 2μL, dNTP (10mM) 0.4μL, MgCl2 (25mM) 1.2μL, rTaq (5U / μL) 0.4μL, ddH2O 10μL, total volume 20μL.

[0106] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, 35 cycles; 72℃ for 10 min.

[0107] PCR products were separated using 8% non-denaturing PAGE gel and silver-stained. Transgenic positive plants were identified.

[0108] 2. Phenotypic identification

[0109] T0 generation pCAMBIA1390-OsFLO26 positive plants, T0 generation empty vector control plants, and mutants k219 and N22 were planted in transgenic fields at the Tuqiao Rice Breeding Base of Nanjing Agricultural University. After seed maturity, seeds from each material were harvested, and transparent seeds were observed in the seeds of pCAMBIA1390-OsFLO26 plants. Figure 6 That is, pCAMBIA1390-OsFLO26 can restore the starchy endosperm of the k219 line to a transparent endosperm similar to the wild type. Therefore, it is proved that the mutant phenotype in k219 is caused by the mutation of OsFLO26, and overexpression can restore it to a state similar to the wild type.

Claims

1. The application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, a recombinant expression vector, expression cassette, or recombinant bacteria containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2, in cultivating rice whose endosperm appearance has been restored from floury to transparent, characterized in that... The application involves transferring the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with the gene defect shown in SEQ ID NO.2, thereby obtaining rice whose endosperm appearance has been restored from powdery to transparent.

2. A method for cultivating transgenic rice whose endosperm appearance has been restored from a powdery to a transparent state, comprising introducing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with a defect in the SEQ ID NO.2 gene to obtain transgenic rice whose endosperm appearance has been restored from a powdery to a transparent state.

3. The method according to claim 2, characterized in that, The method involves introducing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with a gene defect of SEQ ID NO.2 via a recombinant expression vector.

Images