Alleles at the dcnap locus and uses thereof

Abstract

The application provides an allele on a DcNAP locus and application thereof, and belongs to the technical field of plant genetic engineering. The application provides an allele on a DcNAP locus, wherein the allele comprises a DcNAP gene and a DcNAP-dTdic1 gene. DcNAP-dTdic1 is transcribed to obtain DcNAP2, and DcNAP is transcribed to obtain DcNAP1. Transient silencing of DcNAP1 can delay the aging of cut Dianthus caryophyllus flowers and prolong the flower life; transient silencing of DcNAP2 can accelerate the aging of cut Dianthus caryophyllus flowers and shorten the flower life. Transient overexpression of DcNAP1 can accelerate the aging of cut Dianthus caryophyllus flowers, and transient overexpression of DcNAP2 can delay the aging of cut Dianthus caryophyllus flowers. The test results of the application prove that the DcNAP gene and the DcNAP-dTdic1 gene can be used as molecular markers for regulating the aging of Dianthus caryophyllus petals.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to an allele at the DcNAP locus and its application. Background Technology

[0002] Carnations, also known as Dianthus caryophyllus, are perennial flowering plants belonging to the genus Dianthus in the family Caryophyllaceae. Due to their diverse flower colors and rich petal shapes, they are loved by consumers and are considered one of the world's four major cut flowers. Transposable elements (TEs) are ubiquitous in the plant kingdom and are a major component of the plant genome. A transposon is a DNA sequence that can autonomously or involuntarily change its position in the genome. Although transposons are widely distributed in plant genomes, most are dormant or inactive. This is mainly related to DNA methylation regulated by epigenetic silencing (Hollister and Gaut. 2009). Eukaryotic transposons are mainly divided into two categories: DNA transposons and retrotransposons (Finnegan. 1989). Early studies discovered a transposon dTdic1 belonging to the Ac / Ds superfamily in the DFR (dihydroflavonol-4 reductase) gene of the carnation variety "Rhapsody". This transposon disrupts the structure of the DFR gene, resulting in white flowers with red markings and fan-shaped areas in this variety. Meanwhile, the CHI gene carrying the dTdic1 transposon was also isolated from the "7109-01" variety, which has yellow flowers with white markings (Itoh et al. 2002). The relationship between the dTdic1 transposon and senescence in carnation cut flowers has not yet been reported. Summary of the Invention

[0003] To address the shortcomings of existing technologies, the present invention aims to provide an allele at the DcNAP locus, wherein the allele DcNAP-dTdic1 is the second exon of the DcNAP gene inserted by the dTdic1 transposon. By regulating this allele, the senescence trait of carnation cut flowers can be regulated.

[0004] The objective of this invention is achieved through the following technical solution:

[0005] This invention provides an allele at the DcNAP locus, the allele comprising the DcNAP gene and the DcNAP-dTdic1 gene; the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1; the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.2.

[0006] Preferably, the nucleotide sequence of DcNAP1 transcribed from the DcNAP gene is shown in SEQ ID NO.3; the nucleotide sequence of DcNAP2 transcribed from the DcNAP-dTdic1 gene is shown in SEQ ID NO.4; the nucleotide sequence of DcNAP2.2 transcribed from the DcNAP-dTdic1 gene is shown in SEQ ID NO.11; and the nucleotide sequence of DcNAP2.3 transcribed from the DcNAP-dTdic1 gene is shown in SEQ ID NO.12.

[0007] The present invention provides a primer pair for amplifying the alleles described in the above-mentioned technical solution, the primer pair comprising DcNAP-F and DcNAP-R; the nucleotide sequence of DcNAP-F is shown in SEQ ID NO.9; the nucleotide sequence of DcNAP-R is shown in SEQ ID NO.10.

[0008] This invention provides the application of regulating the alleles described in the above-mentioned technical solution in regulating the aging of carnations.

[0009] Preferably, silencing the expression of the DcNAP1 gene and / or overexpressing the DcNAP2 gene can delay the senescence of carnations.

[0010] Preferably, overexpression of the DcNAP1 gene and / or silencing of the DcNAP2 gene can promote senescence in carnations.

[0011] This invention provides an expression formulation for silencing the DcNAP1 gene, comprising a VIGS-based recombinant vector, the recombinant vector comprising the DcNAP1 gene fragment shown in SEQ ID NO. 7; primers for amplifying the gene fragment comprising TRV-DcNAP1-F and TRV-DcNAP1-R; the nucleotide sequence of TRV-DcNAP1-F is shown in SEQ ID NO. 23; the nucleotide sequence of TRV-DcNAP1-R is shown in SEQ ID NO. 24.

[0012] This invention provides an expression formulation for silencing the DcNAP2 gene, comprising a VIGS-based recombinant vector, the recombinant vector comprising the DcNAP2 gene fragment shown in SEQ ID NO. 8; primers for amplifying the gene fragment comprising TRV-DcNAP2-F and TRV-DcNAP2-R; the nucleotide sequence of TRV-DcNAP2-F is shown in SEQ ID NO. 25; the nucleotide sequence of TRV-DcNAP2-R is shown in SEQ ID NO. 26.

[0013] The present invention provides an overexpression formulation of the DcNAP1 gene, wherein the overexpression formulation of the DcNAP1 gene includes an overexpression vector containing the DcNAP1 gene.

[0014] The present invention provides an overexpression formulation of the DcNAP2 gene, wherein the overexpression formulation of the DcNAP2 gene includes an overexpression vector containing the DcNAP2 gene.

[0015] Beneficial effects of the present invention

[0016] This invention provides an allele at the DcNAP locus, comprising the DcNAP gene and the DcNAP-dTdic1 gene; the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1; the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.2. This invention identifies a NAC transcription factor closely related to petal senescence in carnations. Gene amplification and genome sequencing revealed a pair of alleles at the DcNAP locus, namely DcNAP and DcNAP-dTdic1. The DcNAP-dTdic1 allele is formed by the insertion of the dTdic1 transposon into the second exon of the DcNAP gene. The DcNAP-dTdic1 gene is transcribed through alternative splicing into three mRNAs with missing domains: DcNAP2, DcNAP2.2, and DcNAP2.3. The wild-type DcNAP allele, however, transcribes DcNAP1, which possesses complete domains. The biological functions of DcNAP1 and DcNAP2 in carnation petal senescence were verified using transient gene silencing and overexpression methods. Transient silencing of DcNAP1 delayed senescence and prolonged flower lifespan in carnation cut flowers; transient silencing of DcNAP2 accelerated senescence and shortened flower lifespan. Transient overexpression of DcNAP1 accelerated senescence in carnation cut flowers, while transient overexpression of DcNAP2 delayed senescence. The experimental results of this invention demonstrate that the DcNAP and DcNAP-dTdic1 genes can be used as molecular markers to regulate carnation petal senescence. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The image shows the full-length amplification results of the DcNAP and DcNAP-dTdic1 genes.

[0019] Figure 2 The image shows the amplification results of the full-length mRNA of DcNAP1 / 2 / 2.2 / 2.3 in carnations;

[0020] Figure 3 A schematic diagram of the gene structures of DcNAP and DcNAP-dTdic1;

[0021] Figure 4 A schematic diagram of the DcNAP1 / 2 / 2.2 / 2.3 protein domains;

[0022] Figure 5 Plot showing the relative expression levels of DcNAP1 and DcNAP2 / 2.2 / 2.3 in carnation petals treated with ethylene for different durations using RT-qPCR;

[0023] Figure 6 Phenotypic results of transiently silenced DcNAP1 and DcNAP2 in carnation petals: (a) Senescence phenotypes of carnation cut flower petals transiently silenced by TRV control, TRV-DcNAP1, and TRV-DcNAP2, with daily photographic records; scale bar = 2cm; (b) Vase life statistics of TRV control plants, TRV-DcNAP1 and TRV-DcNAP2 transiently silenced plants (n = 6); (c) Relative expression levels of DcNAP1 in TRV control plants and TRV-DcNAP1-silenced plants; (d) DcACO in TRV control plants and TRV-DcNAP1-silenced plants. (e) Relative expression levels of DcACO1 and DcACS1 in TRV control plants, TRV-DcNAP1- and TRV-DcNAP2-silenced plants; (f) Relative expression levels of DcNAP2 in TRV control plants and TRV-DcNAP2-silenced plants; (g) Relative expression levels of DcACO1 and DcACS1 in TRV control plants and TRV-DcNAP2-silenced plants; Values ​​are the mean of three biological replicates ± SD; t-tests were used for statistical analysis; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001;

[0024] Figure 7The images show the phenotypic results of transient overexpression of DcNAP1 and DcNAP2 in carnation petals; (a) Senescence phenotype of carnation cut flower petals transiently overexpressed with 35S control, 35S:DcNAP1 and 35S:DcNAP2, with daily photographic records; scale bar = 2cm; (b) Vase life statistics of plants transiently overexpressed with 35S control, 35S:DcNAP1 and 35S:DcNAP2 (n=6); (c) Relative expression level of DcNAP1 in plants transiently overexpressed with 35S control and 35S:DcNAP1; (d) DcACO in plants transiently overexpressed with 35S control and 35S:DcNAP1. (e) Relative expression levels of DcACO1 and DcACS1 in 35S control and transient overexpression of 35S:DcNAP1 and 35S:DcNAP2; (f) Relative expression levels of DcNAP2 in 35S control and transient overexpression of 35S:DcNAP2; (g) Relative expression levels of DcACO1 and DcACS1 in 35S control and transient overexpression of 35S:DcNAP2; Values ​​are the mean of three biological replicates ± SD; t-tests were used for statistical analysis; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Detailed Implementation

[0025] This invention provides an allele at the DcNAP locus, the allele comprising the DcNAP gene and the DcNAP-dTdic1 gene; the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1; the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.2.

[0026] In this invention, the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1, specifically as follows:

[0027]

[0028] In this invention, the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.2, and is as follows:

[0029]

[0030] This invention, through gene amplification and genome sequencing, discovered a pair of alleles, DcNAP and DcNAP-dTdic1, at the DcNAP locus. The second exon of the DcNAP-dTdic1 allele is inserted by the dTdic1 transposon; the dTdic1 transposon has a length of 886 bp; the dTdic1 transposon is inserted 46 bp after the start of the second exon of the DcNAP-dTdic1 allele; the structural difference between DcNAP and DcNAP-dTdic1 is also reflected in the presence of an additional 8-bp repetitive sequence at the end of the first intron of DcNAP.

[0031] In this invention, the nucleotide sequence of DcNAP1 transcribed from the DcNAP gene is shown in SEQ ID NO.3, and is as follows:

[0032] 5’-ATGGAAGGACATAGTAGTAGGTCTAGTAATCTTCCTCCTGGTTTTAGGTTTCATCCAACCGACGAAGAACTTATCGTACACTACCTTAAGAACCAAGCAATGTCTCGACCATGTCCTGTTTCTATCATTCCTGAAGTCGATATATATAAATTTGATCCTTGGCAATTACCTGATAAGGCAGAATTTGGGGAAAATGAATGGTATTTTTTCACACCAAGAGACCGGAAGTACCCGAATGGGATCCGACCCAATCGAGCCACGTTATCGGGTTATTGGAAGGCAACGGGTACGGATAAGGCCATTTATAGTGGAGCCAAGTATGTTGGAATTAAGAAGGCTCTTGTGTTTTACAAAGGTAGACCACCTAAGGGTTCTAAGACCGATTGGATCATGCACGAGTATCGTCTAACCGAGGCTAAACACCAGCCCATCAAGCAACATGGATCCATGAGGTTGGACGATTGGGTGTTATGTCGAATATACAAGAAGAGAAGCATGGTAAGAACAGAGGAAAAAACAGAGGATTCATCAACATCTCAAGCACAATTAAGCATTGGTGGAACAAGTGATATTTCTAGTGATCAACAAAATACAACAAAATTCCCAAGAACTCATTCATTATCATACCTCTTAGATTTGGATTATTTGGGCCCAATAGCCCATTTACTAAATGACAACACATATAATCCAAGCTTTGATGCCCAAACAAGTATGGGCCTCAATAATGCTACACTCGACCCGAATATCAACCCGTACCCGAATATTGGATTAAGTTGCCAACATAGTAATGGCAACTTTTATTTTAAATAG-3'.

[0033] In the present invention, the nucleotide sequence of DcNAP2 transcribed by the DcNAP-dTdic1 gene is shown in SEQ ID NO.4, specifically as follows:

[0034] 5'--3'.

[0035] In this invention, the DcNAP2 gene is also referred to as DcNAP2.1. In this invention, in addition to transcribing the DcNAP2 gene shown in SEQ ID NO.4, the DcNAP-dTdic1 gene can also transcribe two other coding sequences, DcNAP2.2 and DcNAP2.3.

[0036] In this invention, the nucleotide sequence of DcNAP2.2 is shown in SEQ ID NO.11, specifically as follows:

[0037] 5'-ATGGAAGGACATAGTAGTAGGTCTAGTAATCTTCCTCCTGGTTTTAGGTTTCATCCAACCGACGAAGAACTTATCGTACACTACCTTAAGAACCAAGCAATGTCTCGACCATGTCCTGTTTCTATCATTCCTGAAGTCGATATATATAAATTTGATCCTTGGCAATTACCTGATAAGGCAGAATTTGGGGAAAATGAATGGTATTTCTTCACACCAAGCAGGGTTTTAAATATCGGTATCGGTCGCGATCGCGGTTGCGGTCGCGGTGTCACGGTATCGGCCCTGAATCGCTTGTCTCGGACTATGACTCGCTCGTCGCGTTGGACGATTGGGTGTTATGTCGAATATACAAGAAGAGAAGCATGGTAAGAACAGAGGAAAAAACAGAGGATTCATCAACATCTCAAGCACAATTAAGCATTGGTGGAACAAGTGATATTTCTAGTGATCAACAAAATACAACAAAATTCCCAAGAACTCATTCATTATCATACCTCTTAGATTTGGATTATTTGGGCCCAATAGCCCATTTACTAAATGACAACACATATAATCCAAGCTTTGATGCCCAAACAAGTATGGGCCTCAATAATGCTACACTCGACCCGAATATCAACCCGTACCCGAATATTGGATTAAGTTGCCAACATAGTAATGGCAACTTTTATTTTAAATAG-3'.

[0038] In the present invention, the nucleotide sequence of the DcNAP2.3 is as shown in SEQ ID NO.12, specifically as follows:

[0039] 5'--3'.

[0040] In this invention, due to transposon insertion, DcNAP-dTdic1 generates three types of truncated variants via alternative splicing: DcNAP2, DcNAP2.2, and DcNAP2.3. Of the three variants generated by DcNAP-dTdic1, DcNAP2 (708 nucleotides) and DcNAP2.2 (677 nucleotides) are generated by exon elongation events. The second exon of DcNAP2 consists of 46 nucleotides from the original exon and 133 nucleotides from the transposon. Compared to DcNAP2, the transposon lacks 31 nucleotides, resulting in a premature stop codon in the third exon of DcNAP2.2. Because the PCR products of DcNAP2 and DcNAP2.2 differ in length by only 31 bp, they are difficult to distinguish on gel images. Figure 2 DcNAP2.3 (529 nucleotides) is generated by an exon skipping event, which jumps directly from the first exon to the third exon, and also leads to premature termination.

[0041] This invention provides a primer pair for amplifying the gene described in the above-mentioned technical solution, the primer pair comprising DcNAP-F and DcNAP-R. In this invention, the nucleotide sequence of DcNAP-F is as shown in SEQ ID NO.9, specifically: ATGGAAGGACATAGTAGTAGGTCTAGTAATC; the nucleotide sequence of DcNAP-R is as shown in SEQ ID NO.10, specifically: CTATTTAAAATAAAAGTTGCCATTACTATG.

[0042] This invention provides the application of regulating the alleles described in the above-mentioned technical solutions in regulating the senescence of carnations. In this invention, the alleles preferably include the DcNAP1 gene and the DcNAP2 gene.

[0043] In this invention, silencing the expression of the DcNAP1 gene can delay the senescence of carnations and prolong the vase life of carnation cut flowers; overexpression of the DcNAP1 gene can promote the senescence of carnations and shorten the vase life of carnation cut flowers.

[0044] In this invention, silencing the expression of the DcNAP2 gene can promote the senescence of carnations and shorten the vase life of carnation cut flowers; overexpressing the DcNAP2 gene can delay the senescence of carnations and prolong the vase life of carnation cut flowers.

[0045] This invention provides an expression formulation for silencing the DcNAP1 gene, comprising a VIGS-based recombinant vector, wherein the recombinant vector comprises the DcNAP1 gene fragment shown in SEQ ID NO.7. The DcNAP2 gene fragment shown in SEQ ID NO.7 is a portion of the DcNAP1 gene shown in SEQ ID NO.3.

[0046] In this invention, the nucleotide sequence composition of SEQ ID NO.7 is as follows:

[0047] 5'-AGACCGGAAGTACCCGAATGGGATCCGACCCAATCGAGCCACGTTATCGGGTTATTGGAAGGCAACGGGTACGGATAAGGCCATTTATAGTGGAGCCAAGTATGTTGGAATTAAGAAGGCTCTTGTGTTTTACAAAGGTAGACCACCTAAGGGTTCTAAGACCGATTGGATCATGCACGAGTATCGTCTAACCGAGGCTAAACACCAGCCCATCAAGCAACATGGATCC-3'.

[0048] In this invention, the primers for amplifying the DcNAP1 gene fragment shown in SEQ ID NO. 7 preferably include TRV-DcNAP1-F and TRV-DcNAP1-R. In this invention, the nucleotide sequence of TRV-DcNAP1-F is as shown in SEQ ID NO. 23, specifically: gtgagtaaggttaccgaattcAGACCGGAAGTACCCGAATGG; the nucleotide sequence of TRV-DcNAP1-R is as shown in SEQ ID NO. 24, specifically: ggaggccttctagaggaattcGGATCCATGTTGCTTGATGGG.

[0049] In this invention, the VIGS-based recombinant vector is preferably obtained by cloning the DcNAP1 gene fragment shown in SEQ ID NO.7 into a TRV vector, and more preferably by cloning into a vector such as pTRV2. In this invention, the VIGS-based recombinant vector can silence the expression of the DcNAP1 gene in carnations, reducing the expression level of the DcNAP1 gene in carnations.

[0050] This invention provides an expression formulation for silencing the DcNAP2 gene, comprising a VIGS-based recombinant vector, wherein the recombinant vector comprises the DcNAP2 gene fragment shown in SEQ ID NO. 8. The DcNAP2 gene fragment shown in SEQ ID NO. 8 is a portion of the DcNAP2 gene shown in SEQ ID NO. 4.

[0051] In this invention, the nucleotide sequence composition of SEQ ID NO.8 is as follows:

[0052] 5'-TTTCTTCACACCAAGCAGGGTTTTAAATATCGGTATCGGTCGCGATCGCGGTTGCGGTCGCGGTGTCACGGTATCGGCCCTGAATCGCTTGTCTCGGACTATGACTCGCTCGTCGCGGTTGATTTTTGTTTAGAAGCTTTTTTAGCGTTGGACGATTGG-3'.

[0053] In this invention, the primers for amplifying the DcNAP2 gene fragment shown in SEQ ID NO. 8 preferably include TRV-DcNAP2-F and TRV-DcNAP2-R; the nucleotide sequence of TRV-DcNAP2-F is shown in SEQ ID NO. 25, specifically: gtgagtaaggttaccgaattcTTTCTTCACACCAAGCAGGGTT; the nucleotide sequence of TRV-DcNAP2-R is shown in SEQ ID NO. 26, specifically: tggaggccttctagagaattcCCAATCGTCCAACGCTAAAAA.

[0054] In this invention, the VIGS-based recombinant vector is preferably obtained by cloning the DcNAP2 gene fragment shown in SEQ ID NO.8 into a TRV vector, and more preferably by cloning into a pTRV2 vector. In this invention, the VIGS-based recombinant vector can silence the expression of the DcNAP2 gene in carnations, reducing the expression level of the DcNAP2 gene in carnations.

[0055] This invention provides an overexpression formulation of the DcNAP1 gene, comprising an overexpression vector containing the DcNAP1 gene. Preferably, the overexpression vector comprises the complete CDS gene of the DcNAP1 gene, as shown in SEQ ID NO. 3. Preferably, the overexpression formulation is obtained by cloning the complete CDS gene of the DcNAP1 gene into the pSuper1300 vector. In this invention, the overexpression vector containing the DcNAP1 gene can overexpress the DcNAP1 gene in carnations, increasing the relative expression level of the DcNAP1 gene.

[0056] This invention provides an overexpression formulation of the DcNAP2 gene, comprising an overexpression vector containing the DcNAP2 gene. Preferably, the overexpression vector comprises the complete CDS gene of the DcNAP2 gene, as shown in SEQ ID NO. 4. Preferably, the overexpression formulation is obtained by cloning the complete CDS gene of the DcNAP2 gene into the pSuper1300 vector. In this invention, the overexpression vector containing the DcNAP2 gene can overexpress the DcNAP2 gene in carnations, increasing the relative expression level of the DcNAP2 gene.

[0057] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0058] Example 1

[0059] 1. The experimental material was Dianthus caryophyllus L. 'Master'. Grade A cut flowers ordered from Yunnan were cut with the lower 5cm of stem removed and placed in a bucket containing tap water for cultivation. The water was changed daily, and 3cm of stem was removed each day. Cultivation conditions: 23℃, 14h / d light.

[0060] 2. DNA and RNA extraction

[0061] DNA was extracted from carnation petals using the CTAB method.

[0062] mRNA was extracted from carnation petals using the Trizol method.

[0063] 3. PCR amplification of gene fragments

[0064] (1) After obtaining the DNA from the petals of carnation, in order to amplify the target gene, Phanta Max DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.) was used to clone the target gene fragment. The primers used for cloning the target gene are shown in Table 1.

[0065] Table 1 Primer information for target gene cloning

[0066] DcNAP-F SEQ ID NO.9 ATGGAAGGACATAGTAGTAGGTCTAGTAATC DcNAP-R SEQ ID NO.10 CTATTTAAAATAAAAGTTGCCATTACTATG

[0067] The PCR reaction system (50 μL) consists of the following components: ddH2O 17 μL, 2×phanta Max buffer 25 μL, dNTP Mix 1 μL, Phanta Max DNA polymerase 1 μL, DNA 2 μL, F primer 2 μL, and R primer 2 μL.

[0068] The specific PCR reaction program for gene amplification is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 1 min, repeating denaturation, annealing, and extension for 35 cycles; and final extension at 72℃ for 5 min.

[0069] DNA was extracted from a mixture of petals from different 'Master' carnation plants using the CTAB method. PCR was then performed to obtain the amplified products, which were subsequently detected by agarose gel electrophoresis. The agarose gel electrophoresis results are shown below. Figure 1 As shown.

[0070] The amplified products were sequenced, and the sequencing results are shown in SEQ ID NO.1 and SEQ ID NO.2. The fragment length of SEQ ID NO.2 is 2423 bp; the fragment length of SEQ ID NO.1 is 1545 bp. The major difference between the two sequences is the presence / deletion of an 886 bp fragment, leading this application to suggest the existence of a pair of DcNAP alleles in carnations.

[0071] A BLAST search using the inserted 886bp fragment sequence as a reference on the NCBI website indicated that it belongs to the dTdic1 transposon. Therefore, this invention names the allele of the inserted dTdic1 transposon as DcNAP-dTdic1 and the other wild-type allele as DcNAP, i.e., the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1; the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.2.

[0072] (2) After obtaining the mRNA from carnation petals, the mRNA was reverse transcribed to synthesize cDNA. After obtaining the cDNA, the primers, PCR reaction system and PCR reaction program in (1) above were used to amplify the cDNA by PCR.

[0073] After extracting cDNA from a mixture of petals from different 'Master' carnation plants, PCR was performed. The amplified products were then detected by agarose gel electrophoresis. The agarose gel electrophoresis results are shown below. Figure 2 As shown.

[0074] Depend on Figure 2 It can be seen that there are several shorter segments compared to the wild-type allele.

[0075] Sequencing of the PCR products, as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.11, and SEQ ID NO.12, revealed that shorter fragments contained dTdic1 transposon sequences of varying lengths. Therefore, it is speculated that the DcNAP-dTdic1 allele with transposon insertion may exhibit alternative splicing.

[0076] (3) Through comparative analysis of all sequences, the gene structure diagrams of DcNAP and DcNAP-dTdic1 were obtained as follows: Figure 3 As shown.

[0077] The structural differences between DcNAP and DcNAP-dTdic1 are manifested in the presence of an additional 8-bp repeat sequence at the end of the first intron of DcNAP and the insertion of a dTdic1 transposon into the second exon of DcNAP-dTdic1. The wild-type DcNAP allele is transcribed into an 810 bp RNA, named DcNAP1, as shown in SEQ ID NO.3. In contrast, the second exon of DcNAP-dTdic1 contains an 886 bp transposon. This 886 bp transposon is inserted 46 bp after the start of the second exon of the DcNAP-dTdic1 allele. Due to transposon insertion, DcNAP-dTdic1 generates three truncated variants—DcNAP2.1, DcNAP2.2, and DcNAP2.3—through alternative splicing. The nucleotide sequence of DcNAP2.1 is shown in SEQ ID NO.4 and is also referred to as DcNAP2; the nucleotide sequence of DcNAP2.2 is shown in SEQ ID NO.11; and the nucleotide sequence of DcNAP2.3 is shown in SEQ ID NO.12. Of the three variants generated by DcNAP-dTdic1, DcNAP2.1 (708 nucleotides) and DcNAP2.2 (677 nucleotides) are generated by exon extension events. The second exon of DcNAP2.1 consists of 46 nucleotides from the original exon and 133 nucleotides from the transposon. Compared to DcNAP2.1, the transposon lacks 31 nucleotides, resulting in a premature stop codon in the third exon of DcNAP2.2. Because the PCR products of DcNAP2.1 and DcNAP2.2 differ in length by only 31 bp, it is difficult to distinguish them on a gel image. Figure 2 DcNAP2.3 (529 nucleotides) is generated by an exon skipping event, which jumps directly from the first exon to the third exon, and also leads to premature termination.

[0078] (4) Protein structures of DcNAP1 / 2.1 / 2.2 / 2.3

[0079] By comparing protein sequences, we can obtain results such as... Figure 4 The diagram shows the protein structure.

[0080] Depend on Figure 4It can be seen that the wild-type DcNAP allele transcribed into DcNAP1 encodes a protein with a complete NAC domain and a transcriptional activation domain. However, due to transposon insertion, the DcNAP-dTdic1 allele is transcribed into three types of truncated variants, resulting in the loss of certain domains in these variant proteins. Sequence alignment of several proteins revealed that DcNAP2.1 lacks part of the C domain and the entire D subdomain; DcNAP2.2 retains the A, B, and part of the C subdomains; while DcNAP2.3 retains only the A and B subdomains.

[0081] Example 2

[0082] Expression levels of DcNAP1 / 2.1 / 2.2 / 2.3

[0083] To understand the expression of DcNAP1 / 2.1 / 2.2 / 2.3 in carnations, this invention used RT-qPCR to detect the expression levels of each transcript at different ethylene treatment times.

[0084] The specific method is as follows: Carnation cut flowers are placed in a 10L sealed container, and 0.1mL of ethylene gas is injected into the container. Samples are taken and RT-qPCR experiments are performed after 0h, 8h, and 24h of treatment.

[0085] mRNA was extracted from ethylene-treated carnation petals using the Trizol method, and cDNA was obtained by reverse transcription. The cDNA stock solution was diluted 20-fold and used as a template for real-time quantitative PCR using qPCR Mix and primers. DcUbq3-7 was selected as the internal control gene in carnations.

[0086] The primer information used in the real-time fluorescence quantitative experiment is shown in Table 2.

[0087] Table 2 Primer Information

[0088] RT-DcNAP1-F SEQ ID NO.13 GAATGGGATCCGACCCAATC RT-DcNAP1-R SEQ ID NO.14 CATGGATCCATGTTGCTTGAT RT-DcNAP2.1-F SEQ ID NO.15 CTCGTCGCGGTTGATTTTTG RT-DcNAP2.1-R SEQ ID NO.16 GCTATTGGGCCCAAATAATCC RT-DcNAP2.2-F SEQ ID NO.17 CTATGACTCGCTCGTCGCGT RT-DcNAP2.2-R SEQ ID NO.18 CATTTAGTAAATGGGCTATTGGG RT-DcNAP2.3-F SEQ ID NO.19 ATGGAAGGACATAGTAGTAGGTCTAG RT-DcNAP2.3-R SEQ ID NO.20 AACACCCAATCGTCCAACAGG DcUbq3-7-F SEQ ID NO.21 GTTGTTGGTTTCAGGGCTGGTTTG DcUbq3-7-R SEQ ID NO.22 CTACGGTAATTGAGAATTCACACCGAAATG

[0089] The reaction system for the RT-qPCR experiment was 10 μL, specifically: 5 μL of 2X SYBR Green Fast qPCR Mix, 0.5 μL of Prime-F, 0.5 μL of Prime-R, and 4 μL of diluted cDNA.

[0090] The specific reaction procedure for the RT-qPCR experiment is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 5 s; annealing at 60℃ for 34 s; repeat denaturation and annealing for 40 cycles.

[0091] The expression levels of DcNAP1 / 2.1 / 2.2 / 2.3 were detected using the aforementioned primers, reaction system, and reaction procedure. The results are as follows: Figure 5 As shown in the figure. The horizontal axes E0, E8, and E24 represent ethylene treatment for 0h, 8h, and 24h, respectively; the statistical values ​​are the mean ± SD of the three biological replicates.

[0092] Depend on Figure 5 The results showed that the expression levels of DcNAP2.2 and DcNAP2.3 transcripts were extremely low. Therefore, it is believed that these two transcripts may have little effect on the ethylene pathway. In contrast, the DcNAP1 and DcNAP2.1 transcripts were the most abundant and may determine function. Therefore, we will focus on the DcNAP2.1 transcript thereafter, and for convenience, we will name it DcNAP2.

[0093] Example 3

[0094] To verify the biological functions of DcNAP1 and DcNAP2 in the senescence of carnation petals, this invention utilizes virus-induced gene silencing (VIGS) technology to introduce a specific gene silencing mechanism. VIGS technology refers to the specific induction of homologous gene mRNA degradation or methylation by a virus carrying a target gene fragment after infection of a plant, as the virus replicates and transcribes, thereby silencing endogenous genes in the plant, causing changes in phenotypes or physiological indicators, and then studying the function of the target gene based on phenotypic variations (Cheng et al., 2018).

[0095] Gene fragments of 200-300 bp in size from the CDS sequences of the DcNAP1 and DcNAP2 genes were selected. The DcNAP1 gene fragment used to silence the expression of the DcNAP1 gene is shown in SEQ ID NO.7 and is referred to as target fragment 1; the DcNAP2 gene fragment used to silence the expression of the DcNAP2 gene is shown in SEQ ID NO.8 and is referred to as target fragment 2.

[0096] (1) Obtaining the target fragment 1.

[0097] mRNA was extracted from wild-type carnation cut flowers, reverse transcribed to obtain cDNA, and PCR was performed on the cDNA to obtain target fragment 1. The primers used to obtain target fragment 1 are shown in Table 3.

[0098] Table 3 Primer Information

[0099] TRV-DcNAP1-F SEQ ID NO.23 gtgagtaaggttaccgaattcAGACCGGAAGTACCCGAATGG TRV-DcNAP1-R SEQ ID NO.24 ggaggccttctagaggaattcGGATCCATGTTGCTTGATGGG

[0100] The PCR reaction system consisted of 17 μL ddH2O, 25 μL 2×phanta Max buffer, 1 μL dNTP Mix, 1 μL PhantaMax DNA polymerase, 2 μL DNA, 2 μL F primer, and 2 μL R primer.

[0101] The PCR reaction program is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 1 min, repeating denaturation, annealing, and extension for 35 cycles; and final extension at 72℃ for 5 min.

[0102] After gene amplification, the PCR products were detected using TAE gel. Single target bands that met the fragment length were excised and recovered from the gel, and the DNA was purified and recovered using a kit from Tiangen Biotech Co., Ltd. (DP209-02).

[0103] a) Add 500 μL of B1 protective solution to the adsorption column CB2, centrifuge at 12000 r for 1 min, and discard the waste liquid.

[0104] b) Cut the DNA band from the agarose gel, place it in a centrifuge tube, add 100 μL of PC solution, and incubate in a 50°C water bath for 10 min, turning the centrifuge tube up and down during the process to ensure complete dissolution.

[0105] c) Transfer the solution from the previous step into the CB2 adsorption column, centrifuge at 12000 r for 1 min, and discard the waste liquid.

[0106] d) Add 600 μL of rinsing buffer PW to CB2, centrifuge at 12000 r for 1 min, discard the waste liquid, and repeat twice.

[0107] e) Place CB2 into the collection tube, centrifuge at 12000r for 2min, discard the waste liquid, place the adsorption column at room temperature for 5min, and thoroughly dry to recover the product.

[0108] f) Place the adsorption column CB2 into a clean centrifuge tube, add an appropriate amount of elution buffer EB to the middle of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 r for 2 min, and collect the DNA solution.

[0109] The DNA solution obtained (g) was stored in a -20°C freezer.

[0110] (2) Obtaining target fragment 2

[0111] mRNA was extracted from carnation cut flowers corresponding to DcNAP2.1, and cDNA was obtained by reverse transcription. PCR was then performed on the cDNA to obtain target fragment 2. The primers used to obtain target fragment 2 are shown in Table 4.

[0112] Table 4 Primer Information

[0113] TRV-DcNAP2-F SEQ ID NO.25 gtgagtaaggttaccgaattcTTTCTTCACACCAAGCAGGGTT TRV-DcNAP2-R SEQ ID NO.26 tggaggccttctagagaattcCCAATCGTCCAACGCTAAAAA

[0114] The PCR reaction system consisted of 17 μL ddH2O, 25 μL 2×phanta Max buffer, 1 μL dNTP Mix, 1 μL PhantaMax DNA polymerase, 2 μL DNA, 2 μL F primer, and 2 μL R primer.

[0115] The PCR reaction program is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 1 min, repeating denaturation, annealing, and extension for 35 cycles; and final extension at 72℃ for 5 min.

[0116] After gene amplification, the PCR products were detected using TAE gel. Single target bands that met the fragment length were excised and recovered from the gel, and the DNA was purified and recovered using a kit from Tiangen Biotech Co., Ltd. (DP209-02).

[0117] (3) Construction of pTRV2-DcNAP1 and pTRV2-DcNAP2 vectors

[0118] The pTRV2 vector was linearized by treating it with the EcoR1 restriction endonuclease. The linearization reaction system was 50 μL, specifically as follows: 5 μL 10×K Buffer; 2 μL EcoR1 restriction endonuclease; 31 μL ddH2O; 12 μL target plasmid.

[0119] After mixing the enzyme digestion system thoroughly, incubate at 37°C for 6–8 hours. After incubation, perform gel recovery to retrieve the linearized plasmid vector, and store at -20°C for later use.

[0120] Under the action of homologous recombination enzyme, the target gene fragments obtained in steps (1) and (2) were ligated with the linearized vector fragments in a PCR instrument at 37℃ for 30 min to complete plasmid ligation. The homologous recombination reaction system was as follows: 1 μL of linearized vector fragment, 2 μL of recovered target gene fragment, 2 μL of 5×CE II Buffer, 1 μL of ClonEXpressⅡpolyenzyme1, and 5 μL of ddH2O. The pTRV2-DcNAP1 vector and the pTRV2-DcNAP2 vector were constructed respectively.

[0121] (4) Transformation of Agrobacterium tumefaciens

[0122] a) Take Agrobacterium competent cells stored at -80℃ and place them on ice until they partially thaw. Add 1 μg of plasmid to every 100 μL of competent cells.

[0123] b) Incubate sequentially on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0124] c) Add to 700 μL of antibiotic-free LB liquid medium and incubate at 28°C for 3 h.

[0125] e) Collect bacteria by centrifugation at 6000r for 1 min, take about 100μL of supernatant and spread it on a solid culture medium containing the corresponding resistance, invert it and incubate it in a 28℃ incubator for 2-3 days.

[0126] Prepare pTRV2 control Agrobacterium, pTRV2-DcNAP1 target gene Agrobacterium, and pTRV2-DcNAP2 target gene Agrobacterium according to a) to e) above.

[0127] (5) Agrobacterium pTRV1, pTRV2 control Agrobacterium and Agrobacterium pTRV2-DcNAP1 and pTRV2-DcNAP2 target genes were cultured overnight in 500 mL of LB medium containing Kan and Rif at 28°C in a constant temperature shaker at 200 r / min.

[0128] (6) After the culture is completed, centrifuge at 4000 r / min for 10 min to collect the bacteria, and resuspend at OD. 600 ≈1. Agrobacterium pTRV1 and control Agrobacterium pTRV2, Agrobacterium pTRV1 and target Agrobacterium pTRV2-DcNAP1, and Agrobacterium pTRV1 and target Agrobacterium pTRV2-DcNAP2 were mixed at a volume ratio of 1:1 and incubated in the dark for 3–4 hours to obtain three different bacterial suspensions. The resuspension formulation used was: 1 mL 1M MgCl2, 1 mL 1M MES, 100 μL 200 mL MAS, and diluted to 100 mL with ddH2O.

[0129] (7) Select healthy and uniform carnation cut flowers, immerse the entire flower head in different bacterial solutions, use a vacuum pump to suction and infect, and when the pressure reaches 0.8 atmospheres, maintain for 5 minutes and then slowly release the gas.

[0130] (8) After infection treatment, wash three times with distilled water, transfer to darkness for 12 hours, then place under natural light and incubate at room temperature. Change the water daily and observe the phenotype. Take photos of each flower daily; the results are as follows. Figure 6As shown in 'a', the scale bar is 2 cm. The TRV control group consisted of whole carnation flowers infected with *Agrobacterium tumefaciens* carrying the empty pTRV2 vector plasmid; TRV-DcNAP1 consisted of whole carnation flowers infected with *Agrobacterium tumefaciens* carrying the pTRV2-DcNAP1 plasmid; and TRV-DcNAP2 consisted of whole carnation flowers infected with *Agrobacterium tumefaciens* carrying the pTRV2-DcNAP2 plasmid.

[0131] (9) After obtaining the transiently silenced DcNAP1 and DcNAP2 carnation cut flowers, the petals of carnations in each experimental group and control group were sampled on the 4th day of culture, mRNA was extracted, cDNA was obtained by reverse transcription, and qPCR experiment was performed to obtain the expression of the target gene in the petals of carnations in each experimental group and control group.

[0132] The expression levels of DcNAP1 and DcNAP2 in TRV-DcNAP1 and TRV-DcNAP2 carnation cut flowers were detected using RT-DcNAP1-F / R and RT-DcNAP2-F / R primers, respectively. The expression levels of DcNAP1 and DcNAP2 in the control group were also detected using the same methods as in Example 2. The expression levels of DcNAP1 and DcNAP2 in each experimental group and control group are shown below. Figure 6 c and Figure 6 As shown in f in the figure.

[0133] Depend on Figure 6 c and Figure 6 According to f, TRV-DcNAP1 and TRV-DcNAP2 can specifically silence the expression of the corresponding genes in carnation cut flowers.

[0134] (10) After obtaining transiently silenced DcNAP1 and DcNAP2 carnation cut flowers, the cut flowers were vaseed at room temperature with the water changed daily. Six stems were selected as biological replicates to statistically analyze the vase life. The statistical standard for vase life was defined as the first day immediately after being removed from the dark environment, and the last day as when the petals completely withered and died. The statistical results of the vase life of carnation cut flowers in each experimental group and control group are as follows: Figure 6 As shown in b in the figure.

[0135] Depend on Figure 6 a and Figure 6 As shown in b, compared with the TRV control plants, carnation cut flowers transiently silenced by DcNAP1 exhibited a significantly delayed senescence phenotype and a prolonged vase life; conversely, plants transiently silenced by DcNAP2 exhibited a significantly accelerated senescence phenotype and a shortened vase life.

[0136] (11) After obtaining carnation cut flowers with transiently silenced DcNAP1 and DcNAP2, petals from each experimental group and control group were sampled on day 4 of culture, and mRNA was extracted and reverse transcribed to obtain cDNA. RT-qPCR experiments were performed using RT-DcACS1-F / R and RT-DcACO1-F / R primers to detect the expression levels of downstream genes DcACS1 and DcACO1 in the ethylene synthesis pathway after silencing DcNAP1 or DcNAP2 genes. The primer information for RT-DcACS1-F / R and RT-DcACO1-F / R is shown in Table 5.

[0137] Table 5 Primer Information

[0138] RT-DcACS1-F SEQ ID NO.27 GAAACTCTTTTGTTTTGCTTGGC RT-DcACS1-R SEQ ID NO.28 CTTTGATGTTCTTTTTAAGGGCG RT-DcACO1-F SEQ ID NO.29 GATTGAGAAGTTATCCGAACAACTGT RT-DcACO1-R SEQ ID NO.30 GAGGAGCTGGAGGCCGCTGACC

[0139] The RT-qPCR reaction system and reaction conditions are the same as in Example 2.

[0140] The expression levels of the ethylene synthesis pathway genes DcACS1 and DcACO1 in each experimental and control group are as follows: Figure 6 d and Figure 6 As shown in g in the figure.

[0141] Depend on Figure 6 d and Figure 6 As can be seen from the data, in plants silenced by TRV-DcNAP1, the expression levels of the two ethylene synthesis pathway genes, DcACS1 and DcACO1, decreased sharply. However, in plants transiently silenced by TRV-DcNAP2, the expression of DcACS1 and DcACO1 increased.

[0142] (12) After obtaining transiently silenced DcNAP1 and DcNAP2 carnation cut flowers, on the 4th day of cultivation, whole flowers from each experimental group were placed in a sealed container with a volume of 300–400 mL. The container was left for 6 hours to allow ethylene release. After 6 hours, 1 mL of gas was drawn from the bottle using a syringe to determine the ethylene production. The ethylene production results for each experimental group are as follows: Figure 6 As shown in e.

[0143] Depend on Figure 6 As can be seen from e, compared with the TRV control plants, the TRV-DcNAP1 silenced plants had extremely low ethylene production on day 4, while the TRV-DcNAP2 silenced plants had a significant accumulation of endogenous ethylene on day 4.

[0144] Example 4

[0145] To further verify the functions of DcNAP1 and DcNAP2, this invention constructed 35S:DcNAP1 and 35S:DcNAP2 overexpression vectors to transiently overexpress DcNAP1 and DcNAP2 in carnation flowers.

[0146] The 35S:DcNAP1 vector was constructed by cloning the complete CDS gene sequence of DcNAP1, as shown in SEQ ID NO.3, into the pSuper1300 vector; the 35S:DcNAP2 vector was constructed by cloning the complete CDS gene sequence of DcNAP2, as shown in SEQ ID NO.4, into the pSuper1300 vector.

[0147] (1) mRNA was extracted from wild-type carnation cut flowers, and cDNA was obtained by reverse transcription. The complete CDS gene sequence of DcNAP1 was obtained by PCR. Primer information for obtaining the complete CDS gene sequence of DcNAP1 with restriction sites is shown in Table 6.

[0148] Table 6 Primer Information

[0149] 35S:DcNAP-F SEQ ID NO.5 caaatcgactctagaaagcttATGGAAGGACATAGTAGTAGGTCTAGTAATC 35S:DcNAP-R SEQ ID NO.6 gcccttgctcaccatggtaccTTTAAAATAAAAGTTGCCATTACTATGTTG

[0150] The PCR reaction system and PCR reaction conditions are the same as in Example 1.

[0151] After PCR amplification, the PCR products were detected using TAE gel. Single target bands that met the fragment length were cut and recovered from the gel, and the DNA was purified and recovered using a kit from Tiangen Biotech Co., Ltd. (DP209-02).

[0152] (2) mRNA was extracted from carnation cut flowers corresponding to DcNAP2, and cDNA was obtained by reverse transcription. The cDNA was then subjected to PCR to obtain the complete CDS gene sequence of DcNAP2. Primer information for obtaining the complete CDS gene sequence of DcNAP2 with restriction sites is shown in Table 6. The PCR reaction system and PCR reaction conditions were the same as in Example 1.

[0153] After PCR amplification, the PCR products were detected using TAE gel. Single target bands that met the fragment length were cut and recovered from the gel, and the DNA was purified and recovered using a kit from Tiangen Biotech Co., Ltd. (DP209-02).

[0154] (3) Construction of 35S:DcNAP1 and 35S:DcNAP2 overexpression vectors

[0155] The pSuper1300 vector was linearized by treating it with two restriction endonucleases, HindIII and Kpn1. The linearization reaction system was 50 μL, specifically as follows: 10×K Buffer 5 μL; HindIII 1.5 μL; Kpn1 1.5 μL; ddH2O 30 μL; target plasmid 12 μL.

[0156] After mixing the enzyme digestion system thoroughly, incubate at 37°C for 6–8 hours. After incubation, perform gel recovery to retrieve the linearized plasmid vector, and store at -20°C for later use.

[0157] Plasmid ligation was completed by ligating the target gene fragment and the linearized vector fragment at 37°C for 30 min using a PCR instrument under the action of homologous recombination enzyme. The specific homologous recombination reaction system was as follows: 1 μL of linearized vector fragment, 2 μL of recovered target gene fragment, 2 μL of 5×CE II Buffer, 1 μL of ClonEXpress II polyenzyme 1, and 5 μL of ddH2O. 35S:DcNAP1 overexpression vector and 35S:DcNAP2 overexpression vector were constructed respectively.

[0158] (4) Transformation of Agrobacterium tumefaciens

[0159] a) Take Agrobacterium competent cells stored at -80℃ and place them on ice until they partially thaw. Add 1 μg of plasmid to every 100 μL of competent cells.

[0160] b) Incubate sequentially on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0161] c) Add to 700 μL of antibiotic-free LB liquid medium and incubate at 28°C for 3 h.

[0162] e) Collect bacteria by centrifuging at 6000r for 1 min, take about 100μL of supernatant and spread it on a solid culture medium containing the corresponding resistance, invert it and incubate it in a 28℃ incubator for 2-3 days.

[0163] Using the steps a) to e) above, 35S control Agrobacterium, 35S:DcNAP1 target gene Agrobacterium, and 35S:DcNAP2 target gene Agrobacterium were prepared respectively.

[0164] (5) Agrobacterium 35S control and Agrobacterium 35S:DcNAP1 and Agrobacterium 35S:DcNAP2 target genes were cultured overnight in 500 mL of LB medium containing Kan and Rif at 28°C in a constant temperature shaker at 200 r / min.

[0165] (6) After the culture is completed, centrifuge at 4000 r / min for 10 min to collect the bacteria, and resuspend at OD. 600 ≈1, let stand in the dark for 3-4 hours. The resuspension formula used is: 1 mL 1M MgCl2, 1 mL 1M MES, 100 μL 200 mM AS, and make up to 100 mL with ddH2O.

[0166] (7) Select healthy and uniform carnation cut flowers, immerse the entire flower head in different bacterial solutions, use a vacuum pump to suction and infect, and when the pressure reaches 0.8 atmospheres, maintain for 5 minutes and then slowly release the gas.

[0167] (8) After infection treatment, wash three times with distilled water, transfer to darkness for 12 hours, then place under natural light and incubate at room temperature. Change the water daily and observe the phenotype. Take photos of each flower daily; the results are as follows. Figure 7 As shown in 'a'. The scale bar is 2 cm. 35S represents whole carnation flowers infected with Agrobacterium tumefaciens carrying the pSuper1300 empty vector plasmid; 35S:DcNAP1 represents whole carnation flowers overexpressing the DcNAP1 target gene; 35S:DcNAP2 represents whole carnation flowers overexpressing the DcNAP2 target gene.

[0168] (9) After obtaining carnation cut flowers overexpressing DcNAP1 and DcNAP2, carnation petals from each experimental group and control group were sampled on the 4th day of culture, mRNA was extracted, cDNA was obtained by reverse transcription, and qPCR experiment was performed to obtain the expression of the target gene in carnation petals of each experimental group and control group.

[0169] The expression levels of DcNAP1 and DcNAP2 in 35S:DcNAP1 and 35S:DcNAP2 carnation cut flowers were detected using RT-DcNAP1-F / R and RT-DcNAP2-F / R primers, respectively. The expression levels of DcNAP1 and DcNAP2 in the control group were also detected using the same methods as in Example 2. The expression levels of DcNAP1 and DcNAP2 in each experimental group and control group are shown below. Figure 7 c and Figure 6 As shown in f in the figure.

[0170] (10) After obtaining carnation cut flowers overexpressing DcNAP1 and DcNAP2, the cut flowers were vase-arranged at room temperature with the water changed daily. Six stems were selected as biological replicates to statistically analyze the vase life. The statistical standard for vase life was defined as the first day immediately after being removed from the dark environment, and the last day as when the petals completely withered and died. The statistical results of the vase life of carnation cut flowers in each experimental group and control group are as follows: Figure 7 As shown in b in the figure.

[0171] (11) After obtaining carnation cut flowers overexpressing DcNAP1 and DcNAP2, petals from each experimental group and control group were sampled on day 4 of culture, and mRNA was extracted and reverse transcribed to obtain cDNA. RT-qPCR experiments were performed using RT-DcACS1-F / R and RT-DcACO1-F / R primers to detect the expression levels of downstream genes DcACS1 and DcACO1 in the ethylene synthesis pathway after overexpression of DcNAP1 or DcNAP2. The primer information for RT-DcACS1-F / R and RT-DcACO1-F / R is shown in Table 5.

[0172] The RT-qPCR reaction system and reaction conditions are the same as in Example 2.

[0173] The expression levels of the ethylene synthesis pathway genes DcACS1 and DcACO1 in each experimental and control group are as follows: Figure 7 d and Figure 7 As shown in g in the figure.

[0174] (12) After obtaining carnation cut flowers overexpressing DcNAP1 and DcNAP2, on the 4th day of cultivation, whole flowers from each experimental group were placed in a sealed container with a volume of 300–400 mL. The container was left for 6 hours to allow ethylene release. After 6 hours, 1 mL of gas was drawn from the bottle using a syringe to determine the ethylene yield. The ethylene yield results for each experimental group are as follows: Figure 7 As shown in e.

[0175] Depend on Figure 7 The results showed that plants overexpressing 35S:DcNAP1 exhibited a significantly accelerated senescence phenotype, and the vase life of cut flowers was shortened. Figure 7 a in Figure 7 b and Figure 7 c). In plants overexpressing 35S:DcNAP1, the expression of DcACS1 and DcACO1 was significantly increased ( Figure 7 (d). Furthermore, plants overexpressing 35S:DcNAP1 showed higher levels of endogenous ethylene release on day 4. Figure 7 (e). Conversely, plants overexpressing 35S:DcNAP2 exhibited a significantly delayed senescence phenotype and prolonged vase life of cut flowers (e). Figure 7 a in Figure 7 b and Figure 7 (f in the text). Low expression levels of DcACS1 and DcACO1 also lead to lower endogenous ethylene content. Figure 7 e and Figure 7 g in the middle.

[0176] Note: Figure 6 and Figure 7The values ​​in the table are the mean ± SD of three biological replicates. The t-test was used for statistical analysis. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

[0177] In summary, transient silencing of DcNAP1 can delay senescence and prolong flower lifespan in carnation cut flowers; transient silencing of DcNAP2 accelerates senescence and shortens flower lifespan. Transient overexpression of DcNAP1 accelerates senescence in carnation cut flowers, while transient overexpression of DcNAP2 delays senescence. Therefore, molecular markers can be developed to determine the types of DcNAP alleles in different carnation varieties, thereby predicting the vase life of carnation cut flowers.

[0178] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An allele at the DcNAP locus, characterized in that, The alleles include the DcNAP gene and the DcNAP-dTdic1 gene; the nucleotide sequence of the DcNAP gene is shown in SEQ ID NO.1; the nucleotide sequence of the DcNAP-dTdic1 gene is shown in SEQ ID NO.

2.

2. A primer pair for amplifying the allele of claim 1, characterized in that, The primer pair includes DcNAP-F and DcNAP-R; the nucleotide sequence of DcNAP-F is shown in SEQ ID NO.9; and the nucleotide sequence of DcNAP-R is shown in SEQ ID NO.

10.

3. The application of regulating the alleles described in claim 1 in regulating the senescence of carnations; silencing the expression of the DcNAP1 gene and / or overexpressing the DcNAP2 gene can delay the senescence of carnations; overexpressing the DcNAP1 gene and / or silencing the expression of the DcNAP2 gene can promote the senescence of carnations; The nucleotide sequence of the DcNAP1 gene is shown in SEQ ID NO.3; The nucleotide sequence of the DcNAP2 gene is shown in SEQ ID NO.

4.

4. An expression formulation for silencing the DcNAP1 gene, characterized in that, The expression formulation for silencing the DcNAP1 gene comprises a VIGS-based recombinant vector, the recombinant vector comprising the DcNAP1 gene fragment shown in SEQ ID NO. 7; primers for amplifying the gene fragment comprise TRV-DcNAP1-F and TRV-DcNAP1-R; the nucleotide sequence of TRV-DcNAP1-F is shown in SEQ ID NO. 23; the nucleotide sequence of TRV-DcNAP1-R is shown in SEQ ID NO. 24; The nucleotide sequence of the DcNAP1 gene is shown in SEQ ID NO.

3.

5. An expression formulation for silencing the DcNAP2 gene, characterized in that, The expression formulation for silencing the DcNAP2 gene comprises a VIGS-based recombinant vector, the recombinant vector comprising the DcNAP2 gene fragment shown in SEQ ID NO. 8; primers for amplifying the gene fragment comprise TRV-DcNAP2-F and TRV-DcNAP2-R; the nucleotide sequence of TRV-DcNAP2-F is shown in SEQ ID NO. 25; the nucleotide sequence of TRV-DcNAP2-R is shown in SEQ ID NO. 26; The nucleotide sequence of the DcNAP2 gene is shown in SEQ ID NO.

4.

6. A DcNAP1 gene overexpression formulation, characterized in that, The DcNAP1 gene overexpression formulation includes an overexpression vector containing the DcNAP1 gene; the nucleotide sequence of the DcNAP1 gene is shown in SEQ ID NO.

3.

7. A DcNAP2 gene overexpression formulation, characterized in that, The overexpression formulation of the DcNAP2 gene includes an overexpression vector containing the DcNAP2 gene; the nucleotide sequence of the DcNAP2 gene is shown in SEQ ID NO.4.

Images