Strawberry FvDi19-3 gene and application thereof in improving drought tolerance of plants

Abstract

The application discloses a strawberry FvDi19-3 gene and application thereof in improving plant drought resistance. The gene is induced by drought and the expression amount of the gene is obviously increased in the strawberry. The FvDi19-3 gene is overexpressed in Arabidopsis thaliana, and the drought resistance of the transgenic Arabidopsis thaliana is obviously enhanced, which indicates that the FvDi19-3 gene is a gene participating in drought stress regulation. The FvDi19-3 gene is overexpressed in Arabidopsis thaliana for the first time, and the new drought resistance function of the FvDi19-3 gene is verified, which provides a new idea for cultivating drought-resistant transgenic plants, and has important significance for horticultural crop breeding and production application.

Description

Technical Field

[0001] This invention relates to the field of bioscience and technology, and in particular to a strawberry FvDi19-3 gene and its application in improving plant drought resistance. Background Technology

[0002] Drought is characterized by its frequent occurrence, long duration, and wide impact. Statistics show that global annual yield losses from drought in horticultural crops exceed the combined yield reductions caused by other environmental factors. Strawberries, as berry-type fruit trees, have shallow root systems, numerous leaves, and vigorous transpiration, making them intolerant of drought. Severe drought stress significantly restricts the summer growth and runner development of strawberries.

[0003] Therefore, improving water use efficiency and enhancing plant drought resistance is a theoretical issue in strawberry water-saving cultivation, and also has important practical guiding significance. Researching drought-resistant genes, clarifying the molecular mechanisms of drought resistance, and improving strawberry drought resistance are crucial. With the development of molecular biology techniques, transferring drought-resistant genes into relevant crops and enabling their efficient expression in target crops to improve crop adaptability to adverse environments and increase crop yield and quality has become a current research focus. However, research on Di19-type genes in strawberries is still incomplete, and there are currently no methods to improve plant drought resistance using strawberry Di19-type genes. Summary of the Invention

[0004] Based on the technical problems existing in the background art, the present invention proposes a strawberry FvDi19-3 gene and its application in improving plant drought resistance.

[0005] This invention proposes a strawberry FvDi19-3 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0006] SEQ ID NO: 1:

[0007]

[0008] This invention also proposes the full-length coding region cDNA of the strawberry FvDi19-3 gene, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0009] SEQ ID NO: 2:

[0010] ATGGACTCTGATTCCTGGAGCAACCTGTTCTCGTCTTCGAACGCGAGGAGGTACCAGTCCCGATCCGATCTGTTCGGGCACGAGGAGATAGAAGGAGACGATGAGATAAAGGCTGAGTTTTTGTGCCCTTTTTGCGCGGAGGACTTCGATGTCGTTGGGC TTTGTTGTCACATCGATGAGGAGCATCCCGTCGAGGCTAAGAATGGGGTCTGTCCAGTTTGTACTAAGAGGGTTGGATCAAATCTTGTCACACATATTACCACGCAACATGGGAGTCTATTAAAGGTTCAGCGCAAAAGGAAATTGCGCAGGGGAACTAAT TCGACATTTTTCAATATTAAGGAAAGAGCTGCGAGAAGGAAGTCTACAAGCCCTCCTGGGAGGGTCTTCATTCCCATTTTCCTCAAACACCGAACCTGATCCTTTGTTGTCTTCTTTTATATACAATGCACCTGATGAACATGTGAGCGAACAAACCCTTC CTTTAGTTGAAGCACCATTCATGAAGGAAAGCACAAAAGAAGAGTCCCGAAAGAATTGCTCAACAACCACCTCTATCAACTAAAGACCAAGAGGAGAAGGCTCGGAAGTGTGAGTTTGTCCAAGGATTGCTGATGTCCACCATTCTTGATGACTTATGA

[0011] The present invention also provides amplification primers for cloning the full-length coding region cDNA of the strawberry FvDi19-3 gene, the sequences of which are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] SEQ ID NO: 3FvDi19-3-FP:ATGGACGTTGACTCGTGGG

[0013] SEQ ID NO: 4FvDi19-3-RP:TAGATCTGAAAATATGGTTGATGCA

[0014] The present invention also proposes a recombinant expression vector containing the nucleotide sequence of the strawberry FvDi19-3 gene or the nucleotide sequence of the full-length coding region cDNA of the strawberry FvDi19-3 gene.

[0015] This invention also proposes the application of the strawberry FvDi19-3 gene, the full-length coding region cDNA of the strawberry FvDi19-3 gene, and the recombinant expression vector in improving plant drought resistance.

[0016] Preferably, the plant is a dicotyledonous plant; preferably, the plant is strawberry or Arabidopsis thaliana.

[0017] Preferably, the method for constructing the recombinant expression vector can be as follows: the full-length coding region cDNA of the strawberry FvDi19-3 gene is introduced into the enzyme-digested PMDC43 vector using homologous recombination.

[0018] The present invention also proposes a method for cultivating drought-resistant plants, which involves introducing a recombinant expression vector containing the nucleotide sequence described above into plants to increase the expression level of the strawberry FvDi19-3 gene and obtain plants with improved drought resistance.

[0019] The recombinant expression vectors described above were introduced into plant cells using methods well-known to those skilled in the art, including but not limited to: Agrobacterium-mediated transformation, gene gun method, electroporation method, and ovary injection method.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention marks the first discovery and isolation of the strawberry FvDi19-3 gene. The expression level of this gene in strawberry significantly increased after drought induction. Overexpression of this gene in Arabidopsis thaliana resulted in a significant increase in drought tolerance, indicating that the FvDi19-3 gene is involved in the regulation of drought stress. This invention is the first to overexpress the FvDi19-3 gene in Arabidopsis thaliana and verify its novel drought-resistant function, providing a new approach for breeding drought-resistant transgenic plants and holding significant importance for horticultural crop breeding and production applications. Attached Figure Description

[0022] Figure 1 The expression level of the FvDi19-3 gene in various tissues of *Strombocybe spp.*

[0023] Figure 2 The expression level of the FvDi19-3 gene in forest strawberries after drought stress.

[0024] Figure 3 This is a map of the PMDC43 plasmid.

[0025] Figure 4 The results are PCR verification results of leaves from positive seedlings in the Arabidopsis thaliana transformation experiment.

[0026] Figure 5 The results of drought resistance phenotype and related index determination of wild-type Arabidopsis thaliana plants and FvDi19-3 overexpressing transgenic Arabidopsis thaliana plants. Detailed Implementation

[0027] The technical solution of the present invention will now be described in detail through specific embodiments.

[0028] In the following examples, diploid forest strawberry (“Rugen”) and Arabidopsis thaliana (Col-0; Columbia) were plant materials preserved in the laboratory of the Institute of Horticulture, Anhui Academy of Agricultural Sciences; Agrobacterium (GV3101) was a strain preserved in the laboratory of the Institute of Horticulture, Anhui Academy of Agricultural Sciences.

[0029] Example 1: Amplification of the full-length coding region cDNA of the strawberry FvDi19-3 gene

[0030] Using diploid forest strawberry “Rugen” cDNA as a template, amplification primers were designed using Vector NT1 based on the CDS sequence of the strawberry FvDi19-3 gene (as shown in SEQ ID NO: 1); then, primers containing homologous arms of the vector were designed using homologous recombination based on the multiple cloning site of the vector.

[0031] The sequences of the amplification primers are shown in SEQ ID NO:3 and SEQ ID NO:4.

[0032] SEQ ID NO: 3FvDi19-3-FP:ATGGACGTTGACTCGTGGG

[0033] SEQ ID NO: 4FvDi19-3-RP:TAGATCTGAAAATATGGTTGATGCA

[0034] The primer sequence containing the vector homologous arm is as follows:

[0035] Di19-3-DC43-FP (SEQ ID NO: 5):

[0036] ATGGATGAACTATACAAAGGG ATGGACGTTGACTCGTGGG

[0037] Di19-3-DC43-RP(SEQ ID NO:

[0038] 6): AACATATCCAGTCACTATGGG TAGATCTGAAAATATGGTTGATGCA, where the underlined part is the vector homologous arm sequence.

[0039] PCR was performed using the high-fidelity enzyme KOD-plus-Neo, with a reaction volume of 25 μL. The amplification reaction mixture is as follows:

[0040]

[0041]

[0042] The PCR amplification procedure uses a two-step method common to KOD enzymes because the primers contain adapters and have a high Tm value. The specific steps are as follows:

[0043]

[0044] After the reaction is complete, add an appropriate amount of DNA loading buffer, and use 1% agarose gel electrophoresis to determine the size of the product and recover the DNA fragments with the correct bands. The recovery steps are as follows:

[0045] (1) Under UV light, cut the DNA agarose fragment containing the target gene and put it into a 2.0 mL centrifuge tube. Calculate the gel weight, estimate the gel volume according to 100 mg = 100 μL, and then perform gel recovery according to the Axygen gel recovery kit.

[0046] (2) Add 4 gel volumes of DE-A solution to a centrifuge tube, mix well, and then heat in a 75°C water bath until the gel is completely melted. This process takes about 8-10 minutes.

[0047] (3) Add 1 / 2 volume of Buffer DE-A to Buffer DE-B, mix thoroughly until the solution turns bright yellow;

[0048] (4) Transfer the mixture from step (3) to a 2.0 mL centrifuge tube with a preparation tube, centrifuge at 12000 rpm for 1 min, and discard the filtrate.

[0049] (5) Place the preparation tube back into the centrifuge tube, add 500 μL of W1 solution, centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0050] (6) Place the preparation tube back into the centrifuge tube, add 700 μL of W2 solution, centrifuge at 12000 rpm for 30 s, and discard the filtrate.

[0051] (7) Place the preparation tube back into the centrifuge tube and centrifuge at 12,000 rpm for 2 minutes. Let stand at room temperature for 2-5 minutes to allow the ethanol to evaporate completely.

[0052] (8) Place the preparation tube back into a clean 1.5 mL centrifuge tube, add 26 μL of deionized water or Eluent (preheated to 65 °C beforehand) to the center of the membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, discard the preparation tube, and take 3-5 μL of the recovered product for agarose gel electrophoresis to check whether the recovery was successful.

[0053] After the above steps, the full-length coding region cDNA of the strawberry FvDi19-3 gene was successfully recovered, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0054] Example 2: Detection of FvDi19-3 gene expression in strawberry

[0055] RNA was extracted from *Strawberry* (using the Tiangen reagent kit), reverse transcribed into cDNA, and the expression level of the FvDi19-3 gene in various tissues of *Strawberry* was detected using RT-qPCR (quantitative PCR). The results are as follows: Figure 1 As shown. Figure 1 In this context, Root, Shoot, Leaf, Flower, WF (green fruit stage), and RF (red fruit stage) are used. Figure 1 As can be seen, the FvDi19-3 gene is most expressed in flowers, followed by roots, and almost not expressed in fruits, indicating that the FvDi19-3 gene may play a role during plant growth and development.

[0056] Example 3: Expression level of FvDi19-3 gene in simulated drought conditions of forest strawberry.

[0057] Forest strawberries were treated with 20% PEG to simulate drought conditions for 24 consecutive hours. Samples were collected at seven time points (0, 1, 2, 4, 8, 12, and 24 hours), RNA was extracted and reverse transcribed, and the expression level of the FvDi19-3 gene at different time points was detected using RT-qPCR. The results are as follows: Figure 2 As shown. By Figure 2 It can be seen that under the induction of 20% PEG, the expression level of FvDi19-3 gene was significantly upregulated, reaching a peak within 1 hour of treatment and remaining at the peak until it decreased after 24 hours. This preliminarily indicates that the FvDi19-3 gene can respond rapidly and continuously to drought stress.

[0058] Example 4 Construction of recombinant expression vector

[0059] The full-length coding region cDNA of the strawberry FvDi19-3 gene was ligated into the PMDC43 vector using homologous recombination, with the upstream restriction enzyme site being AscⅠ and the downstream restriction enzyme site being SalⅠ.

[0060] Based on the primer design, the pMDC43 empty vector was selected for double digestion with AscⅠ and SalⅠ (PMDC43 plasmid map as shown). Figure 3 (As shown), the enzyme digestion conditions were 37℃ for 5 hours, and the enzyme digestion system was as follows:

[0061]

[0062] The linearized vector after enzyme digestion was detected by 1% agarose gel electrophoresis. The vector backbone was recovered and recombined with the recovered product obtained in Example 1. The system was as follows:

[0063]

[0064] After the system was prepared, the components were gently mixed by pipetting with a micropipette and the homologous recombination reaction was carried out under the following conditions: 37℃, 2h; after completion, it was placed on ice for 5min to obtain the recombinant product.

[0065] Transfer 5 μL of the recombinant product into 50 μL of competent E. coli (DH5α) cells. Gently scratch the bottom of the tube, place it on ice, incubate on ice for 30 min, heat shock at 42°C for 90 s, place on ice for another 2 min, add 100 μL of antibiotic-free LB medium, and incubate at 37°C and 180 rpm for 1 h. Spread 100 μL of the bacterial culture evenly on a kanamycin-resistant plate, invert the plate, and incubate overnight at 37°C for 10-12 h. Once single-clone plaques have grown on the plate, use a sterile inoculation loop to inoculate the single colony from the resistant plate into 2 mL of liquid LB medium containing an appropriate amount of kanamycin resistance. Incubate at 37°C with shaking at 220 rpm for 10-12 h. After turbidity, collect the culture in a 2.0 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, discard the supernatant, and then extract the recombinant plasmid using the Axygen plasmid extraction kit to obtain the recombinant plasmid. The recombinant expression vector containing the full-length coding region cDNA of the strawberry FvDi19-3 gene was successfully constructed.

[0066] Example 5: Recombinant plasmid transformed into Agrobacterium GV3101

[0067] Preparation of Agrobacterium competent cells (GV3101):

[0068] (1) Prepare 1.0L LB liquid culture medium and 1.6L 10% glycerol, sterilize and set aside;

[0069] (2) Streak single GV3101 competent cells on LB solid medium containing three antibiotics (rifampin, gentamicin, and tetracycline) and incubate in the dark at 28°C for about 48 hours.

[0070] (3) After the colonies grow, pick a single colony and inoculate it into 5 mL of LB liquid medium containing three types of resistance. Incubate overnight at 28°C and 220 rpm for about 48 hours.

[0071] (4) Inoculate 5 mL of overnight culture into 500 mL of antibiotic-free LB liquid medium and incubate at 28°C and 220 rpm for about 6-8 hours until the OD600 is about 0.8.

[0072] (5) Collect the bacterial solution in a 50mL sterilized centrifuge tube, centrifuge at 4000rpm and 4℃ for 5min, and collect the bacterial cells;

[0073] (6) Wash and resuspend the bacterial cells with 40 mL of 10% sterile glycerol, centrifuge at 4000 rpm and 4℃ for 5 min, and discard the supernatant;

[0074] (7) Repeat step (6) once;

[0075] (8) In the last step of glycerol washing, when discarding the supernatant, resuspend GV3101 in the refluxed glycerol (if there are many bacteria, more can be refluxed), dispense 50 μL into 1.5 mL centrifuge tubes (which need to be sterilized in advance), and quickly place them in liquid nitrogen at -80℃ for later use.

[0076] Recombinant plasmid transformed Agrobacterium GV3101:

[0077] (1) Take GV3101 Agrobacterium competent cells out of the -80℃ freezer, place them on ice to thaw, add 1 μL of the recombinant plasmid obtained in Example 4, and add the mixture to a pre-prepared electroporation cup;

[0078] (2) 2500V, 1-2 electric shocks;

[0079] (3) Add 400 μL of non-resistant LB solution to the electroporation cup, mix well, and then transfer the mixture to a 1.5 mL centrifuge tube.

[0080] (4) Shake at 28℃, 220rpm, in the dark for 3-5 hours;

[0081] (5) Take 50 μL and spread it on LB plates containing kanamycin, rifampin, gentamicin and tetracycline resistance, and incubate in the dark at 28°C for 48 h.

[0082] (6) After the bacterial colonies grow, shake the bacteria to propagate them and obtain the recombinant plasmid to transform Agrobacterium GV3101. Store it for later use.

[0083] Example 6: Transformation of Arabidopsis thaliana

[0084] In Arabidopsis transformation experiments, to facilitate subsequent screening, the infected wild-type Col-0 Arabidopsis is usually referred to as the T0 generation, the seeds obtained from the infected Arabidopsis are called T1 generation seeds, the seedlings that germinate from the T1 generation seeds are called T1 generation seedlings, and the seeds harvested from the T1 generation seedlings are called T2 generation seeds. Genotype segregation occurs in the T2 generation seeds, that is, homozygous positive seedlings are selected in the T2 generation, and the expression level of the FvDi19-3 gene is measured to obtain overexpression lines with different FvDi19-3 gene expression levels.

[0085] 6.1 Sterilization treatment of Arabidopsis thaliana seeds:

[0086] (1) Take an appropriate amount of Arabidopsis thaliana seeds into a 2.0 mL centrifuge tube, add 12% Bleach in a clean bench and treat for 10 min. During this time, the centrifuge tube needs to be constantly inverted and shaken to ensure that the seeds are in full contact with the disinfectant.

[0087] (2) Remove the 12% Bleach solution from the centrifuge tube, and wash it with sterile water 6-8 times, shaking thoroughly for 1-2 minutes each time;

[0088] (3) After washing, add an appropriate amount of sterile water and place the Arabidopsis seeds at 4°C in the dark for 3 days to vernalize.

[0089] 6.2 Cultivation of wild-type Arabidopsis thaliana:

[0090] (1) After vernalization, the seeds were evenly sown on 1 / 2 MS solid medium and placed vertically in an artificial climate chamber for growth at 25°C with 16h-light / 8h-dark light.

[0091] (2) Mix vermiculite and sieved black soil after high pressure sterilization in a volume ratio of 3:1, and divide them into small square basins (7cm×7cm×10cm). Place the square basins in a tray and add tap water to the bottom of the tray to allow the nutrient soil and vermiculite to slowly soak and moisten.

[0092] (3) When the Arabidopsis thaliana grows to 6-8 days and the root length is about 6cm, open the culture dish and gently transplant the Arabidopsis thaliana into the prepared nutrient soil with tweezers. Be careful not to damage the root system. Press down the roots of the Arabidopsis thaliana with an appropriate amount of water and cover with plastic wrap to prevent the seedlings from losing water.

[0093] (4) After a week, when the seedlings have grown steadily, the plastic wrap can be removed to allow them to grow normally. Water and fertilize them at appropriate times, and take precautions against pests and diseases.

[0094] (5) When Arabidopsis thaliana flowers, it is then soaked in the solution.

[0095] 6.3 Agrobacterium infection in Arabidopsis thaliana:

[0096] (1) After activating the Agrobacterium tumefaciens bacterial culture containing recombinant plasmid, take 500 μL to 50 mL of liquid LB medium containing four antibiotics (kanamycin, rifampin, gentamicin, tetracycline) for expansion culture, and incubate in the dark at 28℃ and 220 rpm for 36-48 h.

[0097] (2) Collect the bacterial culture in a 50 mL centrifuge tube, centrifuge at 6000 rpm for 10 min at room temperature, and discard the supernatant;

[0098] (3) Add 15 mL of Arabidopsis thaliana transformation buffer, fully suspend the bacterial cells and mix well;

[0099] (4) Use a Pasteur dropper to draw a certain amount of suspension and drip it onto the stigma of Arabidopsis thaliana that is about to flower. After the process is finished, cover the infected plant with a black plastic bag and remove it after 24 hours.

[0100] (5) One week later, repeat the above-mentioned dyeing steps to improve conversion efficiency.

[0101] (6) After the two immersions, the growth of Arabidopsis thaliana may deteriorate. It is necessary to water and fertilize in a timely manner and take precautions against pests and diseases.

[0102] (7) Stop watering when most of the siliques of the infected Arabidopsis thaliana mature and turn yellow, and harvest the T0 generation transgenic seeds one after another.

[0103] 6.4 Screening of transgenic positive lines of Arabidopsis thaliana:

[0104] (1) T0 generation transgenic Arabidopsis seeds were disinfected, vernalized, and then evenly sown on 1 / 2 MS solid medium containing 25 mg / L hygromycin. They were placed vertically in an artificial climate chamber for growth at 25°C with 16 h light / 8 h dark light.

[0105] (2) After growing in the greenhouse for 7-10 days, Arabidopsis thaliana that can grow normally on the plate are transgenic positive seedlings. Because the fusion plasmid contains a GFP tag, take 1 cm from the root tip and observe it under a fluorescence microscope. If the cell nucleus contains a green fluorescent signal, it is preliminarily identified as a positive seedling and then transplanted into nutrient soil.

[0106] (3) When Arabidopsis thaliana is about to flower, take 1-2 leaves from each plant and extract DNA for PCR verification. Refer to the instructions of Sangon Biotech kit for DNA extraction steps.

[0107] (4) PCR amplification of the target gene fragment. PCR was performed using a common Mix enzyme, and the reaction volume was 25 μL. The amplification reaction system is as follows:

[0108]

[0109] The PCR amplification reaction procedure is as follows:

[0110]

[0111] After the reaction was complete, the size of the product was determined by 1% agarose gel electrophoresis.

[0112] PCR verification results of positive seedling leaves are as follows Figure 4 As shown. Figure 4 The DNA marker used was DL2000, and the target band length was 642 bp. From... Figure 4 As can be seen from the above, the present invention has successfully obtained Arabidopsis thaliana lines expressing the strawberry FvDi19-3 gene.

[0113] 6.5 Screening of homozygous lines with different expression levels

[0114] Leaves from six homozygous Arabidopsis thaliana lines were selected, with nine samples taken from each line. RNA was extracted from the leaves and reverse transcribed into cDNA. The gene expression levels of different lines were measured using RT-PCR. Homozygous lines with different expression levels were screened out, and three lines with low, medium, and high expression levels were selected as OE-1, OE-2, and OE-3, respectively.

[0115] Example 7: Arabidopsis thaliana drought treatment experiment

[0116] Seeds of wild-type Arabidopsis thaliana and seeds of Arabidopsis thaliana lines with different FvDi19-3 gene expression levels obtained in Example 6 were germinated under the same conditions and planted in an artificial climate chamber, maintaining suitable temperature, light, and humidity. When the seedlings reached the 5-leaf stage, watering was stopped and drought treatment was initiated, continuing for approximately two weeks until the Arabidopsis thaliana plants exhibited drought stress phenotypes. The survival rate of the Arabidopsis thaliana plants was recorded (three replicates). Simultaneously, before and after drought treatment, stress-related physiological and biochemical indicators, including relative water content (RWC), proline (Pro), malondialdehyde (MDA) content, and peroxidase (POD) key physiological indicators, were measured (three replicates). Results are shown below. Figure 5 .in, Figure 5 (A): Drought-resistant phenotype of transgenic Arabidopsis thaliana with overexpression of the FvDi19-3 gene; Figure 5 (B): Changes in relative water content of leaves during drought treatment; Figure 5 (C): Determination of malondialdehyde content; Figure 5 (D): Determination of POD (peroxidase) activity; Figure 5 (E): Proline content determination; *p<0.05**p<0.01. (Col-0 is wild type, OE-1, OE-2, and OE-3 are positive transgenic plants). Figure 5In (C), (D), and (E), the bar charts from left to right correspond to Col-0, OE-1, OE-2, and OE-3, respectively.

[0117] from Figure 5 The results show that after 12 days of drought, wild-type Arabidopsis exhibited leaf curling and yellowing, while this phenomenon was not obvious in overexpressing Arabidopsis. Physiological and biochemical indicators of transgenic Arabidopsis were measured. After drought treatment, the relative water content of transgenic Arabidopsis plants decreased more slowly than that of wild-type plants, malondialdehyde (MDA) content was lower, and peroxidase activity (POD) and proline (Pro) content were higher. These results reveal from different perspectives that overexpression of the FvDi19-3 gene can enhance the drought resistance of Arabidopsis plants.

[0118] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A type of strawberry FvDi19-3 Genes, strawberries FvDi19-3 The full-length coding region cDNA of the gene, containing the strawberry FvDi19-3 Genes or the strawberry FvDi19-3 The application of recombinant expression vectors of the full-length coding region cDNA of a gene in improving drought resistance in plants, wherein the plant is strawberry or Arabidopsis thaliana; The strawberry FvDi19-3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The strawberry FvDi19-3 The full-length coding region cDNA sequence of the gene is shown in SEQ ID NO:

2.

2. A method for cultivating drought-resistant plants, characterized in that, Will contain strawberries FvDi19-3 Genes or strawberries FvDi19-3 The recombinant expression vector containing the full-length coding region of the gene was introduced into plants to enhance the expression of strawberry cDNA. FvDi19-3 The gene expression level was adjusted to obtain plants with improved drought resistance, wherein the plants were strawberries or Arabidopsis thaliana; The strawberry FvDi19-3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The strawberry FvDi19-3 The full-length coding region cDNA sequence of the gene is shown in SEQ ID NO: 2.

Images