Application of Rosa hybrida RhMYB28 in regulating plant proanthocyanidin synthesis and enhancing plant stress resistance

Abstract

The application discloses application of a Chinese rose RhMYB28 in regulating plant proanthocyanidin synthesis and enhancing plant stress resistance, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the Chinese rose RhMYB28 is shown in a sequence table SEQ ID NO:1, and the sequence of the corresponding protein is shown in SEQ ID NO:2. The gene can increase the content of plant proanthocyanidin and enhance the stress resistance of plants. Direct transformation of the gene fragment into plants can increase the content of proanthocyanidin in transgenic plants and enhance the stress resistance of plants.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of rose RhMYB28 in regulating proanthocyanidin synthesis and enhancing plant stress resistance. Background Technology

[0002] Proanthocyanidins (PA) are a mixture of flavonoids with a unique molecular structure (Dixon RA, 2005), widely found in stems, bark, flowers, seeds, and pericarps (Zhang Yin, 2021). The basic unit of proanthocyanidins is a flavan-3-ol compound (Zhang Huiwen et al., 2015), which can be classified according to the type of flavan-3-ol unit into catechin, epicatechin, gallocatechin, epielechin, afzelechin, and epigallocatechin (Lelono RA, 2013; Zhao Guoling et al., 2012). Based on the linkage between units, they can be classified into type A (Ma Q, 2014) linked by C-C bonds and CO-C bonds, and type B (Infante R, 2011) linked by a single C-C bond. Based on the complexity of polymerization, proanthocyanidins with 2-5 polymers are generally called oligomeric proanthocyanidins (OPC), also known as soluble proanthocyanidins, while those with more than 5 polymers are called polymeric proanthocyanidins (PPC), or simply insoluble proanthocyanidins. Depending on the modification of the hydroxyl groups, there are methylation, esterification, glycosylation, and other methods. These characteristics are what create the diverse structural properties of proanthocyanidins.

[0003] Studies have shown that increased proanthocyanidin content can enhance plant resistance to both biotic and abiotic stresses, playing a crucial role in protecting plants from adverse environmental conditions such as ultraviolet radiation, predator feeding, and microbial invasion (Dixon RA, 2013; Wang LJ, 2017). Furthermore, moderate proanthocyanidin content in forage can prevent potential bloating in animals, enhance forage digestibility (Li YG, 1996), and improve the bioavailability of rumen-protected proteins (Naumann HD, 2013). For humans, proanthocyanidins are natural antioxidants beneficial to health (Santos-buelga C, 2000). Free radicals and oxidative stress are among the causes of cardiovascular disease, and proanthocyanidins can effectively scavenge oxygen free radicals, maintain heart function, lower blood cholesterol and blood sugar levels, and resist atherosclerosis. Through a series of effects, they achieve the goal of preventing cardiovascular disease and protecting the cardiovascular system (Zhao Gaixia, 2010; Serra AT, 2012). Studies have found that green tea extract is rich in PA (Molan AL, 2009), which can resist aging and prevent cardiovascular diseases (Dixon RA, 2005). Proanthocyanidins in grape seeds have positive effects on combating atherosclerosis and protecting vascular endothelial cells (Zhao G X, 2010; Ma Yabing, 2004; Aldini G, 2003). With further research, proanthocyanidins extracted from blackberries, lychees, and larch trees have shown varying degrees of antioxidant activity (Xu Huaide et al., 2008; Wang Wei et al., 2011; Jiang Qizhong, 2010). In addition, proanthocyanidins can determine the pigments and flavors of plants and their derivatives, including some fruits such as persimmons (Salvador A, 2007), strawberries (Schaart JG, 2013), grapes, and their processed products like wine (Bogs J, 2017). The seed coat color of crops becomes darker due to the accumulation of proanthocyanidins; for example, cultivated yellow rapeseed has high oil content, a thin seed coat, and is easy to process (Tang ZL, 2010). Currently, proanthocyanidins are widely used in the pharmaceutical, food, and cosmetic markets as natural antioxidants, nutritional fortifiers, and DNA protectants.

[0004] The Chinese rose (Rosa chinensis 'Old Blush') is a perennial deciduous shrub belonging to the genus Rosa in the family Rosaceae. Due to its long flowering period, rich flower colors, and diverse qualities, it ranks first among the four major cut flowers and has a long history of cultivation, widely used in landscaping. Besides being an ornamental plant, the Chinese rose also has certain medicinal value. Its petals and fruits are rich in anthocyanins, and the resulting flower tea has beauty and skin-nourishing effects. Pigments are one of the main nutrients ingested by humans, and anthocyanins are natural antioxidants that play an important role in preventing cardiovascular diseases and delaying cell aging (Heim KE, 2002). By rationally utilizing the anthocyanin resources in Chinese roses, natural and harmless functional foods, medicines, cosmetics, and other products can be developed, expanding the market. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the functional gene RhMYB28 isolated from roses in regulating proanthocyanidin synthesis in plants, and this gene is related to plant stress resistance. The gene is involved in proanthocyanidin synthesis. When the complete translation region of this gene is combined with the cauliflower mosaic virus promoter and directly transferred into ordinary plants, the proanthocyanidin content of the transgenic plants is significantly increased, and the stress resistance of the transgenic plants is significantly enhanced.

[0006] The present invention is specifically implemented using the following technical solutions:

[0007] This invention provides the gene coding sequence for expressing RhMYB28 in roses and its function, specifically including: cloning the nucleotide coding sequence of the RhMYB28 gene, constructing an expression vector, and transforming this gene into tobacco for molecular identification and phenotypic observation.

[0008] This invention first clones the RhMYB28 functional gene from roses. This gene fragment is a DNA molecule with a specific sequence, an open reading frame of 921 bp, and its nucleotide sequence is shown in SEQ ID NO: 1 of the sequence listing.

[0009] The present invention also provides the protein coding sequence of this rose RhMYB28, which has 306 amino acid residues, and its corresponding amino acid sequence is shown in SEQ ID NO:2.

[0010] This invention also provides a pair of nucleotide primers for retrieving the RhMYB28 gene from rose samples. These primers are designed based on the RhMYB28 gene, and PCR amplification of cDNA from rose petal samples using this primer pair yields a 921 bp gene fragment. The DNA sequence of this primer pair is shown below:

[0011] P1 forward primer: 5'ATGGGTAGAGGTCCTCGGT3' (see sequence listing SEQ ID NO:3)

[0012] P2 reverse primer: 5'TCAACTCAACATAACATTTAGATCA3' (see sequence listing SEQ ID NO:4)

[0013] This invention also provides a pair of nucleotide primers for detecting the expression of the rose RhMYB28 gene in transgenic tobacco. These primers are designed based on the RhMYB28 gene. Using this primer pair, RT-PCR amplification of cDNA from tobacco samples transformed with this gene can detect whether the gene is expressed in transgenic tobacco, yielding a 341 bp gene fragment. The DNA sequence of this primer pair is as follows:

[0014] P3 forward primer: 5'CTTGGTCAAGGCTGTTAATTCTGTC 3' (see sequence listing SEQ ID NO:5)

[0015] P4 reverse primer: 5'CATTCCCAAGCCAATCCTCAT 3' (see sequence listing SEQ ID NO: 6)

[0016] The RhMYB28 encoding gene provided by this invention can be introduced into plant cells or tissues using any vector capable of guiding the expression of exogenous genes in plants, through conventional biotechnological methods such as direct DNA transformation, electrocoagulation, or Agrobacterium-mediated transformation. The transformed plant tissues can then be cultured into plants. When constructing plant expression vectors using the gene fragments of this invention, any enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the vectors used can be processed, such as by adding antibiotic resistance markers (e.g., kanamycin or hygromycin). The hosts for transformation include various plants, including tobacco, to cultivate plant species with significantly enhanced stress resistance.

[0017] This invention also provides a method for extracting proanthocyanidins from transgenic tobacco. Accurately weigh 0.4 g of leaves and petals, add 3 mL of extraction solution (acetone:water:glacial acetic acid = 70:29.5:0.5, volume ratio), and sonicate at 35°C for 1 h in a water bath, shaking for 2 min every 20 min during this period. Centrifuge at 12000 rpm for 10 min, collect the supernatant in a new centrifuge tube, and extract twice more with chloroform and n-hexane, respectively. Then filter through a 0.45 μm nylon microporous filter and store at -40°C for proanthocyanidin content determination. Attached Figure Description

[0018] Figure 1: This is a schematic diagram of the structure of the supercapacity plant expression vector pCAMBIA2300s of the present invention.

[0019] Figure 2 : Schematic diagram of the construction of the super-plant expression vector pCAMBIA2300s---RhMYB28 of the present invention.

[0020] Figure 3 Semi-quantitative results of the RhMYB28 gene in WT wild-type tobacco and transgenic tobacco (OE3 and OE6 are two transgenic lines).

[0021] Figure 4 Results of petal phenotype and proanthocyanidin content detection of the RhMYB28 gene in transgenic plants. Figure 4 In the figure: A shows the petal phenotypes of WT wild-type tobacco and transgenic tobacco; B shows the proanthocyanidin content in the leaves of RhMYB28 transgenic tobacco. *, * and *** indicate the difference levels of P<0.05, P<0.01, and P<0.001, respectively.

[0022] Figure 5 Dehydrated phenotypes of RhMYB28 (OE-3, OE-6) transgenic tobacco and control wild-type tobacco (WT). Figure 5 In the diagram: A represents the phenotype of leaves from 20-day-old seedlings before and after natural dehydration; B represents the water loss rate calculated by naturally dehydrating leaves from approximately 20-day-old seedlings of each line for 70 minutes, with fresh weight measured every 10 minutes, using the material before dehydration as a control. *, *, and *** indicate the difference levels of P<0.05, P<0.01, and P<0.001, respectively.

[0023] Figure 6 Drought phenotypes of RhMYB28 (OE-3, OE-6) transgenic tobacco and control wild-type tobacco (WT). Wherein: A represents the phenotype of 30-day-old seedlings before and after 15 days of drought treatment; B and C represent the electrical conductivity and malondialdehyde (MDA) content of transgenic tobacco and control wild-type tobacco after drought treatment, respectively. *, *, and *** indicate the difference levels of P<0.05, P<0.01, and P<0.001, respectively.

[0024] Figure 7 Chemical histochemical staining analysis of RhMYB28 (OE-3, OE-6) transgenic tobacco and control wild-type tobacco (WT) after drought treatment. In the figure, A shows NBT histochemical staining of tobacco plants before and after drought treatment; B shows DAB histochemical staining of tobacco plants before and after drought treatment. Detailed Implementation

[0025] Example 1: Isolation and cloning of the RhMYB28 gene

[0026] In the early stages of this invention, bioinformatics analysis of the rose EST database (http: / / bioinfo.bti.cornell.edu / cgi-bin / rose_454 / index.cgi) revealed a new MYB-type transcription factor, named RhMYB28. Specific primer P1 was designed.

[0027] (See sequence listing SEQ ID NO:3) forward primer 5'ATGGGTAGAGGTCCTCGGT3' and P2 (see sequence listing SEQ ID NO:4) reverse primer 5'TCAACTCAACATAACATTTAGATCA3' amplified the 1-855bp sequence from cDNA obtained by reverse transcription of the RNA from the petals of the modern rose variety 'Violet'. The 1-921bp sequence in the amplified product is the RhMYB28 sequence of this invention.

[0028] The specific steps are as follows:

[0029] 1. Total RNA was extracted from the petals of the rose variety 'Violet' using the commonly used CTAB method (refer to: Plant Genetic Engineering, edited by Wang Guanlin and Fang Hongjun). The specific steps are as follows:

[0030] 1) Add CTAB (hexadecyltrimethylammonium bromide) extraction buffer (2% (w / v) CTAB, NaCl) to the centrifuge tube.

[0031] 1.4 mol / L, EDTA (ethylenediaminetetraacetic acid) 20 mmol / L, Tris·Cl 100 mmol / L, 2% (w / v) pvp) and 10% β-mercaptoethanol, preheated in a water bath.

[0032] 2) Grind the rose petals under liquid nitrogen, add them to the extract, mix well, and incubate in a 65°C water bath for 10 minutes.

[0033] 3) Add an equal volume of chloroform:isoamyl alcohol (volume ratio 24:1), invert to mix, let stand for 10 min, and centrifuge at 12000g for 10 min at 4℃.

[0034] 4) Collect the supernatant and repeat step 3).

[0035] 5) Take the supernatant, add LiCl to a final concentration of 2 mol / L, incubate on ice for 10-12 hours, centrifuge at 12000g and 4℃ for 15 minutes, discard the supernatant, wash the precipitate twice with 75% ethanol, and dissolve it in an appropriate amount of DEPC (diethyl pyrocarbonate) treated water for later use.

[0036] 6) Using total RNA extracted from the petals of the rose variety 'Violet' as a template, the first strand of cDNA was synthesized by reverse transcription using reverse transcriptase (purchased from Takara Bio Engineering Dalian Co., Ltd.). The reaction conditions were: 65℃ for 5 min, 42℃ for 50 min, and 70℃ for 3 min.

[0037] 10 minutes.

[0038] 7) Specific primer P1 (see sequence listing SEQ ID NO:3) 5' designed based on the sequence from the transcription sequencing.

[0039] ATGGGTAGAGGTCCTCGGT 3' and P2 (see sequence listing SEQ ID NO:4) 5'

[0040] TCAACTCAACATAACATTTAGATCA 3', amplified the cDNA obtained by reverse transcription of RhMYB28 from the petal RNA of the rose variety 'Violet'.

[0041] Reaction conditions: 94℃ pre-denaturation for 4 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 37 cycles; 72℃ extension for 10 min. The amplified PCR product was then ligated into… The 18-T vector (purchased from Takara Bio Engineering Co., Ltd., Dalian) was used to screen positive clones and sequence them to obtain the desired full-length gene. This clone was named... 18-RhMYB28 plasmid.

[0042] Example 2: Construction and transformation of RhMYB28 gene overexpression vector

[0043] like Figure 2 To better elucidate the function of this gene, the applicant overexpressed it in tobacco and verified it through the phenotype of the transgenic plants. The specific steps were: first, the positive clone obtained in Example 1... The 18-RhMYB28 plasmid was double-digested with BamHI and SalI, and the target fragment was recovered. Simultaneously, the genetic transformation vector pCAMBIA2300s carrying the 35S promoter of the tobacco mosaic virus was digested using the same method (this genetic transformation vector was constructed and donated by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei Province). After digestion, the digested fragment containing the RhMYB28 gene and the digested pCAMBIA2300s were used... Figure 1 The vector was used for ligation reaction and transformed into Escherichia coli DH5α (E. coli strain purchased from Takara Bio Engineering Dalian Co., Ltd.). Positive clones were screened by enzyme digestion to obtain the transformation vector, which was named pCAMBIA2300s-RhMYB28.

[0044] The genetic transformation of tobacco was introduced into early-flowering tobacco using Agrobacterium-mediated genetic transformation. After infection, co-culture, and screening for kanamycin-resistant transformed seedlings, transgenic plants were obtained through conventional steps such as rooting, hardening-off, and transplanting.

[0045] The main steps and reagents used in the genetic transformation of this invention are described below:

[0046] (1) Abbreviations for reagents and solutions

[0047] The abbreviations for the substances used in the culture medium in this invention are as follows: 6-BA (6-Benzylaminopurine); NAA (Naphthaleneacetic acid); Kan (Kanamycin); Cef (Cefotaxime).

[0048] (2) Culture medium formulation for genetic transformation of early-flowering tobacco

[0049] Table 1 lists the components and dosages of various culture media of the present invention.

[0050] Table 1. Design of conversion culture medium for early-flowering tobacco.

[0051]

[0052]

[0053] Note: For the preparation of MS medium, please refer to the method reported in Murashige T. and F. Skoog. Physiol. Plant, 1962, 15: 473-497.

[0054] In Table 1, Kan (Kanamycin) and Cef (Cefotaxime) were sterilized by filtration through a 0.45 μm filter membrane. After the culture medium other than Kan and Cef was sterilized by conventional autoclaving at 121°C for 20 min, the sterilized Kan and Cef were added to the clean bench when the culture medium cooled to 50-60°C.

[0055] (1) Steps of Agrobacterium-mediated genetic transformation

[0056] 1) Culture of Agrobacterium

[0057] First, Agrobacterium EHA105 was pre-cultured for 48 hours at 28°C on solid LB medium with corresponding resistance selection (10 g / L peptone + 5 g / L yeast extract + 10 g / L sodium chloride + 100 mg / L Kan + 1.5 g / L agar). A single colony of the pre-cultured Agrobacterium was then picked and inoculated into liquid LB medium with corresponding resistance selection (10 g / L peptone + 5 g / L yeast extract + 10 g / L sodium chloride + 100 mg / L Kan), and incubated overnight at 28°C with a shaker at 200 rpm until the bacterial concentration reached OD500. 600 The value is approximately 0.6.

[0058] 2) Leaf disc conversion method

[0059] a. Cut the fully unfolded tender leaves from the upper part of the sterile seedlings of early-flowering tobacco, cut the leaves into small pieces of 0.8cm×0.8cm, and put them into a sterile beaker;

[0060] b. Pour the prepared bacterial solution into a beaker and gently swirl the beaker. Let the leaves soak in the bacterial solution for 10 minutes;

[0061] c. Remove the leaves from step b, transfer them to sterilized filter paper to blot dry; then place them on the co-culture medium as described above and incubate in the dark for three days at a temperature of 28°C.

[0062] d. Three days later, the leaves were transferred to the bud selection medium as shown in Table 1 and cultured under alternating light and dark conditions (light intensity 1000-1500 lx, light time: 16 h / d, dark time: 8 h / d) to screen and differentiate Kan resistant buds. The culture temperature was 28℃.

[0063] e. After the resistant shoots are formed, they are cut off and transferred to the seedling selection medium as described above. They are cultured under alternating light and dark conditions (light intensity 1000-1500 lx, light time: 16 h / d, dark time: 8 h / d) to screen for Kan resistant shoots. The culture temperature is 28℃.

[0064] f. Transfer the selected resistant seedlings to the rooting selection medium as described above to allow them to root. Culture them under alternating light and dark conditions (light intensity 1000-1500 lx, light duration: 16 h / d, dark duration: 8 h / d) at a temperature of 28 °C.

[0065] 2) Transplanting

[0066] Wash away the residual culture medium from the roots of the genetically modified early-flowering tobacco plants, transfer the seedlings with good root systems to the greenhouse, and keep them moist for the first week.

[0067] A total of 15 strains of T0 generation transgenic tobacco transformed with plasmid pCAMBIA2300s-RhMYB28 were obtained with positive PCR test results.

[0068] Example 3: Phenotypic observation and RT-PCR detection of the RhMYB28 gene transgenic T0 generation in the field.

[0069] To verify whether RhMYB28 has been transferred into tobacco and its expression status, this invention used the commonly used RT-PCR method to detect the expression of the RhMYB28 gene in some transgenic tobacco plants (results are shown in...). Figure 3 The specific steps are as follows: Total RNA was extracted from flowers of transgenic tobacco lines 1-6 using TRIZOL reagent (purchased from Takara Bio Engineering Dalian Co., Ltd.) (extraction method according to the TRIZOL reagent instructions). The RNA was then reverse transcribed using reverse transcriptase (purchased from Takara Bio Engineering Dalian Co., Ltd.) to synthesize the first strand of cDNA. The reaction conditions were 65℃ for 5 min, 42℃ for 50 min, and 70℃ for 10 min. The cDNA obtained by reverse transcription was first detected and its concentration adjusted using the reported housekeeping gene EF1α. Based on the sequence of the housekeeping gene EF1α, a pair of primers, P5 forward primer (5-TGGTTGTGACTTTTGGTCCCA) and P6 reverse primer (5-ACAAACCCACGCTTGAGATCC), were designed for PCR detection. The reaction conditions were: 94℃ pre-denaturation for 4 min; 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 30 sec, 28 cycles; extension at 72℃ for 10 min. The experimental results are as follows: Figure 3 As shown, the housekeeping gene EF1α was amplified in both wild-type and transgenic tobacco, with consistent brightness. Then, based on the RhMYB28 gene sequence, a pair of primers were designed near the 3' end: a forward primer P3 (see SEQ ID NO:5, sequence listing) (5-CTTGGTCAAGGCTGTTAATTCTGTC) and a reverse primer P4 (see SEQ ID NO:6, sequence listing) (5-CATTCCCAAGCCAATCCTCAT). RT-PCR detection was performed under the following conditions: 94℃ pre-denaturation for 4 min; 35 cycles of 94℃ for 30 sec, 60℃ for 30 sec, and 72℃ for 1 min; extension at 72℃ for 10 min. The results showed that RhMYB28 gene expression was detected in all three transgenic tobacco plants, as shown in the figure. Figure 3 As shown. Figure 3 The results show: 1: PCR amplification results of untransformed tobacco. 2-3: RT-PCR amplification results of transgenic tobacco transformed with plasmid pCAMBIA2300s-RhMYB28.

[0070] Example 4: Extraction and determination of proanthocyanidins from RhMYB28 early-flowering tobacco

[0071] Accurately weigh 0.4 g of leaf material and add 3 mL of extraction buffer (acetone:water:glacial acetic acid = 70:29.5:0.5, volume ratio). Sonicate at 35℃ for 1 h in a water bath, shaking for 2 min every 20 min. Centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new centrifuge tube, and extract twice with chloroform and n-hexane, respectively. Filter through a 0.45 μm nylon microporous filter and store at –40℃. Quantitative analysis was performed using a NanoDrop 2000C spectrophotometer. Add 200 μL of p-dimethylaminocinnamaldehyde (DMACA; Sigma-Aldrich, MO, USA) (0.1% DMACA, 90% reagent-grade ethanol, 10% HCl) to 50 μL of solution. Measure at 640 nm every 1 min for 10 min, and record the maximum reading. Perform three replicates and average the results. The proanthocyanidin content was quantified using the standard (+)-catechin (Sigma-Aldrich, MO, USA). Results are as follows: Figure 4 ,Depend on Figure 4 It was found that the flower color of the transgenic plants was significantly lighter than that of the wild type, and the content of proanthocyanidins in the petals of the transgenic plants was significantly higher than that of the wild type. This indicates that RhMYB28 can promote the accumulation of proanthocyanidins.

[0072] Example 5: Determination of stress resistance in RhMYB28 converted tobacco

[0073] To better elucidate the function of this gene, OE-3 and OE-6 were identified as two overexpression lines using semi-quantitative RT-PCR. These two lines, along with the control (WT), were then subjected to dehydration and H2O2 treatment. The specific steps were as follows: First, 20-day-old transgenic seedlings from each line were placed on petri dishes for natural dehydration for 70 minutes. The weight of untransformed plants and the two transgenic lines was measured every 10 minutes before and after dehydration, and the water loss rate was finally calculated. The results are as follows: Figure 5 ,Depend on Figure 5 It was found that the wild-type plants exhibited more severe leaf wilting and a higher dehydration rate compared to the transgenic plants. This indicates that the transgenic plants have stronger dehydration tolerance. Transgenic tobacco plants grown for approximately 30 days and untransgenic plants were drought-treated for 15 days. Histochemical staining analysis was performed on the accumulation of reactive oxygen species (ROS) in the untransgenic plants and the two transgenic lines before and after drought treatment. Diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) were used to detect H2O2 and O2, respectively. - The accumulated staining was analyzed (based on the depth and extent of staining), and the results are as follows: Figure 7 ,Depend on Figure 7 It can be seen that after drought stress, the O2 content in the leaves of transgenic plants decreased. -The accumulation of reactive oxygen species (ROS) and H2O2 was significantly lower in the transgenic plants than in the wild type. This indicates that under drought conditions, the leaves of transgenic plants accumulate less reactive oxygen species. The conductivity and malondialdehyde (MDA) content were also measured, and the results were as follows: Figure 6 .Depend on Figure 6 It can be seen that the leaves of wild-type plants wilt more severely than those of transgenic plants, and the cell membranes of leaves of wild-type plants have higher permeability than those of transgenic plants.

[0074] The specific steps for DAB and NBT histochemical staining analysis are as follows:

[0075] For O2 - The test involved immersing the leaves in 1 mg / ml water. -1 Leaves showed a distinct phenotype (leaf turning blue) after 1-2 hours in NBT solution (pH 7.8). H2O2 detection was performed by immersing leaves in 1 mg / ml solution. -1 In DAB working solution (pH 7.8), stain under light for 8 hours. After a clear phenotype is observed, decolorize (to brown). Then, completely remove the green color from the leaves with anhydrous ethanol, and finally wash with water.

Claims

1. Rose RhMYB28 The application of genes in regulating proanthocyanidin synthesis and enhancing plant stress resistance is characterized by, The rose RhMYB28 The nucleotide sequence of the gene is shown in SEQ ID NO:1 of the sequence listing; the rose RhMYB28 The application of the gene is to overexpress the rose in tobacco. RhMYB28 Genes are used to enhance their resistance to drought stress.

Images