Use of pesticidal proteins

Abstract

The present application relates to the use of a kind of insecticidal protein, the insecticidal protein can be used to control pod borer pest, the method for controlling pod borer pest includes: pod borer pest is contacted with at least Cry2Ab protein.The present application controls pod borer pest by producing the Cry2Ab protein capable of killing pod borer in plant body;Compared with the agricultural control method, chemical control method and biological control method used in prior art, the present application protects the whole growth period and whole plant of plant to prevent the invasion of pod borer pest, and there is no pollution, no residue, stable, complete, simple, convenient and economic.

Description

Technical Field

[0001] This invention relates to the use of an insecticidal protein, and more particularly to the use of a Cry2Ab protein expressed in plants to control damage to plants by the bean pod borer. Background Technology

[0002] The bean pod borer (Etiella zinckenella), also known as the cowpea pod borer, soybean pod borer, or locust pod borer, belongs to the family Pyralidae in the order Lepidoptera. It mainly damages leguminous plants such as soybeans, broad beans, mung beans, cowpeas, kidney beans, peas, black locusts, hairy peas, sophora flavescens, vetch, and quinoa. The larvae damage leaves, buds, flowers, and pods, rolling leaves or boring into pods to feed on young seeds. Excrement often accumulates inside the pods and outside the boreholes. In mild cases, the borer creates notches and holes in the beans; in severe cases, it hollows out the entire pod. Affected pods taste bitter, causing bud drop, flower drop, pod drop, and shoot dieback.

[0003] Cultivated soybean (Glycine max (L.) Merri) is a globally grown and important economic crop, serving as a major source of vegetable oil and protein. It is also a significant food and feed crop in China. Soybean is one of the favorite plants of the soybean pod borer, an insect with a global distribution. It is widely distributed in my country, occurring in all provinces except Tibet, with high densities in areas south of the Yellow River and in most parts of Gansu and Qinghai provinces. Soybean pod borer damage causes severe economic losses to soybeans annually. Common methods for controlling the soybean pod borer include agricultural control, chemical control, and biological control.

[0004] Agricultural pest control involves the comprehensive and coordinated management of multiple factors within the entire farmland ecosystem. This includes regulating crops, pests, and environmental factors to create a favorable ecological environment for crop growth and unfavorable for the occurrence of the soybean pod borer. For example, irrigation can be used to control pests. In areas with convenient water sources, several irrigations can be conducted in autumn and winter to increase the mortality rate of overwintering larvae. Irrigation can also be conducted 1-2 times during the summer soybean flowering and pod-setting period to increase the mortality rate of larvae entering the soil and thus increase soybean yield. However, this method has limited effectiveness and consumes a great deal of water resources.

[0005] Chemical control, also known as pesticide control, utilizes chemical insecticides to kill pests. It is a crucial component of integrated pest management for the bean pod borer, characterized by its speed, convenience, simplicity, and high economic efficiency. It is an indispensable emergency measure, especially in cases of large-scale bean pod borer outbreaks. Currently, the main method of chemical control is spraying. Suitable sprays include 21% cypermethrin·malachite EC, 2.5% deltamethrin EC, 2.5% deltamethrin, 2.5% deltamethrin EC, and 55% cypermethrin·chlorpyrifos EC. Spraying should begin from the budding stage, once every 10 days at the bud and flowering stage, to control the damage. If other pests need to be controlled simultaneously, comprehensive spraying should be performed. However, chemical control also has limitations. Improper use can lead to phytotoxicity in crops, pesticide resistance in pests, harm to natural enemies, environmental pollution, damage to the farmland ecosystem, and pesticide residues threatening the safety of humans and livestock.

[0006] Biological control utilizes beneficial organisms or their metabolites to control pest populations, thereby reducing or eliminating pests. For example, pesticides with low toxicity to natural enemies are selected, and the application time is adjusted based on the differences in the occurrence periods of pests and natural enemies in the field, avoiding application when natural enemies are abundant to protect them. Secondly, releasing Trichogrammatae wasps at the beginning of peak egg-laying can achieve control efficacy of over 80%. Its advantages include safety for humans and livestock, minimal environmental pollution, and long-term control of certain pests; however, its effectiveness is often inconsistent, and the same investment is required regardless of the severity of the bean pod borer infestation.

[0007] To address the limitations of agricultural, chemical, and biological control methods in practical applications, scientists have discovered that transferring insect-resistant genes encoding insecticidal proteins into plants can produce insect-resistant transgenic plants for controlling plant pests. Cry2Ab insecticidal protein is one such protein, an insoluble parasporal crystalline protein produced by Bacillus thuringiensis subsp. kurstaki (Btk).

[0008] When the Cry2Ab protein is ingested by insects, it enters the midgut, where the protoxin dissolves in the alkaline pH environment. The N- and C-termini of the protein are digested by alkaline proteases, converting the protoxin into an active fragment. This active fragment binds to receptors on the surface of the midgut epithelial cell membrane, inserts into the intestinal membrane, causing perforation lesions, disrupting osmotic pressure changes and pH balance across the cell membrane, thus interfering with the insect's digestive process and ultimately leading to its death.

[0009] Plants transgenic with the Cry2Ab gene have been shown to resist damage from lepidopteran pests such as the corn borer and the millet borer. However, there are no reports to date on controlling the damage caused by the bean pod borer by producing transgenic plants that express the Cry2Ab protein. Summary of the Invention

[0010] The purpose of this invention is to provide a use for an insecticidal protein, and for the first time provides a method for controlling the bean pod borer by producing transgenic plants expressing the Cry2Ab protein, which effectively overcomes the technical deficiencies of existing agricultural control, chemical control and biological control technologies.

[0011] To achieve the above objectives, the present invention provides a method for controlling the bean pod borer pest, comprising contacting the bean pod borer pest with at least the Cry2Ab protein.

[0012] Furthermore, the Cry2Ab protein is present in at least the host cells that produce the Cry2Ab protein, and the bean pod borer pest comes into contact with the Cry2Ab protein at least by ingesting the host cells.

[0013] Furthermore, the Cry2Ab protein is present in at least the bacteria or transgenic plants that produce the Cry2Ab protein, and the bean pod borer pest comes into contact with the Cry2Ab protein by ingesting the tissues of the bacteria or the transgenic plants. After contact, the growth of the bean pod borer pest is inhibited and / or it leads to death, thereby achieving control over the plants damaged by the bean pod borer.

[0014] The genetically modified plant can be at any stage of growth.

[0015] The tissues of the genetically modified plant are roots, leaves, stems, fruits, and flowers.

[0016] The control measures against plants damaged by the bean pod borer will not change due to changes in planting location and / or planting time.

[0017] The plants mentioned are soybeans, lentils, mung beans, cowpeas, common beans, peas, locust trees, or black locust trees.

[0018] The step preceding the contact step is to plant a plant containing a polynucleotide encoding the Cry2Ab protein.

[0019] Preferably, the Cry2Ab protein has the amino acid sequence shown in SEQ ID NO:1. The Cry2Ab protein has the nucleotide sequence shown in SEQ ID NO:2.

[0020] Based on the above technical solution, the plant also includes at least one second polynucleotide that is different from the polynucleotide encoding the Cry2Ab protein.

[0021] Furthermore, the second polynucleotide encodes a Cry-type insecticidal protein, a Vip-type insecticidal protein, a protease inhibitor, a lectin, an α-amylase, or a peroxidase. The protein encoded by the second polynucleotide is not the Cry1Ac protein.

[0022] Alternatively, the second polynucleotide is a dsRNA that inhibits important genes in the target insect pest.

[0023] To achieve the above objectives, the present invention also provides the use of Cry2Ab protein in controlling the bean pod borer pest.

[0024] To achieve the above objectives, the present invention also provides a method for producing a plant that controls the bean pod borer pest, comprising introducing a polynucleotide sequence encoding the Cry2Ab protein into the genome of said plant.

[0025] To achieve the above objectives, the present invention also provides a method for producing plant seeds that control the bean pod borer pest, comprising self-pollinating or hybridizing the plants obtained by the method with a second plant to produce seeds containing a polynucleotide sequence encoding the Cry2Ab protein.

[0026] To achieve the above objectives, the present invention also provides a method for cultivating plants to control the bean pod borer pest, comprising:

[0027] Plant at least one plant seed, the genome of which includes a polynucleotide sequence encoding the Cry2Ab protein;

[0028] To allow the plant seeds to grow into plants;

[0029] The plants are grown under conditions of artificial inoculation with the bean pod borer pest and / or natural occurrence of damage by the bean pod borer pest, and the harvested plants exhibit reduced plant damage and / or increased plant yield compared to other plants that do not have a polynucleotide sequence encoding the Cry2Ab protein.

[0030] In this invention, "contact" refers to insects and / or pests touching, staying on, and / or feeding on plants, plant organs, plant tissues, or plant cells. The plants, plant organs, plant tissues, or plant cells may express insecticidal proteins within themselves, or they may have insecticidal proteins on their surface and / or have microorganisms that produce insecticidal proteins.

[0031] In this invention, the terms "control" and / or "prevention" refer to the bean pod borer pest coming into contact with the Cry2Ab protein at least once, resulting in inhibited growth and / or death of the pest. Further, the bean pod borer pest comes into contact with the Cry2Ab protein at least once by ingesting plant tissue, resulting in inhibited growth and / or death of all or part of the pest. Inhibition refers to sublethality, meaning it does not cause death but induces some effect on growth, development, behavior, physiology, biochemistry, and tissue aspects, such as slowed and / or stopped growth. Simultaneously, the plant should be morphologically normal and culturable under conventional methods for product consumption and / or generation. Furthermore, plants and / or seeds containing the polynucleotide sequence encoding the Cry2Ab protein that control the bean pod borer pest exhibit reduced plant damage compared to non-transgenic wild-type plants under conditions of artificial inoculation with the bean pod borer pest and / or natural pest infestation. Specific manifestations include, but are not limited to, improved stem resistance, and / or increased grain weight, and / or increased yield. The "control" and / or "prevention" effect of the Cry2Ab protein against the bean pod borer can exist independently and is not weakened or eliminated by the presence of other substances that can "control" and / or "prevent" the bean pod borer pest. Specifically, if any tissue of a transgenic plant (containing a polynucleotide sequence encoding the Cry2Ab protein) simultaneously and / or asynchronously contains and / or produces the Cry2Ab protein and / or another substance that controls the bean pod borer pest, then the presence of the other substance neither affects the “control” and / or “prevention” effect of the Cry2Ab protein on the bean pod borer, nor causes the “control” and / or “prevention” effect to be wholly and / or partially achieved by the other substance, and is unrelated to the Cry2Ab protein. In the field, the feeding process of the bean pod borer on plant tissue is usually brief and difficult to observe with the naked eye. Therefore, under conditions of artificial inoculation of the bean pod borer and / or natural occurrence of damage by the bean pod borer, such as the presence of dead bean pod borers in any tissue of a transgenic plant (containing a polynucleotide sequence encoding the Cry2Ab protein), and / or the presence of bean pod borers with inhibited growth on which they remain, and / or reduced plant damage compared to non-transgenic wild-type plants, the method and / or use of the present invention is achieved, namely, the method and / or use of controlling the bean pod borer by having the bean pod borer at least come into contact with the Cry2Ab protein.

[0032] In this invention, the expression of the Cry2Ab protein in a transgenic plant can be accompanied by the expression of one or more Cry-type insecticidal proteins and / or Vip-type insecticidal proteins. The co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved through genetic engineering to include and express the desired genes in the plant. Alternatively, one plant (the first parent) can be genetically engineered to express the Cry2Ab protein, and a second plant (the second parent) can be genetically engineered to express Cry-type insecticidal proteins and / or Vip-type insecticidal proteins. Offspring plants expressing all genes introduced from both the first and second parents are obtained through hybridization.

[0033] RNA interference (RNAi) refers to a highly conserved evolutionary phenomenon characterized by the efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). Therefore, in this invention, RNAi technology can be used to specifically knock out or shut down the expression of specific genes in target insect pests.

[0034] The bean pod borer (Etiella zinckenella) described in this invention is an insect belonging to the family Pyralidae in the order Lepidoptera. The adult is 10–12 mm long with a wingspan of 20–24 mm, and is grayish-brown in color. The hindwings are grayish-white with brown edges; the forewings are narrow and long, grayish-brown, covered with dark brown, yellow, and white scales, with a white longitudinal band along the leading edge and a yellowish-brown crescent-shaped transverse band near the base of the wing (approximately one-third of the way down). The eggs are oval, with a long diameter of 0.5–0.6 mm and a short diameter of about 0.4 mm. Initially milky white, they later turn reddish-yellow, and the egg surface is covered with irregular reticulate patterns. Mature larvae are 14–18 mm long, purplish-red dorsally and green ventrally; the pronotum has a "V"-shaped black spot, with one black spot on each side and two small black spots in the center of the posterior margin. The dorsal line, subdorsal line, spiracular line, and subspiracular line are distinct. The pupa is 9-10 mm long. It is green when it first pupates, and turns yellowish-brown later. The abdomen is pointed at the end and darker in color along the midline of the back. The antennae and wings reach the posterior margin of the 5th abdominal segment, and there are 6 hooks at the end of the abdomen.

[0035] The bean pod borer is widely distributed in my country, with the most severe damage occurring in East China, Central China, South China, and Shaanxi Province. It feeds primarily on legumes. Adults live for 6-7 days, hiding on the undersides of leaves during the day and active at night. They are weak fliers and not strongly attracted to light. They mate on the day of emergence and lay eggs the following day. Each pod typically contains only one egg, though a few may contain more than two. Eggs are mostly laid among the fine hairs on the pod and under the sepals, with a few laid on the petioles. Each female moth can lay 80-90 eggs, with an incubation period of 3-6 days. The larvae have five instars, with a larval stage of 9-12 days. After hatching, the larvae crawl on the pods or spin silk to rotate between pods. After selecting a pod, they first spin a small white silken sac on the pod, then bore into the pod from under the sac to feed on the beans. First-instar larvae do not rotate between pods, while second- to fifth-instar larvae do, rotating between pods 1-3 times per pod. The larvae first infest the upper part of the plant, gradually spreading to the lower part, with the highest concentration of larvae generally found in the upper part. After maturing, the larvae leave the pod and enter the soil, spinning cocoons to pupate, with soil particles adhering to the outside of the cocoons. The larvae usually bore into the middle of the pod, feeding on the beans inside. Injured beans may develop notches, or even become hollow, filled with frass, turning brown and eventually rotting.

[0036] In classification systems, Lepidoptera are generally divided into suborders, superfamilies, and families based on morphological characteristics such as the venation sequence of adult wings, linkage patterns, and antennae types. The Pyralidae family is one of the most diverse families within Lepidoptera, with over 10,000 species discovered worldwide, and several thousand recorded in China alone. Most Pyralidae insects are agricultural pests, primarily damaging crops by boring into stems, such as the rice stem borer and the corn borer. Although the corn borer and the bean pod borer both belong to the Pyralidae family of Lepidoptera, they differ greatly in morphology and structure, aside from similarities in classification criteria. This is similar to the difference between strawberries and apples (both belonging to the Rosaceae family of the Rosales order); both have bisexual flowers, radial symmetry, and five petals, but their fruits and plant morphologies are vastly different. However, because people have limited contact with insects, especially agricultural pests, they pay less attention to these morphological differences, leading to the misconception that insects are largely similar in appearance. In fact, the bean pod borer has unique characteristics in both its larval and adult forms.

[0037] Insects belonging to the Pyralidae family not only differ significantly in morphological characteristics but also in their feeding habits. For example, the corn borer, also a member of the Pyralidae family, primarily infests corn, a member of the Poaceae family. The bean pod borer, on the other hand, prefers to feed on legumes. These differences in feeding habits suggest variations in the enzymes and receptor proteins produced by their digestive systems. Enzymes produced in the digestive tract are crucial for the function of Bt genes; only enzymes or receptor proteins that can bind to specific Bt genes can potentially exert an insecticidal effect on a particular Bt gene against that pest. Increasing research indicates that insects within the same order but different families, and even different species within the same family, exhibit varying sensitivities to the same Bt protein. For example, the Vip3Aa gene showed insecticidal activity against the rice stem borer (Chilosuppressalis) and the Asian corn borer (Ostrinia furnacalis), both belonging to the Pyralidae family. However, it had no effect on the Indian meal borer (Plodia interpunctella) and the European corn borer (Ostrinia nubilalis), both also belonging to the Pyralidae family. These pests all belong to the Pyralidae family of Lepidoptera, yet the same Bt protein exhibits different resistance effects against them. In particular, the European corn borer and the Asian corn borer, which even belong to the same genus (Ostrinia) within the Pyralidae family, show drastically different responses to the same Bt protein, further illustrating the complex and unpredictable interaction between Bt protein and enzymes and receptors within insects.

[0038] The genome of a plant, plant tissue, or plant cell as described in this invention refers to any genetic material within a plant, plant tissue, or plant cell, including the nucleus and plastid genome and the mitochondrial genome.

[0039] The polynucleotides and / or nucleotides described in this invention form a complete "gene" that encodes a protein or polypeptide in the desired host cell. Those skilled in the art will readily recognize that the polynucleotides and / or nucleotides of this invention can be placed under the control of regulatory sequences in the target host.

[0040] As is well known to those skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other, and vice versa. Because DNA replicates in plants, other complementary strands of DNA are produced. Thus, this invention includes the use of the polynucleotides and their complementary strands as exemplified in the sequence listing. The term "coding strand" as commonly used in the art refers to the strand that binds to the antisense strand. To express proteins in vivo, typically one strand of DNA is transcribed into a complementary strand of mRNA, which serves as a template for protein translation. The mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (codons are three nucleotides, and reading three at a time produces a specific amino acid) that can be read as an open reading frame (ORF) to form the target protein or peptide. This invention also includes RNA that functions substantially similarly to the DNA of the examples.

[0041] In this invention, nucleic acid molecules or fragments thereof hybridize with the Cry2Ab gene of this invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry2Ab gene of this invention. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. In this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that these two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. In this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low-string" conditions, the two nucleic acid molecules are called "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under conventional "high-string" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to be used as a primer or probe, it is only necessary to ensure that it has sufficient sequence complementarity so that it can form a stable double-stranded structure under the specific solvent and salt concentration used.

[0042] In this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions that promote DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, the stringent conditions described in this invention can be as follows: specific hybridization with SEQ ID NO:2 occurs at 65°C in a 6×SSC, 0.5% SDS solution, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0043] Therefore, sequences that have insecticidal activity and hybridize with SEQ ID NO:2 of the present invention under stringent conditions are included in the present invention. These sequences are at least about 40%-50% homologous to the sequences of the present invention, about 60%, 65%, or 70% homologous, or even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence homology.

[0044] The genes and proteins described in this invention include not only specific example sequences, but also portions and / or fragments (including deletions at the in-line and / or ends compared to the full-length protein), variants, mutants, substitutes (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the insecticidal activity characteristics of the specific example proteins. The term "variant" or "mutation" refers to a nucleotide sequence encoding the same protein or an equivalent protein encoding insecticidal activity. The term "equivalent protein" refers to a protein having the same or substantially the same biological activity against the bean pod borer pest as the protein of the claims.

[0045] The “fragment” or “truncated” DNA molecule or protein sequence described in this invention refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) involved or its artificially modified form (e.g., a sequence suitable for plant expression). The length of the aforementioned sequence may vary, but the length is sufficient to ensure that the protein (encoding) is an insect toxin.

[0046] Genes can be modified and gene variants can be easily constructed using standard techniques. For example, techniques for creating point mutations are well known in the art. U.S. Patent No. 5,605,793, for instance, describes a method for generating additional molecular diversity using DNA reassembly after random breaks. Fragments of full-length genes can be produced using commercially available restriction endonucleases, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically remove nucleotides from the ends of these genes. Genes encoding active fragments can also be obtained using various restriction endonucleases. Active fragments of these toxins can be obtained directly using proteases.

[0047] This invention can derive equivalent proteins and / or genes encoding these equivalent proteins from Bt isolates and / or DNA libraries. Various methods exist for obtaining the insecticidal proteins of this invention. For example, antibodies to the insecticidal proteins disclosed and claimed in this invention can be used to identify and isolate other proteins from a protein mixture. In particular, the antibody may be generated from the protein fraction that is most constant and most distinct from other Bt proteins. These antibodies can then be used to specifically identify the characteristically active equivalent proteins by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or Western blotting. Antibodies to the proteins, equivalent proteins, or fragments of such proteins disclosed in this invention can be readily prepared using standard procedures in the art. Genes encoding these proteins can then be obtained from microorganisms.

[0048] Due to the abundance of genetic codons, many different DNA sequences can encode the same amino acid sequence. The production of alternative DNA sequences encoding these identical or substantially identical proteins is within the skill level of those skilled in the art. These different DNA sequences are included within the scope of this invention. The term "substantially identical" means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect insecticidal activity, and also includes fragments that retain insecticidal activity.

[0049] The substitution, deletion, or addition of amino acid sequences in this invention is a conventional technique in the art. Preferably, such amino acid changes are: small property changes, i.e., conserved amino acid substitutions that do not significantly affect protein folding and / or activity; small deletions, typically about 1-30 amino acid deletions; small amino or carboxyl terminus extensions, such as an amino terminus extension of one methionine residue; and small linker peptides, such as about 20-25 residues long.

[0050] Examples of conserved substitutions are those occurring within the following groups of amino acids: basic amino acids (such as arginine, lysine, and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, and valine), aromatic amino acids (such as phenylalanine, tryptophan, and tyrosine), and small-molecule amino acids (such as glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that do not typically alter specific activity are well known in the art and have been described, for example, by N. Neurath and R.L. Hill in *Protein*, published by Academic Press in New York in 1979. The most common interchanges are Ala / Ser, Val / Ile, Asp / Glu, Thu / Ser, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly, as well as their opposite interchanges.

[0051] It will be apparent to those skilled in the art that such substitution can occur outside the region where molecular function is important, and still produce an active polypeptide. For the polypeptides of the present invention, the amino acid residues essential for their activity and therefore selected as unsubstituted can be identified according to methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (see, Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing a mutation at each positively charged residue in the molecule and detecting the insecticidal activity of the resulting mutant molecule, thereby identifying the amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analyzing its three-dimensional structure, which can be determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

[0052] In this invention, the Cry2Ab protein includes, but is not limited to, SEQ ID NO:1, and amino acid sequences having a certain degree of homology with the amino acid sequence shown in SEQ ID NO:1 are also included in this invention. These sequences typically exhibit greater than 78% similarity / identity with the sequences of this invention, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99%. Preferred polynucleotides and proteins of this invention can also be defined according to more specific ranges of similarity and / or identity. For example, sequences exhibiting 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% similarity and / or identity with the sequences exemplified in this invention.

[0053] In this invention, the transgenic plants producing the Cry2Ab protein include, but are not limited to, the MON87751 transgenic soybean event and / or plant materials containing the MON87751 transgenic soybean event (as described in CN105531376A). All of these can achieve the method and / or use of this invention, namely, controlling the bean pod borer pest by having it at least come into contact with the Cry2Ab protein. Those skilled in the art will understand that expressing the Cry2Ab protein in the aforementioned transgenic events in different plants can also achieve the method and / or use of this invention. More specifically, the Cry2Ab protein is present in at least the transgenic plants producing the Cry2Ab protein, and the bean pod borer pest comes into contact with the Cry2Ab protein by ingesting the tissues of the transgenic plant. After contact, the growth of the bean pod borer pest is inhibited and / or it leads to death, thereby achieving control of the bean pod borer-damaged plants.

[0054] The regulatory sequences described in this invention include, but are not limited to, promoters, transport peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operatively linked to the Cry2Ab protein.

[0055] The promoters mentioned are plant-expressible promoters, meaning promoters that ensure the expression of the coding sequence linked to them within plant cells. Plant-expressible promoters can be constitutive promoters. Examples of promoters that guide constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the Arabidopsis Ubi10 promoter, the maize Ubi promoter, and the promoter of the rice GOS2 gene. Alternatively, plant-expressible promoters can be tissue-specific promoters, meaning that the promoter guides the expression level of the coding sequence in some plant tissues, such as green tissues, to be higher than in other plant tissues (which can be determined by conventional RNA assays), such as the PEP carboxylase promoter. Alternatively, plant-expressible promoters can be wound-induced promoters. Wound-induced promoters, or promoters that guide wound-induced expression patterns, refer to promoters that significantly increase the expression of the coding sequence under their regulation compared to normal growth conditions when plants experience mechanical or insect-induced trauma. Examples of trauma-inducible promoters include, but are not limited to, promoters of the protease repressor genes (pin I and pin II) of potato and tomato and the maize protease repressor gene (MPI).

[0056] The transport peptide (also known as a secretory signal sequence or guide sequence) guides the transgenic product to a specific organelle or cell compartment. The transport peptide can be heterologous to the receptor protein, for example, using a sequence encoding a chloroplast transport peptide to target the chloroplast, or using the 'KDEL' reserved sequence to target the endoplasmic reticulum, or using the CTPP of the barley plant lectin gene to target the vacuoles.

[0057] The leader sequence includes, but is not limited to, small RNA virus leader sequences, such as the EMCV leader sequence (5' untranslated region of encephalomyocarditis virus); potato Y virus group leader sequences, such as the MDMV (maize dwarf mosaic virus) leader sequence; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequence of alfalfa mosaic virus capsid protein mRNA (AMVRNA4); and tobacco mosaic virus (TMV) leader sequence.

[0058] The enhancers include, but are not limited to, enhancers for cauliflower mosaic virus (CaMV), enhancers for scrophularia mosaic virus (FMV), enhancers for carnation weathering ring virus (CERV), enhancers for cassava vein mosaic virus (CsVMV), enhancers for four o'clock mosaic virus (MMV), enhancers for night-blooming jasmine yellow leaf curl virus (CmYLCV), enhancers for cotton leaf curl virus (CLCuMV), enhancers for dayflower yellow mottle virus (CoYMV), and enhancers for peanut chlorotic streak mosaic virus (PCLSV).

[0059] For monocotyledonous plant applications, the introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicotyledonous plant applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.

[0060] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to polyadenylation signal sequences derived from the Agrobacterium tumefaciens carmine synthase (NOS) gene, polyadenylation signal sequences derived from the protease inhibitor II (pin II) gene, polyadenylation signal sequences derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequences derived from the α-tubulin gene.

[0061] In this invention, "effective linkage" refers to the connection of nucleic acid sequences such that one sequence provides the function required for the linked sequences. In this invention, "effective linkage" can refer to linking a promoter to a sequence of interest, such that the transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and its expression is desired, "effective linkage" means that the promoter is linked to the sequence in a manner that allows for efficient translation of the resulting transcript. If the linkage between the promoter and the coding sequence is a transcript fusion and the desired expression of the encoded protein is desired, such a linkage is created such that the first translation start codon in the resulting transcript is the start codon of the coding sequence. Alternatively, if the linkage between the promoter and the coding sequence is a translational fusion and the desired expression of the encoded protein is desired, such a linkage is created such that the first translation start codon contained in the 5' untranslated sequence is linked to the promoter, and the linkage is such that the relationship between the resulting translation product and the open reading frame encoding the desired protein conforms to the reading frame. Nucleic acid sequences that can be "effectively linked" include, but are not limited to: sequences that provide gene expression function (i.e., gene expression elements, such as promoters, 5' untranslated regions, introns, protein-coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators); sequences that provide DNA transfer and / or integration function (i.e., T-DNA boundary sequences, site-specific recombinase recognition sites, and integrase recognition sites); sequences that provide selective function (i.e., antibiotic resistance markers and biosynthetic genes); sequences that provide scoreable marker function; sequences that assist in sequence manipulation in vitro or in vivo (i.e., multiple adapter sequences and site-specific recombination sequences); and sequences that provide replication function (i.e., bacterial origin of replication, autonomous replication sequences, and centromere sequences).

[0062] In this invention, "insecticide" or "insect-resistant" refers to being toxic to crop pests, thereby achieving "control" and / or "prevention" of crop pests. Preferably, "insecticide" or "insect-resistant" refers to killing crop pests. More specifically, the target insect is the bean pod borer.

[0063] In this invention, the Cry2Ab protein is toxic to the soybean pod borer. The plant used in this invention, particularly soybean, contains exogenous DNA in its genome, which includes a polynucleotide sequence encoding the Cry2Ab protein. The soybean pod borer comes into contact with this protein by ingesting plant tissues, and upon contact, its growth is inhibited and / or it leads to death. Inhibition refers to lethality or sublethality. Simultaneously, the plant should be morphologically normal and can be cultured using conventional methods for product consumption and / or generation. Furthermore, this plant essentially eliminates the need for chemical or biological pesticides (specifically, pesticides targeting the soybean pod borer that the Cry2Ab protein targets).

[0064] The expression level of insecticidal crystal proteins (ICPs) in plant materials can be detected by a variety of methods described in the art, such as quantifying the mRNA encoding insecticidal proteins produced in tissues by applying specific primers, or directly and specifically detecting the amount of insecticidal proteins produced.

[0065] Different tests can be used to determine the insecticidal effect of ICP in plants. The main target insect in this invention is the bean pod borer.

[0066] In this invention, the Cry2Ab protein may have the amino acid sequence shown in SEQ ID NO:1 of the sequence listing. In addition to the coding region of the Cry2Ab protein, it may also contain other elements, such as proteins encoding selective markers.

[0067] Furthermore, the expression cassette containing the polynucleotide sequence encoding the Cry2Ab protein of the present invention can also be expressed in plants along with at least one protein encoding a herbicide resistance gene, including but not limited to glufosinate resistance genes (such as bar genes, pat genes), benzyladenine resistance genes (such as pmph genes), glyphosate resistance genes (such as EPSPS genes), bromooxynil resistance genes, sulfonylurea resistance genes, resistance genes to the herbicide glyphosate, resistance genes to aminonitrile, or resistance genes to glutamine synthetase inhibitors (such as PPT), thereby obtaining transgenic plants that have both high insecticidal activity and herbicide resistance.

[0068] In this invention, exogenous DNA is introduced into plants, such as introducing the gene encoding the Cry2Ab protein, expression cassette, or recombinant vector into plant cells. Conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, microemission bombardment, direct DNA uptake into protoplasts, electroporation, or whisker-silicon-mediated DNA introduction.

[0069] This invention provides a use for an insecticidal protein, which has the following advantages:

[0070] 1. Internal control. Existing technologies mainly control the damage caused by the bean pod borer through external factors, such as agricultural control, chemical control, and biological control. However, this invention controls the bean pod borer by producing the Cry2Ab protein within the plant, which can kill the bean pod borer. That is, it controls the pest through internal factors.

[0071] 2. No pollution or residue. While existing chemical control methods have played a role in controlling the damage caused by the bean pod borer, they also cause pollution, damage, and residue to humans, livestock, and the farmland ecosystem. The method for controlling the bean pod borer using this invention can eliminate these adverse consequences.

[0072] 3. Control throughout the entire growth cycle. Existing technologies for controlling the bean pod borer are all phased, while this invention provides protection for the plant throughout its entire growth cycle. The transgenic plant (Cry2Ab protein) can avoid bean pod borer infestation from germination and growth to flowering and fruiting.

[0073] 4. Whole-plant control. Most existing methods for controlling bean pod borer are localized, such as foliar spraying; however, this invention protects the entire plant, including the roots, leaves, stems, fruits, male and female ears, anthers, and filaments of the transgenic plant (Cry2Ab protein), all of which are resistant to bean pod borer infestation.

[0074] 5. Stable efficacy. Existing technologies, whether agricultural or physical control methods, rely on environmental conditions for pest control, which are subject to numerous variables. This invention, by expressing the Cry2Ab protein within plants, effectively overcomes the instability of environmental conditions. Furthermore, the control efficacy of the transgenic plant (Cry2Ab protein) of this invention remains stable and consistent across different locations, times, and genetic backgrounds.

[0075] 6. Simple, convenient, and economical. This invention only requires planting transgenic plants that can express the Cry2Ab protein, without the need for other measures, thus saving a lot of manpower, material resources, and financial resources.

[0076] 7. Thorough effect. Existing methods for controlling bean pod borer pests are not thorough and only alleviate the symptoms; however, the transgenic plant (Cry2Ab protein) of this invention can cause mass mortality of bean pod borer pests, while the transgenic plant itself suffers only minor damage.

[0077] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0078] Figure 1 A flowchart illustrating the construction process of the recombinant cloning vector DBN01-T containing the Cry2Ab polynucleotide sequence for the purpose of the insecticidal protein of this invention.

[0079] Figure 2 A flowchart illustrating the construction process of the recombinant expression vector DBN10756 containing the Cry2Ab polynucleotide sequence for the purpose of the insecticidal protein of this invention.

[0080] Figure 3 The bean pod borer under natural insect-susceptible conditions for the use of the insecticidal protein of the present invention;

[0081] Figure 4 The image shows pod damage in a transgenic soybean plant under natural infestation by the pod borer, illustrating the use of the insecticidal protein of this invention. Detailed Implementation

[0082] The following specific embodiments further illustrate the technical solution for the use of the insecticidal protein of the present invention.

[0083] First embodiment: Acquisition and synthesis of genes

[0084] 1. Obtain the nucleotide sequence

[0085] The amino acid sequence (634 amino acids) of the Cry2Ab insecticidal protein is shown in SEQ ID NO:1 in the sequence listing; the Cry2Ab polynucleotide sequence (1905 nucleotides) encoding the amino acid sequence of the Cry2Ab insecticidal protein is shown in SEQ ID NO:2 in the sequence listing.

[0086] 2. Synthesize the above nucleotide sequence

[0087] The Cry2Ab polynucleotide sequence (as shown in SEQ ID NO:2 in the sequence listing) was synthesized by Nanjing Genscript Biotech Co., Ltd.

[0088] Second embodiment: Construction of recombinant expression vector and transformation of recombinant expression vector into Agrobacterium.

[0089] 1. Construct a recombinant cloning vector containing the Cry2Ab gene.

[0090] The synthesized Cry2Ab polynucleotide sequence was ligated into the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600). The procedure was performed according to the Promega pGEM-T vector instructions, resulting in the recombinant cloning vector DBN01-T. The construction process is as follows: Figure 1 As shown (where Amp represents the ampicillin resistance gene; f1 represents the replication origin of phage f1; LacZ is the LacZ start codon; SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase promoter; Cry2Ab is the Cry2Ab polynucleotide sequence (SEQ ID NO:2); MCS is the multiple cloning site).

[0091] The recombinant cloning vector DBN01-T was then transformed into *E. coli* T1 competent cells (Transgen, Beijing, China, CAT: CD501) using a heat shock method. White colonies were picked and cultured overnight at 37°C in LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using the alkaline method and stored at -20°C for later use.

[0092] After the extracted plasmid was identified by enzyme digestion, the positive clones were sequenced for verification. The results showed that the Cry2Ab polynucleotide sequence inserted into the recombinant cloning vector DBN01-T was the nucleotide sequence shown in SEQ ID NO:2 in the sequence listing, that is, the Cry2Ab polynucleotide sequence was correctly inserted.

[0093] 2. Construct a soybean recombinant expression vector containing the Cry2Ab gene.

[0094] The recombinant cloning vector DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from the CAMBIA organization)) were digested with restriction endonucleases, respectively. The excised Cry2Ab polynucleotide sequence fragments were inserted between the restriction endonuclease sites of the expression vector DBNBC-01. Constructing vectors using conventional digestion methods is well-known to those skilled in the art. The resulting recombinant expression vector DBN10756 was constructed, and the construction procedure is as follows: Figure 2The following are sample sequences: (Kan: kanamycin gene; RB: right border; eFMV: Scrophularia mosaic virus enhancer (SEQ ID NO:3); prBrCBP: rapeseed eukaryotic elongation factor gene 1α (Tsf1) promoter (SEQ ID NO:4); spAtCTP2: Arabidopsis chloroplast transport peptide gene (SEQ ID NO:5); EPSPS: glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase gene of Agrobacterium CP4 strain (SEQ ID NO:6); tPsE9: terminator of pea RbcS gene (SEQ ID NO:7); prAtUbi10: Arabidopsis ubiquitin gene promoter (SEQ ID NO:8); Cry2Ab: Cry2Ab polynucleotide sequence (SEQ ID NO:2); tNos: terminator of carmine synthase gene (SEQ ID NO:9); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO:8). NO:10); PAT: glufosinate acetyltransferase gene (SEQ ID NO:11); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:12); LB: left border). The recombinant expression vector DBN10756 was transformed into *E. coli* T1 competent cells using the heat shock method. White colonies were picked and cultured overnight at 37°C in LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 50 mg / L kanamycin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using the alkaline method. The extracted plasmid was identified by restriction endonuclease digestion, and positive clones were sequenced. The results showed that the nucleotide sequence in the recombinant expression vector DBN10756 was the nucleotide sequence shown in SEQ ID NO:2 in the sequence listing, namely the Cry2Ab polynucleotide sequence.

[0095] 3. Transformation of Agrobacterium with recombinant expression vector

[0096] The correctly constructed recombinant expression vector DBN10756 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 minutes, followed by a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 hours. The cultured tubes were then plated on LB agar plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single colonies appeared. Single colonies were picked, cultured, and their plasmids were extracted. The recombinant expression vector DBN10756 was digested with restriction endonucleases for verification. The results showed that the recombinant expression vector DBN10756 had a completely correct structure.

[0097] Third embodiment: Obtaining transgenic soybean plants

[0098] Following the conventional Agrobacterium infection method, cotyledonary node tissues of the aseptically cultured soybean variety Jack were co-cultured with Agrobacterium described in Example 3 of the second embodiment to transfer the T-DNA (including the Cry2Ab polynucleotide sequence and the PAT gene) of the soybean recombinant expression vector DBN10756 constructed in Example 2 of the second embodiment into the soybean chromosome, thereby obtaining soybean plants with the Cry2Ab polynucleotide sequence. Wild-type soybean plants were used as a control.

[0099] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1 g / L, B5 vitamin, sucrose 20 g / L, agar 8 g / L, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, fresh, green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3-4 mm below the cotyledon node, the cotyledons were longitudinally cut, and the terminal bud, lateral buds, and seed roots were removed. The cotyledon node was wound with the back of a scalpel, and the wounded cotyledon node tissue was contacted with an Agrobacterium suspension, wherein Agrobacterium can transfer the Cry2Ab polynucleotide sequence to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledon node tissue was preferably immersed in an Agrobacterium suspension (OD). 660=0.5-0.8), and inoculation is initiated in an infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). The cotyledonary tissue is co-cultured with Agrobacterium for a period (3 days) (step 2: co-culture step). Preferably, after the infection step, the cotyledonary tissue is cultured on a solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). Following this co-culture phase, a selective "recovery" step may be performed. In the "recovery" step, the recovery medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6) contains at least one known antibiotic (cephalosporin) that inhibits the growth of Agrobacterium, without the addition of a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary node regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary node regenerated tissue blocks are cultured on a medium containing a selector (glufosinate) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selective solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, glufosinate 6 mg / L, pH 5.6), leading to selective growth of the transformed cells. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selective medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0100] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH 5.6) and cultured for differentiation at 25°C. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants were cultured at 26°C for 16 hours each day, followed by 8 hours at 20°C.

[0101] Fourth Example: Verification of Transgenic Plants using TaqMan

[0102] Approximately 100 mg of leaves from soybean plants transfected with the Cry2Ab polynucleotide sequence were collected as a sample. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit, and the copy number of the PAT gene was determined by Taqman probe-based quantitative PCR to confirm the copy number of the Cry2Ab gene. Wild-type soybean plants were used as a control, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0103] The specific method for detecting the PAT gene copy number is as follows:

[0104] Step 11: Take 100 mg of leaves from soybean plants with Cry2Ab polynucleotide sequence and wild-type soybean plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample.

[0105] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0106] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0107] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0108] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0109] The following primers and probes are used to detect the PAT gene:

[0110] Primer 1: gagggtgttgtggctggtattg is shown in SEQ ID NO:13 in the sequence listing;

[0111] Primer 2: tctcaactgtccaatcgtaagcg is shown in SEQ ID NO:14 in the sequence listing;

[0112] Probe 1: cttacgctgggccctggaaggctag as shown in SEQ ID NO:15 in the sequence listing;

[0113] The PCR reaction system is as follows:

[0114]

[0115] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0116] The PCR reaction conditions are as follows:

[0117]

[0118]

[0119] The data was analyzed using SDS2.3 software (Applied Biosystems).

[0120] The experimental results showed that the Cry2Ab polynucleotide sequence had been integrated into the chromosome of the tested soybean plants, and the soybean plants that were transformed with the Cry2Ab polynucleotide sequence produced single-copy transgenic soybean plants.

[0121] Fifth Example: Detection of Insect Resistance in Transgenic Soybean Plants

[0122] The insect resistance of soybean plants transformed with the Cry2Ab polynucleotide sequence and soybean plants identified by Taqman as non-GMO was tested against the soybean pod borer.

[0123] The resistance of transgenic soybean plants to the soybean pod borer was assessed under natural insect-susceptible conditions in the field. Two lines (S1 and S2) transfected with the Cry2Ab polynucleotide sequence and one line identified as non-transgenic by TaqMan were selected. Plantings were conducted at a planting base in Shandong Province, with three replicates for each line and the control (NGM). A randomized block design was used, with two rows (5 meters) planted per replicate.

[0124] During the R6 stage, pod-boring pests damaging soybeans were discovered at planting bases in Shandong Province. The pests were identified as the soybean pod borer. See details below. Figure 3 .

[0125] Resistance levels were assessed based on the pod-boring rate, with specific evaluation criteria shown in Table 1.

[0126] Table 1. Evaluation Criteria for Resistance Level

[0127]

[0128] During soybean materials at stages R6-R8, the feeding of pods by soybean pod borer larvae was investigated. Five plants were surveyed per row, using uniform sampling. One normally growing plant with full pods was randomly selected per meter. One hundred pods were randomly collected, and the number of pods damaged by insects was recorded to obtain the pod-boring rate (%). The survey was repeated three times. The results are shown in Table 2 and... Figure 4 As shown.

[0129] Table 2. Experimental results showing natural susceptibility of soybean pod borer to transgenic soybean plants.

[0130]

[0131] The results in Table 1 show that, under natural occurrence conditions, soybean plants transformed with the Cry2Ab polynucleotide sequence have a good inhibitory effect on soybean pod borer compared with NGM, exhibiting a high resistance level and effectively controlling the feeding damage of soybean pod borer on soybean seeds.

[0132] This demonstrates that soybean plants transfected with the Cry2Ab polynucleotide sequence exhibit high resistance to the soybean pod borer, an activity sufficient to adversely affect the growth of the soybean pod borer and thus control it in the field.

[0133] The above experimental results also indicate that the control / prevention of soybean pod borer by soybean plants transformed with the Cry2Ab polynucleotide sequence is clearly due to the plant's ability to produce the Cry2Ab protein. Therefore, as is well known to those skilled in the art, based on the toxic effect of the Cry2Ab protein on the soybean pod borer, the plants transformed with the Cry2Ab protein in this invention can also produce at least one second insecticidal protein different from the Cry2Ab protein, such as Vip-like proteins or Cry-like proteins.

[0134] In summary, the insecticidal protein of this invention controls the bean pod borer pest by producing Cry2Ab protein within the plant, which can kill the bean pod borer. Compared with existing agricultural, chemical, and biological control methods, this invention provides protection for the entire plant throughout its growth cycle to prevent bean pod borer infestation. It is also pollution-free, residue-free, and provides stable, thorough, simple, convenient, and economical results.

[0135] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention. sequence list <110> Beijing Dabeinong Biotechnology Co., Ltd. <120> Uses of insecticidal proteins <130> DBNBC164 <160> 15 <170> SIPOSequenceListing 1.0 <210> 1 <211> 634 <212> PRT <213> Artificial Sequence - Cry2Ab Amino Acid Sequence <400> 1 Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala 1 5 10 15 Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu 20 25 30 Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser 35 40 45 Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys 50 55 60 Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn 65 70 75 80 Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg 85 90 95 Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala 100 105 110 Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe 115 120 125 Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro 130 135 140 Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn 145 150 155 160 Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro 165 170 175 Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val 180 185 190 Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr 195 200 205 Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys 210 215 220 Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His 225 230 235 240 Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr 245 250 255 Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser 260 265 270 Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser 275 280 285 Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn 290 295 300 Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr 305 310 315 320 Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu 325 330 335 Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile 340 345 350 Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro 355 360 365 Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp 370 375 380 Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu 385 390 395 400 Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser 405 410 415 Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu 420 425 430 Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile 435 440 445 Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr 450 455 460 Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu 465 470 475 480 Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr 485 490 495 Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe 500 505 510 Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln 515 520 525 Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr 530 535 540 Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val 545 550 555 560 Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr 565 570 575 Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn 580 585 590 Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile 595 600 605 Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met 610 615 620 Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr 625 630 <210> 2 <211> 1905 <212> DNA Artificial Sequence - Cry2Ab nucleotide sequence (Artificial Sequence) <400> 2 atggataact cagttttgaa cagtgggaga actacaatct gtgatgctta taacgtggca 60 gctcatgacc ctttttcttt tcagcacaag agtcttgata ctgtccaaaa ggagtggaca 120 gaatggaaaa agaataacca ctctctttac ttggacccta ttgtgggtac tgtcgcctcc 180 ttcctcctta aaaaagttgg atcactcgtt ggaaagagaa ttttgagtga gttgagaaat 240 cttattttcc cttcaggatc taccaatttg atgcaagaca ttctcaggga gactgaaaaa 300 tttctcaacc agaggcttaa cactgacacc ctcgccagag tgaatgctga gcttactggc 360 ttgcaagcta atgttgagga gtttaacagg caagtcgata atttcctcaa tccaaacaga 420 aacgctgtgc ccctcagcat aacttcatca gtgaacacta tgcaacaact gtttttgaat 480 agattgcccc agtttcagat gcaaggttac caactcctct tgcttccact cttcgcccag 540 gctgctaacc tgcatctcag ttttatcagg gatgtgattt tgaatgctga tgagtggggg 600 atttcagctg ccacccttag gacctaccgc gattatctca aaaactacac tagggactac 660 tctaattact gcattaacac ttatcagagc gctttcaagg gacttaatac cagactgcac 720 gacatgctcg agtttaggac ttacatgttt ctgaatgttt tcgagtacgt cagtatttgg 780 agtcttttca agtatcagtc actccttgtt agcagcggtg ctaacttgta cgcttctggg 840 tcagggcccc agcagactca gagctttaca agccaggatt ggcccttcct gtattctctg 900 tttcaagtga atagtaatta cgtgttgaac ggtttctccg gggctaggct gtcaaatacc 960 tttcccaaca ttgtgggact tcctggatct actaccactc acgctctcct ggcagctagg 1020 gttaattatt ctggcggcat taggcgga gatattgggg cttctccatt caatcagaat 1080 ttcaactgtt ctactttct tcctccactc cttactccct tcgttagatc ctggttggat 1140 agtgggtctg atagagaggg cgtcgccacc gttacaaact ggcaaaccga atcctttgaa 1200 acaacactcg gacttaggtc tggcgctttc acagctagag gaaattccaa ttactttcct 1260 gattatttta ttaggaacat aagtggcgtt ccactcgttg ttaggaatga ggacctgagg 1320 agacctcttc attacaacga aataagaaac atcgcatctc catcaggcac ccctggcgga 1380 gctagggctt atatggttc cgtgcataat agaaagaaca acattcatgc tgtccacgag 1440 aatggatcaa tgattcacct ggctcccaac gactataccg ggttactat ttcacctatt 1500 cacgccacac aagtcaacaa tcagacaagg accttcattt ccgagaaatt cggaaatcag 1560 ggggacagtc tgagattcga gcagaataac actaccgcaa gatatactct tagaggaaat 1620 ggaaattctt acaacttgta cttgagggtg agctcaatcg gcaattcaac aatcagagtt 1680 actattaacg gcagggtgta tactgcaaca aacgtcaaca ctactacaaa caatgatggc 1740 gttaatgata acggagcaag gttctcagat attaacattg ggaatgttgt cgcaagttcc 1800 aattcagatg tgccccttga tattaacgtg acacttaatt caggcaccca atttgacttg 1860 atgaacataa tgctggtgcc cacaaatatc tcaccactct actaa 1905 <210> 3 <211> 542 <212> DNA <213> Figwort mosaic virus (Figwort mosaic virus) <400> 3 aattctcagt ccaaagcctc aacaaggtca gggtacagag tctccaaacc attagccaaa 60 agctacagga gatcaatgaa gaatcttcaa tcaaagtaaa ctactgttcc agcacatgca 120 tcatggtcag taagtttcag aaaaagacat ccaccgaaga cttaaagtta gtgggcatct 180 ttgaaagtaa tcttgtcaac atcgagcagc tggcttgtgg ggaccagaca aaaaaggaat 240 ggtgcagaat tgttaggcgc acctaccaaa agcatctttg cctttattgc aaagataaag 300 cagattcctc tagtacaagt ggggaacaaa ataacgtgga aaagagctgt cctgacagcc 360 cactcactaa tgcgtatgac gaacgcagtg acgaccacaa aagaattagc ttgagctcag 420 gatttagcag cattccagat tgggttcaat caacaaggta cgagccatat cactttattc 480 aaattggtat cgccaaaacc aagaaggaac tcccatcctc aaaggtttgt aaggaagaat 540 tc 542 <210> 4 <211> 1534 <212> DNA <213> Eukaryotic elongation factor 1α gene of Brassica rapa (Tsf1 promoter, Brassica rapa) <400> 4 gattatgaca ttgctcgtgg aatgggacag ttatggtatt tttttgtaat aaattgtttc 60 cattgtcatg agattttgag gttaatctat gagacattga atcacttagc attagggatt 120 aagtagtcac aaatcgcatt caagaagctg aagaacacgt tatggtctaa tggttgtgtc 180 tctttattag aaaatgttgg tcagtagcta tatgcactgt ttctgtaaaa ccatgttggt 240 gttgtgttta tttcaagaca catgttgagt ccgttgattc agagcttttg tcttcgaaca 300 caatctagag agcaaatttg ggttcaattt ggatatcaat atgggttcga ttcagataga 360 acaataccct ttgatgtcgg gtttcgattt ggttgagatt catttttatc gggtttggtt 420 cgattttcga attcggttta ttcgccccct catagcatct acattctgca gattaatgta 480 caagttatgg aaaaaaaaat gtggttttcg aattcggttt agtagctaaa cgttgcttgc 540 agtgtagtta tgggaattat gaaacacgac cgaaggtatc aattagaaga acgggtcaac 600 gggtaagtat tgagaaatta ccggagggta aaaataaaca gtattctttt tttttcttaa 660 cgaccgacca aggttaaaaa aagaaaggag gacgagatac aggggcatga ctgtaattgt 720 acataagatc tgatctttaa accctaggtt tccttcgcat cagcaactat aaataattct 780 gagtgccact cttcttcatt cctagatctt tcgccttatc gctttagctg aggtaagcct 840 ttctatacgc atagacgctc tcttttctct tctctcgatc ttcgttgaaa cggtcctcga 900 tacgcatagg atcggttaga atcgttaatc tatcgtctta gatcttcttg attgttgaat 960 tgagcttcta ggatgtattg tatcatgtga tggatagttg attggatctc tttgagtgaa 1020 ctagctagct ttcgatgcgt gtgatttcag tataacagga tccgatgaat tatagctcgc 1080 ttacaattaa tctctgcaga tttattgttt aatcttggat ttgatgctcg ttgttgatag 1140 aggatcgttt atagaactta ttgattctgg aattgagctt gtgtgatgta ttgtatcatg 1200 tgatcgatag ctgatggatc tatttgagtg aactagcgta cgatcttaag atgagtgtgt 1260 attgtgaact gatgattcga gatcagcaaa acaagatctg atgatatctt cgtcttgtat 1320 gcatcttgaa tttcatgatt ttttattaat tatagctcgc ttagctcaaa ggatagagca 1380 ccacaaaatt ttattgtggt agaaatcggt tcgattccga tagcagctta ctgtgatgaa 1440 tgatttgag atttggtatt tgatatatgt ctactgtgtt gaatgatcgt ttatgcattg 1500 tttaatcgct gcagatttgc attgacaagt agcc 1534 <210> 5 <211> 228 <212> DNA <213> Arabidopsis thaliana (Arabidopsis thaliana) <400> 5 atggcgcaag ttagcagaat ctgcaatggt gtgcagaacc catctcttat ctccaatctc 60 tcgaaatcca gtcaacgcaa atctccctta tcggtttctc tgaagacgca gcagcatcca 120 cgagcttatc cgatttcgtc gtcgtgggga ttgaagaaga gtgggatgac gttaattggc 180 tctgagcttc gtcctcttaa ggtcatgtct tctgtttcca cggcgtgc 228 <210> 6 <211> 1368 <212> DNA <213> EPSPS(Agrobacterium aurantiacum) <400> 6 atgcttcacg gtgcaagcag ccgtccagca actgctcgta agtcctctgg tctttctgga 60 accgtccgta ttccaggtga caagtctatc tcccacaggt ccttcatgtt tggaggtctc 120 gctagcggtg aaactcgtat caccggtctt ttggaaggtg aagatgttat caacactggt 180 aaggctatgc aagctatggg tgccagaatc cgtaaggaag gtgatacttg gatcattgat 240 ggtgttggta acggtggact ccttgctcct gaggctcctc tcgatttcgg taacgctgca 300 actggttgcc gtttgactat gggtcttgtt ggtgtttacg atttcgatag cactttcatt 360 ggtgacgctt ctctcactaa gcgtccaatg ggtcgtgtgt tgaacccact tcgcgaaatg 420 ggtgtgcagg tgaagtctga agacggtgat cgtcttccag ttaccttgcg tggaccaaag 480 actccaacgc caatcaccta cagggtacct atggcttccg ctcaagtgaa gtccgctgtt 540 ctgcttgctg gtctcaacac cccaggtatc accactgtta tcgagccaat catgactcgt 600 gaccacactg aaaagatgct tcaaggtttt ggtgctaacc ttaccgttga gactgatgct 660 gacggtgtgc gtaccatccg tcttgaaggt cgtggtaagc tcaccggtca agtgattgat 720 gttccaggtg atccatcctc tactgctttc ccattggttg ctgccttgct tgttccaggt 780 tccgacgtca ccatccttaa cgttttgatg aacccaaccc gtactggtct catcttgact 840 ctgcaggaaa tgggtgccga catcgaagtg atcaacccac gtcttgctgg tggagaagac 900 gtggctgact tgcgtgttcg ttcttctact ttgaagggtg ttactgttcc agaagaccgt 960 gctccttcta tgatcgacga gtatccaatt ctcgctgttg cagctgcatt cgctgaaggt 1020 gctaccgtta tgaacggttt ggaagaactc cgtgttaagg aaagcgaccg tctttctgct 1080 gtcgcaaacg gtctcaagct caacggtgtt gattgcgatg aaggtgagac ttctctcgtc 1140 gtgcgtggtc gtcctgacgg taagggtctc ggtaacgctt ctggagcagc tgtcgctacc 1200 cacctcgatc accgtatcgc tatgagcttc ctcgttatgg gtctcgtttc tgaaaaccct 1260 gttactgttg atgatgctac tatgatcgct actagcttcc cagagttcat ggatttgatg 1320 gctggtcttg gagctaagat cgaactctcc gacactaagg ctgcttga 1368 <210> 7 <211> 643 <212> DNA <213> Terminator (Pisum sativum) <400> 7 agctttcgtt cgtatcatcg gtttcgacaa cgttcgtcaa gttcaatgca tcagtttcat 60 tgcgcacaca ccagaatcct actgagtttg agtattatgg cattgggaaa actgtttttc 120 ttgtaccatt tgttgtgctt gtaatttact gtgtttttta ttcggttttc gctatcgaac 180 tgtgaaatgg aaatggatgg agaagagtta atgaatgata tggtcctttt gttcattctc 240 aaattaatat tatttgtttt ttctcttatt tgttgtgtgt tgaatttgaa attataagag 300 atatgcaaac attttgtttt gagtaaaaat gtgtcaaatc gtggcctcta atgaccgaag 360 ttaatatgag gagtaaaaca cttgtagttg taccattatg cttattcact aggcaacaaa 420 tatattttca gacctagaaa agctgcaaat gttactgaat acaagtatgt cctcttgtgt 480 tttagacatt tatgaacttt cctttatgta attttccaga atccttgtca gattctaatc 540 attgctttat aattatagtt atactcatgg atttgtagtt gagtatgaaa atatttttta 600 atgcatttta tgacttgcca attgattgac aacatgcatc aat 643 <210> 8 <211> 1322 <212> DNA <213> Ubiquitin (Ubiquitin gene promoter, Agrobacterium tumefaciens) <400> 8 gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60 tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120 aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180 ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240 aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300 tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360 aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420 ttacttttcc aagaaattca ctgattttat aagccccactt gcattagata aatggcaaaa 480 aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540 aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600 aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660 720 gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780 caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840 cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900 ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960 gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020 aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080 tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140 tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200 caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260 gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320 ag 1322 <210> 9 <211> 253 <212> DNA <213> Terminator of the carmine synthase gene (Agrobacterium tumefaciens) <400> 9 gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60 atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120 atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180 gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240 atgttactag atc 253 <210> 10 <211> 530 <212> DNA <213> Promoter (Cauliflower mosaic virus) <400> 10 ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60 agttcataca gagtctctta cgactcaatg acagaagaa atcttcgtc aacatggtgg 120 agcacgacac gcttgtctac tccaaaata tcaagatac agtctcagaa gaccaaaggg 180 cattgagac tttcacaa agggtatat ccggaaacct cctcggattc cattgcccag 240 ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300 attgcgataa aggaaggcc atcgttgaag atgccctgc cgacagtggt cccaagatg 360 gacccccacc cacgaggagc atcgtggaaa aagagacgt tccaccacg tctcaagc 420 aagtggattg atgtgatatc tccactgacg tagggatga cgcacaatcc cactacctt 480 cgcaagaccc ttcctctata taggaagtt cattcattt ggagaggaca 530 <210> 11 <211> 552 <212> DNA <213> Streptomyces viridochromogenes <400> 11 atgtctccgg agaggagacc agttgagatt agccagcta cagcagctga tatggccgcg 60 gtttgtgata tcgttaacca ttacattgag acgtctacag tgaacttag gatagagcca 120 caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180 gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240 aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300 ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360 tctgtggttg ctgtatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420 ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480 gttggtttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540 acccagatct ga 552 <210> 12 <211> 195 <212> DNA <213> Cauliflower mosaic virus <400> 12 ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60 ccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120 cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180 accaaaatcc agtgg 195 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence - Primer 1 <400> 13 gagggtgttg tggctggtat tg 22 <210> 14 <211> twenty three <212> DNA <213> Artificial Sequence - Primer 2 <400> 14 tctcaactgt ccaatcgtaa gcg 23 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence - Probe 1 <400> 15 cttacgctgg gccctggaag gctag 25

Claims

1. A method of controlling the pod borer pest, Maruca testulalis (Guenée) (Lepidoptera: Pyralidae), characterized by, This includes bringing the bean pod borer pest into contact with at least the Cry2Ab protein, the amino acid sequence of which is shown in SEQ ID NO:1, and the contact being ingestion.

2. The method for controlling the bean pod borer pest according to claim 1, characterized in that, The Cry2Ab protein is present in at least the host cells that produce the Cry2Ab protein, and the bean pod borer pest comes into contact with the Cry2Ab protein at least by ingesting the host cells.

3. The method for controlling the bean pod borer pest according to claim 2, characterized in that, The Cry2Ab protein is present in at least the bacteria or transgenic plants that produce the Cry2Ab protein. The bean pod borer pest comes into contact with the Cry2Ab protein by ingesting the tissues of the bacteria or the transgenic plants. After contact, the growth of the bean pod borer pest is inhibited and / or it leads to death, thereby achieving control of the bean pod borer-damaged plants.

4. The method for controlling the bean pod borer pest according to claim 3, characterized in that, The genetically modified plants are soybeans, lentils, mung beans, cowpeas, common beans, peas, locust trees, or black locust trees.

5. The method for controlling the bean pod borer according to any one of claims 3 or 4, characterized in that, The tissues of the genetically modified plant are leaves, fruits, and flowers.

6. The method for controlling the bean pod borer according to any one of claims 1-4, characterized in that, The nucleotide sequence of the Cry2Ab protein is shown in SEQ ID NO:

2.

7. The method for controlling the bean pod borer according to any one of claims 3 or 4, characterized in that, The transgenic plant also includes at least one second polynucleotide different from the polynucleotide encoding the Cry2Ab protein.

8. The method for controlling the bean pod borer pest according to claim 7, characterized in that, The second type of polynucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

9. The method for controlling the bean pod borer pest according to claim 7, characterized in that, The second type of polynucleotide is a dsRNA that inhibits important genes in the target insect pest.

10. The method for controlling the bean pod borer pest according to claim 5, characterized in that, The transgenic plant also includes at least one second polynucleotide different from the polynucleotide encoding the Cry2Ab protein.

11. The method for controlling the bean pod borer according to claim 10, characterized in that, The second type of polynucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

12. The method for controlling the bean pod borer according to claim 10, characterized in that, The second type of polynucleotide is a dsRNA that inhibits important genes in the target insect pest.

13. The method for controlling the bean pod borer pest according to claim 3 or 4, characterized in that, The transgenic plant also includes at least one second polynucleotide different from the polynucleotide encoding the Cry2Ab protein, the nucleotide sequence of which is shown in SEQ ID NO:

2.

14. The method for controlling the bean pod borer according to claim 13, characterized in that, The second type of polynucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

15. The method for controlling the bean pod borer according to claim 13, characterized in that, The second type of polynucleotide is a dsRNA that inhibits important genes in the target insect pest.

16. The use of a Cry2Ab protein in controlling the bean pod borer pest, characterized in that, The amino acid sequence of the Cry2Ab protein is shown in SEQ ID NO:1.

Images