Engineered bacteria capable of stably expressing antigen-polysaccharide-protein biocoupled biofactors and increasing product yield and their applications

By integrating glycosyltransferase and substrate protein genes into the E. coli genome and knocking out the yfdGHI gene cluster, the genetic instability of plasmid expression systems was solved, the yield and purification efficiency of polysaccharide-protein conjugates were improved, and the development of polysaccharide conjugate vaccines was promoted.

CN117106681BActive Publication Date: 2026-07-17ACADEMY OF MILITARY MEDICAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2023-01-06
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

In the prior art, plasmid expression systems have genetic instability and metabolic burden when producing polysaccharide-protein conjugates, which affect product yield and purification efficiency, especially in the absence of antibiotics, where plasmids are easily lost.

Method used

Glycosyltransferase and substrate protein genes were integrated into the E. coli genome, and the yfdGHI gene cluster was knocked out. The engineered strain was constructed using the CRISPR-Cas9 method to reduce plasmid burden and improve genetic stability.

Benefits of technology

It improved the yield and purification efficiency of antigen polysaccharide-protein bioconjugates, reduced production costs, and enhanced the technological advancement of polysaccharide conjugate vaccine preparation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117106681B_ABST
    Figure CN117106681B_ABST
Patent Text Reader

Abstract

This application discloses an engineered bacterium capable of stably expressing antigen-polysaccharide-protein bioconjugation-related biological elements and increasing product yield. This engineered bacterium uses *Escherichia coli* as the starting strain, knocking out the yfdGHI gene cluster on the *E. coli* genome and integrating a glycosyltransferase gene and a substrate protein gene. By integrating the glycosyltransferase gene and substrate protein gene used in PGCT technology into the chromosome, not only is the metabolic burden of the plasmid on the host reduced, but the genetic stability of the producing strain is also improved. Simultaneously, knocking out the yfdGHI gene cluster in the target strain effectively improves the biosynthetic yield of the final product—the antigen-polysaccharide-protein bioconjugation product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, specifically to engineered bacteria capable of stably expressing antigen polysaccharide-protein biocoupled biological elements and increasing product yield, and their applications. Background Technology

[0002] In recent years, with the continuous analysis of bacterial protein glycosylation systems, a biological method for preparing polysaccharide conjugate vaccines, known as protein-glycan coupling technologies (PGCT), has gradually replaced chemical cross-linking methods as a new and popular research area. The production of biological conjugate vaccines requires four key components: glycosyl engineered strains, glycosyltransferases, glycan expression gene clusters, and substrate proteins. Based on the different glycosyltransferases, biological production of polysaccharide conjugate vaccines is mainly divided into two categories: N-glycosylated conjugate vaccines based on the N-oligosaccharide transferase PglB from Campylobacter jejuni, and O-glycosylated conjugate vaccines based on the O-oligosaccharide transferase PglL from Neisseria meningitidis. This method involves the biocatalytic coupling of recombinantly expressed polysaccharides with proteins using glycosyltransferases in bacterial host cells. Compared to chemical cross-linking methods, the main advantage of PGCT is that in vivo conjugation can complete the production of glycoproteins in a single step. Only further purification is needed to obtain a relatively homogeneous final product, eliminating the cumbersome process of separately purifying the carrier protein and polysaccharide before further purification and cross-linking to obtain the final product. Therefore, its production cost for conjugate vaccines is lower, its scalability is stronger, and it requires fewer downstream purification steps, eliminating the need for repeated purification and quality control, making quality control more convenient. PglB is mainly used to develop biological conjugate vaccines containing HexNAc sugars at the reducing end, such as those for Shigella, Staphylococcus aureus, and extra-enteric pathogenic Escherichia coli (ExPEC). PglL, on the other hand, has more relaxed substrate specificity, capable of transferring almost any sugar from the undecenyl pyrophosphate carrier to the protein, thus overcoming the limitations of the Campylobacter jejuni N-linked glycosylation system.

[0003] On the other hand, with the rise of CRISPR gene editing technology, gene editing has become faster and more convenient. The rapid development and rise of synthetic biology technology has provided new ideas for the construction of glycosyl engineering chassis cells. The development of microbial chassis is a key topic in the field of synthetic biology, providing a foundation for building cell factories with improved biomanufacturing efficiency. Escherichia coli, as a model strain for studying microbial genetics, physiology, and metabolism, has become one of the important chassis cells due to its diverse genetic manipulation tools and clear genetic background. However, because PGCT requires many key components, the production of polysaccharide-protein conjugates usually requires two to three expression plasmids. Although plasmid-based expression systems have the advantage of simple construction, engineered strains containing plasmids have significant deficiencies in genetic stability, especially in actual production environments where antibiotics cannot be used, where these plasmids are often lost from the cells. In addition, multiple copies of plasmids can significantly alter the normal metabolism of host cells, further increasing plasmid instability. This metabolic burden affects plasmid replication and the translation of plasmid-encoded genes. Summary of the Invention

[0004] In PGCT technology research, a series of experiments revealed that the deletion of a gene cluster, yfdGHI, can effectively improve the biosynthetic yield of the final product—the antigen polysaccharide-protein bioconjugate. This gene cluster, yfdGHI (yfdG, yfdH, yfdI), belongs to the O antigen side-chain modification gene cluster. It consists of yfdG glucose translocase, yfdH protein, and yfdI glucosyltransferase, with the nucleotide sequence shown in SEQ ID NO. 33. Before translocation via yfdG, yfdH transfers glucose from UDP glucose to undecene pyrophosphate. Deletion of this gene cluster may release more undecene pyrophosphate, which can be used for the synthesis of the target glycan chain, thus promoting the yield of the final product, the antigen polysaccharide-protein bioconjugate.

[0005] Therefore, the present invention provides an engineered bacterium capable of stably expressing antigen polysaccharide-protein biocoupled bio-elements and increasing product yield. The engineered bacterium is based on Escherichia coli, which knocks out the yfdGHI gene cluster on the E. coli genome and integrates glycosyltransferase gene and substrate protein gene; the nucleotide sequence of the yfdGHI gene cluster is shown in SEQ ID NO.33.

[0006] Furthermore, the glycosyltransferase is PglL, whose nucleotide sequence is shown in SEQ ID NO.26; and / or, the substrate protein is a SpyCatcher protein modified with glycosylation sites, whose nucleotide sequence is shown in SEQ ID NO.27.

[0007] The engineered bacteria also knocked out the waaL gene and / or wbbH-L gene cluster on the Escherichia coli genome.

[0008] The starting strain was Escherichia coli W3110.

[0009] The wbbH-L gene cluster was replaced with glycosyltransferase genes and substrate protein genes.

[0010] The glycosyltransferase gene and substrate protein gene were integrated into the E. coli genome using the CRISPR-Cas9 method.

[0011] Methods for integrating glycosyltransferase genes and substrate protein genes into the E. coli genome include:

[0012] (1) Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-wbbH-L-N20 ​​and ptf-R, and a new plasmid pTargetF-wbbH-L was constructed.

[0013] (2) Constructing the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B

[0014] The nucleotide sequence of A is shown in SEQ ID NO. 30; the nucleotide sequence of B is shown in SEQ ID NO. 31; LacI is a transcriptional regulatory element, and its nucleotide sequence is shown in SEQ ID NO. 25; PglL is a glycosyltransferase, and its nucleotide sequence is shown in SEQ ID NO. 26; SpyCatcher4573 is a recombinant protein fused with a glycosylation recognition site, and its nucleotide sequence is shown in SEQ ID NO. 27; rrnB is a transcription terminator sequence, and its nucleotide sequence is shown in SEQ ID NO. 28.

[0015] (3) Take 400 ng of homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B and plasmid pTargetF-wbbH-L and electroporate them into competent E. coli cells containing pCas.

[0016] Furthermore, the method for preparing the engineered bacteria includes the following steps:

[0017] (1) Starting with Escherichia coli W3110, the waaL gene was knocked out to obtain W3110△waaL strain.

[0018] (2) Electroporate the pCas plasmid into strain W3110△waaL;

[0019] (3) Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-wbbH-L-N20 ​​and ptf-R. After gel extraction, the obtained linear DNA fragments were ligated into circular fragments. The ligation products were transformed into DH5α competent cells for culture, positive clones were screened, and pTargetF-wbbH-L plasmid was extracted.

[0020] (4) Using the genome of Escherichia coli strain W3110 as a template, the upstream and downstream homologous arms A and B were amplified using primers wbbH-L-lacI-AF and wbbH-L-lacI-AR, wbbH-L-SC-BF and wbbH-L-SC-BR, respectively. The plasmid pET28a-SC (obtained by ligation of the sequence XhoI-pglL-Spycatcher4573-rrnB-BglII from the plasmid backbone pET28a and the whole genome through the restriction sites XhoI and BglII) was used as a template. The LacI-pglL-Spycatcher4573-rrnB sequence element was amplified using primers lacI-F and SC-R; the homologous arms A, LacI-pglL-Spycatcher4573-rrnB, and homologous arm B of the DNA fragment were sequentially ligated using a ligation kit, and then the ligation product was used as a template to amplify the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B using primers wbbH-L-lacI-AF / wbbH-L-SC-BR.

[0021] (5) Take the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B and pTargetF-wbbH-L plasmid and electroporate them into W3110△waaL / pCas competent cells at the same time.

[0022] (6) Knock out the yfdGHI gene cluster from the engineered strain prepared in step (5).

[0023] The present invention also provides the application of the aforementioned engineered bacteria in the preparation of antigen polysaccharide-protein bioconjugate products.

[0024] The present invention also provides the application of the aforementioned engineered bacteria in the preparation of polysaccharide conjugate vaccines.

[0025] Beneficial effects of the present invention

[0026] This invention integrates the glycosyltransferase gene and substrate protein gene used in PGCT technology into the chromosome, which not only helps reduce the metabolic burden of plasmids on the host but also helps improve the genetic stability of the production strain. In particular, the substrate protein integrated into the genome is a recombinant SpyCather protein with a glycosylation recognition site. This protein can further spontaneously couple with protein nanoparticle carriers with SpyTag linkers, thereby forming a nanopolysaccharide conjugate vaccine with superior immunogenicity, greatly advancing the technology for preparing polysaccharide conjugate vaccines. Simultaneously, this invention effectively improves the biosynthetic yield of the final product—the antigen polysaccharide-protein bioconjugate—by knocking out the yfdGHI gene cluster in the target strain. Attached Figure Description

[0027] Figure 1 The expression of substrate protein SpyCatcher4573 was detected in the chassis strain WdlO-tPS, where "+" represents strains induced by IPTG, "-" represents strains not induced by IPTG, and "M" represents MARKER.

[0028] Figure 2 The retention rates of encoding genes of strains W3110△waaL△wbbH-L / SC4573 and WdlO-tPS were detected.

[0029] Figure 3 This study compares the expression levels of KPO2-SC glycoprotein in the chassis strain WdlO-tPS before and after the deletion of the yfdGHI gene cluster. "+" indicates strains without the yfdGHI gene cluster deletion, "-" indicates strains with the yfdGHI gene cluster deletion, and "M" stands for MARKER.

[0030] Figure 4 To compare the expression levels of KPO2-SC glycoprotein in chassis strains WdlO-tPS001 and WdlO-tPS using grayscale analysis.

[0031] Figure 5 The assay includes SDS-PAGE detection of AP205-OPS, His antibody detection, and anti-KPO2-OPS serum antibody detection; where "+" indicates the presence of ST-AP205 protein or KPO2-SC protein, and "-" indicates the absence of ST-AP205 protein or KPO2-SC protein.

[0032] Figure 6 This is a particle size distribution diagram of the nanopolysaccharide conjugate vaccine AP205-OPS.

[0033] Figure 7 Evaluation of the protective effect of the nanopolysaccharide conjugate vaccine AP205-OPS on animals after immunization. Detailed Implementation

[0034] The present invention will be further described and illustrated below with reference to embodiments. However, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the present invention and the embodiments, all other inventions and embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0036] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Example 1: Construction of an engineered strain, WdlO-tPS, integrating glycosyltransferase and substrate protein into its genome sequence.

[0037] (1) Preparation of the W3110△waaL engineered strain: WaaL is an O-antigen ligase responsible for transferring sugar chains to the lipid A-core in *E. coli*. Deletion of WaaL eliminates competition with the subsequently knocked-in glycosyltransferase PglL, allowing sugars and proteins to couple into glycoproteins under the action of PglL. *E. coli* W3110 was used as the starting strain (*E. coli* W3110 is a commonly used experimental strain and can be obtained commercially). Deleting the waaL gene in the W3110 strain is the most common strategy in PGCT technology, and can be obtained using point mutation, Red recombination, CRISPR-Cas9, and other biotechnologies. In this example, the W3110△waaL engineered strain was obtained using CRISPR-Cas9 technology.

[0038] (2) Preparation of the W3110△waaL△wbbH-L engineered strain: Deletion of the wbbH-L gene cluster involved in the synthesis of OPS in E. coli can increase the yield of heterologously expressed glycans. While heterologously expressing the target glycan, host cells often express many other glycan structures. These non-target glycan synthesis pathways can interfere with the synthesis and assembly of the target polysaccharide antigen by competing for lipid carriers and activating monosaccharide substrates. Therefore, removing the non-essential glycan synthesis gene cluster from the chassis cells will facilitate the correct and efficient expression of the target polysaccharide antigen. The wbbH-L gene cluster was knocked out in the W3110△waaL engineered strain using biotechnology such as CRISPR-Cas9.

[0039] (3) Construct the WdlO-tPS strain using the CRISPR-Cas9 method, including the following steps:

[0040] (a) Creating electrocompetent states.

[0041] The target strain W3110△waaL was cultured at 37℃ and 200 rpm until the OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and then resuspended in 10% glycerol to obtain the prepared W3110△waaL competent cells, which were then cryopreserved at -80℃ for later use. The pCas plasmid (commercially available) was electrotransduced into the competent cells (1.8 kV, 4.5 mS). After thawing for 1 hour, the cells were plated on Kan-resistant LB agar plates and incubated overnight at 30℃. The next day, single colonies were picked. After verifying successful plasmid transformation using the verification primers pCas-U (nucleotide sequence shown in SEQ ID NO.3) and pCas-D (nucleotide sequence shown in SEQ ID NO.4), single colonies were picked and inoculated into 5 mL of liquid LB medium, and incubated overnight at 30℃ and 200 rpm. The following day, the cells were seeded at a volume ratio of 1:100 into 50 mL of liquid LB medium and cultured at 30°C and 200 rpm until the OD600 reached approximately 0.5. Then, arabinose was added to a final concentration of 10 mmol / L, and the cells were cultured further until the OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and finally resuspended in 10% glycerol. This yielded the prepared W3110ΔwaaL / pCas competent cells, which should be cryopreserved at -80°C for later use.

[0042] (b) Design sgRNA sequences.

[0043] The gene cluster wbbH-L to be deleted (nucleotide sequence as shown in SEQ ID NO.35) was entered into the N20 design website http: / / crispor.tefor.net / , and an N20 sequence with a high score (TTCCGTCAATAAACATGACA) was selected to design primers W3110-wbbH-L-N20 ​​(nucleotide sequence as shown in SEQ ID NO.36) and ptf-R (nucleotide sequence as shown in SEQ ID NO.5).

[0044] (c) Construct the pTargetF-wbbH-L plasmid.

[0045] Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-wbbH-L-N20 ​​and ptf-R. After gel extraction, the obtained linear DNA fragments were ligated into circular fragments. The ligation product was transformed into DH5α competent cells, incubated at 37°C and 220 rpm for 1 hour, and then plated on spectinomycin (Spc) resistant LB plates and incubated overnight at 37°C. The next day, single clones were picked and amplified using primers gRNA-U (nucleotide sequence as shown in SEQ ID NO.1) / N20-D (nucleotide sequence as shown in SEQ ID NO.2), followed by sequencing to verify successful plasmid construction. After verification, the bacterial strain was preserved, and the pTargetF-wbbH-L plasmid was extracted using a plasmid miniprep kit (Tiangen) and stored at -20°C for later use.

[0046] (d). Construct the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B.

[0047] Using the genome of *E. coli* strain W3110 as a template, primers wbbH-L-lacI-AF (nucleotide sequence as shown in SEQ ID NO. 15), wbbH-L-lacI-AR (nucleotide sequence as shown in SEQ ID NO. 16), wbbH-L-SC-BF (nucleotide sequence as shown in SEQ ID NO. 19), and wbbH-L-SC-BR (nucleotide sequence as shown in SEQ ID NO. 20) were used to amplify upstream and downstream homologous arms A (nucleotide sequence as shown in SEQ ID NO. 30) and B (nucleotide sequence as shown in SEQ ID NO. 31), respectively. Using plasmid pET28a-SC (plasmid pET28a-SC is obtained by ligating the plasmid backbone pET28a and the complete genome sequence XhoI-pglL-Spycatcher4573-rrnB-BglII through restriction sites XhoI and BglII, which are preserved in our laboratory) as a template, primer lacI-F (nucleotide sequence as shown in SEQ ID NO. 15) was used. The LacI-pglL-Spycatcher4573-rrnB sequence element was amplified by SC-R (nucleotide sequence shown in SEQ ID NO.17) and SC-R (nucleotide sequence shown in SEQ ID NO.18), wherein LacI is a transcriptional regulatory element (nucleotide sequence shown in SEQ ID NO.25), PglL is a glycosyltransferase (nucleotide sequence shown in SEQ ID NO.26), SpyCatcher4573 is a recombinant protein fused with a glycosylation recognition site (nucleotide sequence shown in SEQ ID NO.27), and rrnB is a transcription terminator sequence (nucleotide sequence shown in SEQ ID NO.28). After gel extraction and recovery, homologous arms A, LacI-pglL-Spycatcher4573-rrnB, and homologous arm B of the DNA fragment were sequentially ligated using a ligation kit. Then, using the ligation product as a template, homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B was amplified using primers wbbH-L-lacI-AF / wbbH-L-SC-BR. After gel extraction and recovery, the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B was stored at -20°C for later use.

[0048] (e). Deletion of the wbbH-L gene cluster and knock-in of LacI-pglL-Spycatcher4573-rrnB.

[0049] 400 ng of homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B and 100 ng of pTargetF-wbbH-L plasmid were simultaneously electroporated (1.8 kV, 4.0 ms) into W3110△waaL / pCas competent cells. The cells were incubated at 30°C and 200 rpm for 1 h, then plated on Kan / Spc antibiotic plates and cultured overnight at 30°C. The next day, single clones were picked and verified by PCR using primers wbbH-L-checkF1 (nucleotide sequence shown in SEQ ID NO. 6) and wbbH-L-checkR1 (nucleotide sequence shown in SEQ ID NO. 7). Sequencing confirmed the deletion of the gene cluster and the knock-in of LacI-pglL-Spycatcher4573-rrnB. This strain, carrying pCas and pTargetF plasmids, was named WdlO-tPS / pCas+pTargetF-wbbH-L strain.

[0050] (f) Remove pTargetF-wbbH-L plasmid and pCas plasmid.

[0051] For subsequent expression validation, the pTargetF-wbbH-L and pCas plasmids needed to be removed. The WdlO-tPS / pCas+pTargetF-wbbH-L strain was cultured at 30°C and 220 rpm on a shaker until the OD600 reached approximately 0.5. Then, 5 μL of IPTG (1 mol / L) was added for induction, removing the pTargetF-wbbH-L plasmid. The next day, the plasmid was streaked onto Kansas antibiotic plates and incubated overnight at 30°C. After sorting out single clones, they were spotted onto both Kansas antibiotic plates and Kan / Spc antibiotic plates. The strain that lost the pTargetF plasmid grew on Kansas antibiotic plates but not on Kan / Spc antibiotic plates. Strains that grew on Kansas antibiotic plates but not on Kan / Spc antibiotic plates were selected; these strains contained only the pCas plasmid. The WdlO-tPS / pCas strain was then incubated overnight at 42°C and 220 rpm on a shaker. Remove the temperature-sensitive pCas plasmid, streak onto antibiotic-free plates the next day, incubate overnight at 37°C, and sort out single clones. Then, spot-streak onto both antibiotic-resistant and antibiotic-free plates. Strains that have had their pCas plasmid removed will grow on antibiotic-free plates but not on antibiotic-resistant plates. Maintain the correct strain, WdlO-tPS.

[0052] (g) Verify the background expression of SpyCatcher4573 recombinant protein in WdlO-tPS strain.

[0053] Western blot analysis confirmed the correct expression of the SpyCatcher4573 recombinant protein. Coomassie brilliant blue staining was used to verify consistent sample loading in both lanes. Results are as follows: Figure 1 As shown.

[0054] (h) Analysis of coding gene retention rate

[0055] The plasmid pET28a-SC (prepared and preserved in our laboratory) containing the glycosyltransferase PglL and the recombinant protein SpaCather4573 fused with a glycosylation recognition site was transformed into the W3110△waaL△wbbH-L strain obtained in step (2) using electroporation, resulting in the W3110△waaL△wbbH-L / SC4573 strain. The retention rates of the glycosyltransferase (PglL) and substrate protein (SpyCatcher4573) encoding genes in the W3110△waaL△wbbH-L / SC4573 strain and the WdlO-tPS strain were analyzed using PCR. The results showed that the genes carried by the plasmid were significantly lost after continuous passage. Figure 2 The strains that integrated glycosyltransferases and substrate proteins into the genome did not exhibit gene loss, demonstrating remarkable genetic stability.

[0056] Example 2: The engineered strain WdlO-tPS further omits the yfdGHI gene cluster.

[0057] The yfdGHI gene cluster was knocked out in the engineered strain WdlO-tPS using the CRISPR-Cas9 method, including the following steps:

[0058] 1. Create electrocompetent states.

[0059] The target strain WdlO-tPS was cultured at 37℃ and 200 rpm until OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and then resuspended in 10% glycerol to obtain the prepared WdlO-tPS competent cells, which were then cryopreserved at -80℃ for later use. The pCas plasmid (commercially available) was electrotransduced into the competent cells (1.8 kV, 4.5 mS). After thawing for 1 hour, the cells were plated on Kan-resistant LB agar plates and incubated overnight at 30℃. The next day, single colonies were picked, and after verifying successful plasmid transformation using the validation primers pCas-U and pCas-D, each colony was picked and inoculated into 5 mL of liquid LB medium, and incubated overnight at 30℃ and 200 rpm. The following day, the cells were seeded into 50 mL of liquid LB medium at a volume ratio of 1:100 and cultured at 30°C and 200 rpm until OD600 reached approximately 0.5. Then, arabinose was added to a final concentration of 10 mmol / L, and the cells were cultured further until OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and finally resuspended in 10% glycerol. This yielded the prepared WdlO-tPS / pCas competent cells, which should be cryopreserved at -80°C for later use.

[0060] 2. Design sgRNA sequences.

[0061] The gene cluster to be deleted, yfdGHI (nucleotide sequence as shown in SEQ ID NO.33), was entered into the N20 design website http: / / crispor.tefor.net / . A high-scoring N20 sequence (TTACTGAATATCTTGATGCT) was selected to design primers W3110-yfdGHI-N20 (nucleotide sequence as shown in SEQ ID NO.14) and ptf-R.

[0062] 3. Construct the pTargetF-yfdGHI plasmid.

[0063] Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-yfdGHI-N20 and ptf-R. After gel extraction, the obtained linear DNA fragments were ligated into circular fragments. The ligation product was transformed into DH5α competent cells, incubated at 37°C and 220 rpm for 1 hour, and then plated on spectinomycin (Spc) resistant LB agar plates and incubated overnight at 37°C. The next day, single colonies were picked, amplified using primers gRNA-U / N20-D, and sequenced to verify successful plasmid construction. After verification, the bacterial strain was preserved, and the pTargetF-yfdGHI plasmid was extracted using a plasmid miniprep kit (Tiangen) and stored at -20°C for later use.

[0064] 4. Construct the homologous arm CD.

[0065] Using the genome of *E. coli* strain W3110 as a template, homologous arms C (nucleotide sequence as shown in SEQ ID NO. 8), D (nucleotide sequence as shown in SEQ ID NO. 9), C (nucleotide sequence as shown in SEQ ID NO. 10), and D (nucleotide sequence as shown in SEQ ID NO. 11) were amplified using primers yfdGHI-AF (nucleotide sequence as shown in SEQ ID NO. 8), yfdGHI-AR (nucleotide sequence as shown in SEQ ID NO. 9), yfdGHI-BF (nucleotide sequence as shown in SEQ ID NO. 10), and D (nucleotide sequence as shown in SEQ ID NO. 11), respectively. After gel extraction and recovery, DNA fragments C and D were ligated using a ligation kit. The ligation product was then used as a template to amplify homologous arm CD using primers yfdGHI-AF / yfdGHI-BR. After gel extraction and recovery, the amplified product was stored at -20°C for later use.

[0066] 5. Deletion of the yfdGHI gene cluster.

[0067] 400 ng of homologous arm CD and 100 ng of pTargetF-yfdGHI plasmid were simultaneously electroporated into electrotransformation competent cells WdlO-tPS / pCas (1.8 kV, 4.0 mS), and the cells were incubated at 30°C and 200 rpm for 1 h. The cells were then plated on Kan / Spc resistant plates and incubated overnight at 30°C. The next day, single clones were picked and verified by PCR using primers yfdGHI-checkF1 (nucleotide sequence as shown in SEQ ID NO.12) and yfdGHI-checkR1 (nucleotide sequence as shown in SEQ ID NO.13). Sequencing confirmed that the gene cluster was missing. The strain carried pCas and pTargetF plasmids and was named WdlO-tPS△yfdGHI / pCas+pTargetF-yfdGHI.

[0068] 6. Remove pTargetF-yfdGHI plasmid and pCas plasmid.

[0069] The WdlO-tPS△yfdGHI / pCas+pTargetF-yfdGHI strain was cultured at 30℃ and 220rpm on a shaker until the OD600 reached approximately 0.5. Then, 5μL of IPTG (1mol / L) was added to induce the removal of the pTargetF-yfdGHI plasmid. The next day, the strain was streaked onto Kansas resistant plates and incubated overnight at 30℃. After sorting out single clones, they were spotted onto both Kansas resistant plates and Kan / Spc resistant plates. The strain that lost the pTargetF plasmid grew on Kansas resistant plates but not on Kan / Spc resistant plates. Strains that grew on Kansas resistant plates but not on Kan / Spc resistant plates were selected; these strains contained only the pCas plasmid. The WdlO-tPS△yfdGHI / pCas strain was then cultured overnight at 42℃ and 220rpm on a shaker. The temperature-sensitive pCas plasmid was removed, and the strain was streaked onto antibiotic-free plates the following day and incubated overnight at 37°C. Single clones were then sorted and spotted onto both antibiotic-resistant and antibiotic-free plates. The strain without the pCas plasmid grew on antibiotic-free plates but not on antibiotic-resistant plates. The correct strain, WdlO-tPS△yfdGHI, was preserved and renamed WdlO-tPS001.

[0070] Example 3: The engineered strain WdlO-tPS001 can increase the yield of biosynthesized antigen polysaccharide-protein bioconjugate products.

[0071] Since the genomes of the WdlO-tPS001 strain and the WdlO-tPS engineered strain have already stably integrated the glycosyltransferase and substrate protein elements required for PGCT technology, it is only necessary to clone the gene cluster encoding the surface polysaccharide antigen of the pathogenic bacteria into the engineered strain or the WdlO-tPS engineered strain to obtain the product of bioconjugation between the pathogenic bacterial polysaccharide antigen and the substrate protein (SpyCatcher4573).

[0072] This embodiment uses the preparation of Klebsiella pneumoniae O2 serotype polysaccharide antigen as an example. Using genomic DNA of Klebsiella pneumoniae strain 355 as a template, high-fidelity PCR amplification of the polysaccharide synthesis gene cluster (nucleotide sequence shown in SEQ ID NO. 29) was performed using specific amplification primers 355-F (nucleotide sequence shown in SEQ ID NO. 22) / 355-R (nucleotide sequence shown in SEQ ID NO. 23) targeting the O antigen polysaccharide synthesis genome. The vector pACYC184 was similarly amplified by PCR using primers ori-F (nucleotide sequence shown in SEQ ID NO. 21) / ori-R (nucleotide sequence shown in SEQ ID NO. 24). Infusion adapters (15bp repeat sequences) were added to each primer, and all fragments were ligated into a circular plasmid using the infusion method to construct the polysaccharide antigen expression vector pACYC184-KPO2. Plasmid pACYC184-KPO2, containing the gene cluster for the synthesis of Klebsiella pneumoniae O2 surface polysaccharide antigen, was transformed into WdlO-tPS strain and WdlO-tPS△yfdGHI strain, respectively, using electroporation. Expression was induced by IPTG using standard methods, and the synthesis of the antigen polysaccharide-protein bioconjugate was verified by Western blotting using an anti-His tag antibody. Coomassie brilliant blue staining was used to verify consistent sample loading in each lane. Results are as follows: Figure 3 As shown, under the same loading amount, the lane of the WdlO-tPS△yfdGHI / KPO2 strain expressing KPO2-SC glycoprotein was significantly darker than that of the WdlO-tPS / KPO2 strain expressing KPO2-SC glycoprotein. The darker the lane color, the higher the protein content. This suggests that in bacterial cultures with the same OD value, the WdlO-tPS△yfdGHI strain has a higher glycoprotein expression level than the WdlO-tPS strain.

[0073] Simultaneously, image grayscale scanning was used to quantitatively analyze the proportion of expression level differences, and the results are as follows: Figure 4 The results showed that deletion of the yfdGHI gene cluster increased the yield of the biosynthesized antigen polysaccharide-protein bioconjugate (KPO2-SC). Example 4: The polysaccharide-protein bioconjugate obtained from engineered strains WdlO-tPS and WdlO-tPS001 was used to prepare a nanopolysaccharide conjugate vaccine.

[0074] Using the polysaccharide-protein bioconjugate obtained in Example 2, along with self-assembled protein nanoparticles and virus-like protein nanoparticles (VLPs) with SpyTag linkers, nanopolysaccharide conjugate vaccines with antigenic polysaccharides can be formed in vitro. This example uses one type of VLP (AP205 protein particle) to illustrate its application prospects.

[0075] 1. Cloning of protein nanoparticles.

[0076] The coding sequence of SpyTag-AP205 (ST-AP205) was synthesized. The DNA fragment and pET28a plasmid were synthesized by double digestion with restriction endonucleases NcoI and XhoI, respectively. The fragments were ligated using T4 DNA ligase and transformed into BL21 culture medium. After transformation, the medium was added to LB liquid medium and transferred to 1.5 mL sterile EP tubes. The EP tubes were incubated at 37°C with shaking at 220 rpm for 1.5 h. Then, 200 μL of the bacterial culture was spread onto kanamycin-resistant LB agar plates and incubated at 37°C for 12 h. Single clones were picked, and the correct strain was screened by PCR. The plasmid contained in this strain was named pET28a-SpyTag-AP205.

[0077] 2. Expression and purification of protein nanoparticles.

[0078] Preparation of relevant solutions:

[0079] Equilibrium solution A: 75 mmol / L imidazole, 20 mmol / L Tris-HCl (pH 7.8), 150 mmol / L NaCl, 0.1% Tween-20.

[0080] Elution buffer A: 100 mmol / L imidazole, 50 mmol / L Tris-HCl (pH 7.8), 150 mmol / L NaCl, 0.1% Tween-20.

[0081] Elution buffer B: 2 mol / L imidazole, 50 mmol / L glycine, 25 mmol / L sodium citrate, 0.1% Tween-20, pH 8.5

[0082] Purification steps:

[0083] Collect bacterial cells by centrifuging 1 L of BL21 bacterial culture containing plasmid pET28a-SpyTag-AP205 at 8000 rpm for 10 min. Resuspend the bacterial cells in 300 mL of equilibration buffer and homogenize using an autoclave three times. After homogenization, collect the supernatant by centrifugation at 8000 rpm for 10 min, repeating once. Equilibrate the affinity chromatography nickel column (1.6 × 15 cm²) with equilibration buffer A to at least 3 column volumes. Load the supernatant into the sample via a tubing at 4 mL / min. After loading, wash away unbound proteins with elution buffer A until the UV absorbance at 280 nm is close to 0 mAU. Elute with elution buffer B and collect the eluent. Place the collected sample into a 100 kDa dialysis bag, place it in dialysis buffer, and dialyze at 4 °C for 3 hours, changing the buffer once. Finally, dialyze with PBS for 5 hours. Centrifuge at 16000g for 10 min at 4℃, and collect the supernatant as the ST-AP205 protein nanoparticle carrier. Protein content was determined using a micro-BCA protein quantification kit.

[0084] 3. In vitro coupling reaction of polysaccharide antigens with nanoparticles.

[0085] The KPO2-SC and ST-AP205 obtained in Example 2 were spontaneously coupled in a PBS buffer system at a molar ratio of 4:1 and reacted overnight at 4°C. At least one column volume of a Superdex G200 chromatography column (1.6 × 90 cm²) was equilibrated with 1×PBS buffer. The bound sample was loaded at a rate of 1.5 mL / min, and 5 mL was collected per tube. The obtained target sample was named AP205-OPS, which is the candidate nanopolysaccharide conjugate vaccine. Protein content was determined using a micro-BCA protein quantification kit. SDS-PAGE, His antibody detection, and anti-KPO2-OPS serum antibody detection of this sample were also performed. The results are as follows: Figure 5 As shown, "+" indicates the presence of ST-AP205 or KPO2-SC protein, and "-" indicates the absence of ST-AP205 or KPO2-SC protein. Therefore, the left lane is filled with KPO2-SC protein, the middle lane is filled with AP205-OPS nanopolysaccharide conjugate vaccine, and the right lane is filled with ST-AP205 nanoparticles; the particle size of the AP205-OPS nanopolysaccharide conjugate vaccine is as follows... Figure 6 As shown, peak overlap indicates uniform particle size.

[0086] 4. Evaluation of the immunogenicity of nanopolysaccharide conjugate vaccines.

[0087] Six-week-old female BALB / c mice were randomly divided into three groups (PBS control group, OPS group, and nanovaccine group (O2-VLP)), with 10 mice in each group. They were subcutaneously immunized on days 0, 14, and 28. The polysaccharide content was 5 μg / mouse. Fourteen days after the three-dose immunization, the mice were challenged with Klebsiella pneumoniae strain 355 via intraperitoneal injection at a dose of 2.5 × 10⁷ CFU / mouse. The mice were observed for 7 days, and survival curves were plotted. The results are as follows: Figure 7 As shown, the survival rate of mice in the nanovaccine group was significantly different from that in the control group, proving that glycoproteins produced by engineered strains can be used for the preparation of nanopolysaccharide conjugate vaccines.

Claims

1. An engineered bacterium capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, characterized in that, The engineered bacteria was developed using Escherichia coli as the starting strain. The yfdGHI gene cluster was knocked out of the E. coli genome and integrated with glycosyltransferase and substrate protein genes. The nucleotide sequence of the yfdGHI gene cluster is shown in SEQ ID NO.

33. The glycosyltransferase is PglL, and its nucleotide sequence is shown in SEQ ID NO.26; the substrate protein is SpyCatcher protein with modified glycosylation sites, and its nucleotide sequence is shown in SEQ ID NO.

27.

2. The engineered bacteria according to claim 1, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... The engineered bacteria also knocked out the waaL gene and / or wbbH-L gene cluster on the Escherichia coli genome.

3. The engineered bacteria according to claim 2, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... The starting strain was Escherichia coli W3110.

4. The engineered bacteria according to claim 3, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... The wbbH-L gene cluster was replaced with glycosyltransferase genes and substrate protein genes.

5. The engineered bacteria according to claim 3, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... The glycosyltransferase gene and substrate protein gene were integrated into the E. coli genome using the CRISPR-Cas9 method.

6. The engineered bacteria according to claim 5, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... Methods for integrating glycosyltransferase genes and substrate protein genes into the E. coli genome include: (1) Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-wbbH-L-N20 ​​and ptf-R to construct a new plasmid pTargetF-wbbH-L; (2) Constructing the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B Wherein, the nucleotide sequence of A is shown in SEQ ID NO.30; the nucleotide sequence of B is shown in SEQ ID NO.31; LacI is a transcriptional regulatory element, and its nucleotide sequence is shown in SEQ ID NO.25; pglL is a glycosyltransferase, and its nucleotide sequence is shown in SEQ ID NO.26; SpyCatcher4573 is a recombinant protein fused with a glycosylation recognition site, and its nucleotide sequence is shown in SEQ ID NO.27; rrnB is a transcription terminator sequence, and its nucleotide sequence is shown in SEQ ID NO.

28. (3) Take 400 ng of homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B and plasmid pTargetF-wbbH-L and electroporate them into competent E. coli cells containing pCas.

7. The engineered bacteria according to claim 6, capable of stably expressing antigenic polysaccharide-protein biocoupled biofactors and increasing product yield, is characterized in that... The preparation method of the engineered bacteria includes the following steps: (1) Starting with Escherichia coli W3110, the waaL gene was knocked out to obtain W3110△waaL strain; (2) Electroporate the pCas plasmid into strain W3110△waaL; (3) Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-wbbH-L-N20 ​​and ptf-R. After gel extraction, the obtained linear DNA fragments were ligated into circular fragments. The ligation products were transformed into DH5α competent cells for culture, positive clones were screened, and pTargetF-wbbH-L plasmid was extracted. (4) Using the genome of Escherichia coli strain W3110 as a template, the upstream and downstream homologous arms A and B were amplified using primers wbbH-L-lacI-AF and wbbH-L-lacI-AR, wbbH-L-SC-BF and wbbH-L-SC-BR, respectively; using plasmid pET28a-SC as a template, the LacI-pglL-Spycatcher4573-rrnB sequence element was amplified using primers lacI-F and SC-R; the homologous arms A, LacI-pglL-Spycatcher4573-rrnB and homologous arm B of the DNA fragment were sequentially ligated; and the ligation product was then used as a template to amplify the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B using primers wbbH-L-lacI-AF / wbbH-L-SC-BR. The plasmid pET28a-SC was obtained by linking the plasmid backbone pET28a and the fully synthesized sequence XhoI-pglL-Spycatcher4573-rrnB-BglII through the restriction sites XhoI and BglII. (5) Take the homologous arm A-LacI-pglL-Spycatcher4573-rrnB-B and pTargetF-wbbH-L plasmid and electroporate them simultaneously into W3110△waaL / pCas competent cells; (6) Knock out the yfdGHI gene cluster from the engineered strain prepared in step (5).

8. The use of the engineered bacteria described in any one of claims 1-7, which can stably express antigen polysaccharide-protein bioconjugation-related biological elements and increase product yield, in the preparation of antigen polysaccharide-protein bioconjugation products.

9. The use of the engineered bacteria according to any one of claims 1-7, which can stably express antigen polysaccharide-protein biocoupled related biological elements and increase product yield, in the preparation of polysaccharide conjugate vaccines.