Molecular marker ace2 suitable for intervertebral disc degeneration prevention and diagnosis and treatment and application thereof

Abstract

The application relates to the technical field of medical biological detection, in particular to a molecular marker ACE2 suitable for intervertebral disc degeneration prevention and diagnosis and treatment and application thereof, including the molecular marker ACE2, the CDS sequence of the ACE2 gene is 2418 bases in total, and the coding product of the ACE2 is 805 amino acids in total, the application can early screen intervertebral disc degeneration patients, so as to early intervene or prevent, maximize to delay the progress of the patient's condition, and reduce the disability rate, the application first discovers the molecular marker ACE2 which has high diagnosis and treatment value for intervertebral disc degeneration; through the development and application of the marker ACE2 diagnosis kit and related drugs, early diagnosis and treatment of intervertebral disc degeneration can be more convenient and easy, and the clinician can quickly and accurately master the patient's condition, and lay a foundation for improving the clinical treatment effect. Meanwhile, based on the fact that the activity of the ACE2 or the intracellular content of the product is obviously relieved, the degeneration phenotype of the nucleus pulposus cell is relieved, a new treatment target is provided for the treatment of intervertebral disc degeneration.

Description

Technical Field

[0001] This invention relates to the field of medical biodetection technology, specifically to ACE2, a molecular marker applicable to the prevention and treatment of intervertebral disc degeneration, and its applications. Background Technology

[0002] Intervertebral disc degeneration (IVDD) is one of the most important factors causing chronic low back pain, seriously threatening public health. It is reported that nearly 80% of people will experience low back pain in their lifetime, and 40% of these patients have chronic low back pain related to intervertebral disc degeneration (IVDD). Furthermore, with the aging of society, the incidence of IVDD is gradually increasing, imposing a huge medical burden and economic pressure on the world every year. Pathologically, IVDD is mainly characterized by degeneration of the nucleus pulposus, a decrease in the number of nucleus pulposus cells, and metabolic disorders of the extracellular matrix, ultimately leading to the disruption of the biomechanical stability of the intervertebral disc-vertebral body unit and the occurrence of neuromuscular injury-related symptoms. IVDD has a high incidence rate, and currently lacks effective treatments to slow down degeneration, making it a global public health problem urgently needing to be addressed. Therefore, in-depth understanding of the key molecular mechanisms of nucleus pulposus cell degeneration is of significant clinical and social value for developing new treatments for IVDD.

[0003] Therefore, this invention proposes a molecular marker ACE2 suitable for the prevention and treatment of intervertebral disc degeneration and its application. Summary of the Invention

[0004] In view of the above-mentioned shortcomings of the existing technology, the first objective of the present invention is to provide a molecular marker ACE2 suitable for the prevention and treatment of intervertebral disc degeneration and its application, thereby solving the problems in the background technology.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] A molecular marker ACE2 suitable for early screening, diagnosis and treatment of intervertebral disc degeneration, comprising the molecular marker ACE2, wherein the ACE2 gene CDS sequence comprises 2418 bases and the ACE2 encoded product comprises 805 amino acids.

[0007] The diagnostic and therapeutic application of ACE2, a molecular marker suitable for early screening, diagnosis, and treatment of intervertebral disc degeneration, is described in the application of ACE2 in the preparation of diagnostic reagents for intervertebral disc degeneration, wherein the diagnostic reagents are nucleus pulposus tissue detection reagents.

[0008] Preferably, the biological sample detected by the diagnostic reagent is intervertebral disc nucleus pulposus tissue.

[0009] Preferably, the biological sample is obtained from the following sources: fresh tissue of the subject.

[0010] Preferably, the diagnostic reagent further includes a probe that has detection specificity for ACE2.

[0011] Preferably, the diagnostic reagent is a reagent used to detect ACE2 expression levels using the Real-time RT-PCR method.

[0012] Preferably, the method for maintaining and improving intervertebral disc degeneration by adjusting ACE2 levels involves directly treating nucleus pulposus cells with the ACE2 enzyme product Ang1-7 protein to obtain a human nucleus pulposus cell model rich in Ang1-7 protein.

[0013] Beneficial effects

[0014] Compared with known public technologies, the technical solution provided by this invention has the following beneficial effects:

[0015] This invention enables early screening of patients with intervertebral disc degeneration, facilitating timely intervention or prevention to minimize disease progression and reduce disability rates. It is the first to discover ACE2, a molecular marker with high diagnostic and therapeutic value for intervertebral disc degeneration. The development and application of ACE2 diagnostic kits and related drugs make early diagnosis and treatment of intervertebral disc degeneration more convenient and accessible, allowing clinicians to quickly and accurately assess patient conditions and laying the foundation for improved clinical treatment outcomes. Furthermore, the significantly enhanced intracellular content of ACE2 or its products alleviates the degenerative phenotype of nucleus pulposus cells, providing a new therapeutic target for intervertebral disc degeneration. Attached Figure Description

[0016] Figure 1 Differential gene expression maps from transcriptome databases of intervertebral disc nucleus pulposus tissues from multiple individuals;

[0017] Figure 2 A diagram illustrating the in vitro construction of a human nucleus pulposus cell degeneration model;

[0018] Figure 3 A diagram of a mouse model with the ACE2 gene knocked out;

[0019] Figure 4 A graph showing the changes in a mouse model with ACE2 gene knockout;

[0020] Figure 5 A diagram of an in vitro constructed human nucleus pulposus cell model with ACE2 gene knockdown.

[0021] Figure 6 This is a diagram of a mouse model with ACE2 gene overexpression. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0023] The present invention will be further described below with reference to embodiments.

[0024] Example

[0025] A molecular marker ACE2 suitable for early screening, diagnosis and treatment of intervertebral disc degeneration, comprising the molecular marker ACE2, wherein the ACE2 gene CDS sequence comprises 2418 bases and the ACE2 encoded product comprises 805 amino acids.

[0026] The diagnostic and therapeutic application of ACE2, a molecular marker suitable for early screening, diagnosis, and treatment of intervertebral disc degeneration, is described in the preparation of diagnostic reagents for intervertebral disc degeneration, wherein the diagnostic reagents are nucleus pulposus tissue detection reagents.

[0027] Molecular biomarkers suitable for early screening and diagnosis of intervertebral disc degeneration: Transcriptome sequencing analysis of human intervertebral disc nucleus pulposus tissue revealed that ACE2 expression was significantly reduced in degenerated intervertebral discs. Gene expression detection and histological molecular analysis of human nucleus pulposus tissue showed that the expression level of ACE2 in nucleus pulposus cells was negatively correlated with the degree of intervertebral disc degeneration and also negatively correlated with patient age. ACE2 gene knockout mice were constructed using CRISPR-Cas9 technology, and single-cell sequencing of intervertebral disc nucleus pulposus cells from these mice revealed that ACE2 knockout of nucleus pulposus cells made them more susceptible to cellular senescence and intervertebral disc degeneration. This was verified in in vitro cell experiments. Given that ACE2 protein can be distributed in the cytoplasm, cell membrane, and extracellular space after synthesis, the risk and degree of intervertebral disc degeneration in the tested population can be assessed by detecting the expression level of ACE2 in serum.

[0028] The application of the molecular marker ACE2 in the preparation of diagnostic reagents or kits for intervertebral disc degeneration is as follows:

[0029] The diagnostic reagent or kit mentioned is a nucleus pulposus tissue detection reagent or kit;

[0030] The diagnostic reagent or kit is used to detect the expression level of ACE2 in biological samples, wherein the biological samples are selected from: fresh tissues or cells obtained from the subject, formalin-fixed or paraffin-embedded tissues or cells, blood or body fluids;

[0031] The biological sample is intervertebral disc nucleus pulposus tissue;

[0032] The diagnostic reagents or kits include: probes, gene chips, or PCR primers that have specificity for detecting ACE2;

[0033] The diagnostic reagent or kit mentioned is a reagent or kit for detecting ACE2 expression using the Real-time RT-PCR (qPCR) method;

[0034] The substance with detection specificity for ACE2 is the nucleotide sequence of PCR primers.

[0035] One of the inventions is a kit for diagnosing intervertebral disc degeneration, which includes reagents for detecting ACE2 expression levels.

[0036] The reagent used to detect ACE2 expression is a reagent for detecting ACE2 expression using the Real-time RT-PCR method;

[0037] The kit includes the nucleotide sequences of PCR primers that are specific for the detection of ACE2.

[0038] Among them, the use of reagents for detecting ACE2 expression levels in the preparation of kits for the diagnosis or screening of intervertebral disc degeneration is provided.

[0039] One of the methods provided is to maintain and / or improve intervertebral disc degeneration by increasing ACE2 levels: directly treating nucleus pulposus cells with the enzyme product Ang1-7 protein of ACE2 to obtain a human nucleus pulposus cell model rich in Ang1-7 protein;

[0040] The specific steps are as follows:

[0041] The design was based on the human Ace2 gene CDS sequence. The human Ace2 gene CDS sequence consists of 2418 bases and encodes a product of 805 amino acids.

[0042] mACE2KO mouse genotyping protocol: hACE2-F: 5′

[0043] -TGCTGGTTATTGTGCTGTCTCATCA-3′; hACE2-R: 5′

[0044] -CAGGTCTTCGGCTTCGTGGTTAA-3′. Annealing temperature: 56℃, theoretical PCR product size: 163bp;

[0045] Lumbar instability and acupuncture-mediated intervertebral disc degeneration models were established in wild-type and ACE2-overexpressing mice, respectively. One month post-surgery, disc tissues were harvested, and the degree of disc degeneration at the surgical segments was assessed in each group. The results showed that the degree of disc degeneration in the ACE2-overexpressing group was less severe than in the control group in both the lumbar instability and acupuncture models. HE staining indicated that the intervertebral disc structure was clearer in the ACE2-overexpressing group compared to the wild-type group, with the boundary between the nucleus pulposus and annulus fibrosus still visible. Safranin-Fix-Green staining showed that the nucleus pulposus tissue at the surgical segments of the ACE2-overexpressing group still contained a significant amount of proteoglycans, suggesting less extracellular matrix damage compared to the wild-type control group.

[0046] Working principle:

[0047] Option 1:

[0048] 1) Transcriptome data from multiple individuals with intervertebral disc degeneration nucleus pulposus tissue were selected for common differential gene screening analysis to explore the expression changes of the ACE2 gene in intervertebral disc degeneration;

[0049] 2) ACE2 gene expression differences were analyzed in intervertebral disc tissue samples from patients with severe disc degeneration (n=20) and from normal or mildly degenerated intervertebral disc tissue samples obtained after trauma surgery (n=10). There were no statistically significant differences in patient age, smoking, and alcohol consumption between the two groups (P>0.05).

[0050] 3) Intervertebral disc tissues (n=10 / group) from patients with different grades of intervertebral disc degeneration were selected, and the differential expression of ACE2 protein was analyzed by immunohistochemistry.

[0051] 4) The ACE2 protein level in intervertebral disc tissue (n=59) of patients with different grades of intervertebral disc degeneration was detected using an ACE2 protein detection ELISA kit;

[0052] The research methodology is as follows:

[0053] We searched the human intervertebral disc nucleus pulposus transcriptome sequencing database in the NCBI database, cleaned and standardized the data, analyzed the differentially expressed genes, and explored the expression changes of ACE2 gene in degenerated intervertebral disc tissue by obtaining the intersection.

[0054] During the operation, intervertebral disc tissue was removed from the patient and, according to the experimental design, was fixed in 4% paraformaldehyde, fixed in liquid nitrogen, and immediately immersed in sterile PBS and then immediately transported to the laboratory for cell culture.

[0055] Immunohistochemistry and ELISA were used to detect the ACE2 protein levels in sclerotic tissues with different degeneration stages.

[0056] Conclusion: Intersection of differentially expressed genes from multiple human intervertebral disc nucleus pulposus transcriptome databases revealed a significant decrease in ACE2 gene expression in degenerated nucleus pulposus tissue. Gene expression analysis showed that ACE2 gene expression was significantly lower in degenerated human nucleus pulposus tissue compared to normal human nucleus pulposus tissue (P<0.0001). Furthermore, in vitro nucleus pulposus cell culture of normal and degenerated human intervertebral disc nucleus pulposus cells showed a significant decrease in ACE2 gene expression in degenerated human nucleus pulposus cells compared to normal human nucleus pulposus cells (P<0.0001). Further histological studies of human nucleus pulposus tissue revealed a negative correlation between ACE2 expression in nucleus pulposus cells and the severity of intervertebral disc degeneration. We also detected ACE2 protein levels in different degenerated human nucleus pulposus tissues, finding a negative correlation between ACE2 protein levels and the severity of intervertebral disc degeneration.

[0057] Option 2:

[0058] Normal intervertebral disc tissue (n=3) was collected during trauma surgery for in vitro cell experiments;

[0059] In vivo experiments were conducted using 6-8 week old C57 wild-type mice to construct a natural intervertebral disc degeneration model and an acupuncture-mediated intervertebral disc degeneration model (n=5).

[0060] Research Methods:

[0061] Nucleus pulposus cell extraction: Intervertebral disc tissue was harvested during surgery, immediately immersed in sterile PBS, and transported to the laboratory. NP cells were extracted under sterile conditions for primary culture. Well-grown nucleus pulposus cells were seeded into 6-well plates (normal culture, 37°C, 5% CO2 incubator). Once the cell density reached 60-80%, natural and inflammation-induced degeneration models of nucleus pulposus cells were constructed. ACE2 gene expression was detected using RT-qPCR. The primer sequences are as follows: Forward primer: TGCAGCCACACCTAAGCATT; Reverse primer: GTCCCAACAATCGTGAGTGC; Size: 114bp.

[0062] Construction of a model for lumbar instability and degeneration:

[0063] 1) Preoperative preparation: Surgical instruments are sterilized using a high-pressure steam sterilizer (121℃, 30 minutes), and then dried overnight in a 65℃ oven until ready for use. Simultaneously, prepare the operating table (approximately 60cm x 60cm), intraoperative shadowless lamp, gas anesthesia machine, sutures and needles, painless iodine solution, normal saline, sterile gauze, disposable sterile surgical gown, disposable sterile gloves, and disinfectant alcohol.

[0064] 2) Animal preparation: One week before the experiment, purchase 30 male C57BL / 6J mice (6-8 weeks old) and place them in the laboratory's public animal housing (SPF grade), allocating them to 5 mice per cage. Provide sufficient food and water, and cycle the lighting in the animal housing every 12 hours from day to night.

[0065] 3) Preoperative anesthesia: The experimental mice were first placed in the anesthesia machine induction box for preoperative anesthesia induction. The oxygen flow rate of the anesthesia machine was controlled at 0.4 L / min and the isoflurane concentration was controlled at 4%. After the mice were comatose, they were removed and maintained by endotracheal anesthesia (1.5% isoflurane, 0.4 L / min oxygen). After the mice’s heartbeat and breathing were stable, the surgery was performed.

[0066] 4) Skin preparation: Use a small animal trimmer to scrape the surgical area on the dorsal surface, from the lower chest area to the top of the sacral area, and wipe away the scraped skin with a tissue. It is recommended to apply tetracycline hydrochloride eye ointment around the eyes during surgery to prevent corneal dryness.

[0067] 5) Expose the facet joints: Palpate the lateral aspect of the spinous processes of the lumbar vertebrae with your index finger, comparing them with the thoracic and sacral vertebrae to determine the lumbar region. Refer to Jacoby's line (yellow line) to determine the L4-5 level. The red curve represents the bilateral posterior iliac crests. Incise the skin layer by layer, bluntly dissect the subcutaneous fascia, and expose the L4-5 facet joints layer by layer. Preserve the L4-5 facet joints, and use microsurgical needle forceps to remove the bilateral inferior facets, while simultaneously excising the adjacent interspinous ligaments.

[0068] 6) Suturing the incision: Suture the subcutaneous fascia and skin layer by layer (5.0 sutures), apply tetracycline hydrochloride eye ointment to the surgical site, and place the animal on a warming board to wait for the anesthesia to wear off. Then, place it in the animal house for normal feeding.

[0069] 7) Postoperative observation: The condition of the surgical animal was observed daily for three days after surgery until the animal's condition stabilized. One month after surgery, lumbar MRI and histological staining assessment were performed.

[0070] Construction of acupuncture-mediated degeneration model:

[0071] 1) All animal-related experiments shall comply with the ethical requirements and standards for laboratory animals of this unit’s animal experiment center.

[0072] 2) According to the experimental plan, purchase 20 C57BL / 6 mice aged 6-8 weeks and place them in a laboratory-specific animal husbandry center to allow them to acclimatize to the environment for one week. During this period, the mice are provided with sufficient food and water and are allowed to move around freely.

[0073] 3) First, place the mouse in an anesthesia induction box for induction anesthesia. After the mouse enters the anesthesia state, transfer the mouse to a constant temperature operating table and cover the mouse's nostrils with an anesthesia mask for gas anesthesia.

[0074] 4) Disinfect the corresponding parts of the mouse tail with alcohol and iodine solution respectively.

[0075] 5) Locate the Co7 / 8 and Co8 / 9 vertebral bodies through palpation to determine the intervertebral space. Insert a pre-prepared 1mL sterile syringe needle vertically into the intervertebral space to a depth of 2-3mm. Stop advancing when the needle reaches the center of the nucleus pulposus. Rotate the needle 180° and hold for 35 seconds. The sham surgery group only underwent palpation, without puncture.

[0076] 6) After the modeling is completed and the skin surface is disinfected, the mice are returned to the animal housing according to their groups and given normal food and water.

[0077] 7) One month after surgery, a lumbar MRI and histological staining assessment were performed;

[0078] Conclusion: In vitro models of human nucleus pulposus cell degeneration (aging and inflammation models) revealed that ACE2 gene expression decreased with increasing degrees of nucleus pulposus cell degeneration. Furthermore, in vivo mouse models of spontaneous intervertebral disc degeneration and acupuncture-mediated intervertebral disc degeneration showed that ACE2 protein expression decreased with increasing degrees of intervertebral disc degeneration; moreover, ACE2 protein was primarily expressed in the nucleus pulposus tissue of the intervertebral disc.

[0079] like Figure 1 - Figure 6 As shown:

[0080] Figure 1 Intersection of differentially expressed genes from multiple human intervertebral disc nucleus pulposus transcriptome databases revealed a significant decrease in ACE2 gene expression in degenerated nucleus pulposus tissue. Gene expression assays showed that ACE2 gene expression was significantly lower in degenerated human nucleus pulposus tissue compared to normal human nucleus pulposus tissue (P<0.0001). Furthermore, in vitro nucleus pulposus cell culture of normal and degenerated human intervertebral disc nucleus pulposus cells showed a significant decrease in ACE2 gene expression compared to normal human nucleus pulposus cells (P<0.0001). Further histological studies of human nucleus pulposus tissue revealed a negative correlation between ACE2 expression in nucleus pulposus cells and the severity of intervertebral disc degeneration.

[0081] Figure 2 In vitro models of human nucleus pulposus cell degeneration (aging and inflammation models) were constructed, revealing that ACE2 gene expression decreased with increasing degrees of nucleus pulposus cell degeneration. Furthermore, in vivo mouse models of spontaneous intervertebral disc degeneration and acupuncture-mediated intervertebral disc degeneration were constructed. On the one hand, ACE2 protein expression decreased with increasing degrees of intervertebral disc degeneration; on the other hand, ACE2 protein was mainly expressed in the nucleus pulposus tissue of the intervertebral disc.

[0082] Figure 3 An ACE2 gene knockout mouse model was constructed, and single-cell transcriptome sequencing was performed on intervertebral disc nucleus pulposus tissues from wild-type and ACE2 knockout mice. The results showed that ACE2 gene knockout mice highly expressed SERPINE1-positive nucleus pulposus cells. GO and KEGG analyses of these cells revealed that SERPINE1-positive nucleus pulposus cells mainly exhibited nucleus pulposus cell senescence and apoptosis, making them more prone to intervertebral disc degeneration.

[0083] Figure 4 Nucleus pulposus tissues from wild-type and ACE knockdown mice were cultured in vitro at 3, 6, and 12 months of age. Immunofluorescence and cellular senescence staining showed that ACE2 gene-deficient nucleus pulposus cells were more prone to senescence-related phenotypes, including high positive rates of P16, P21, IL-1β, and cellular galacturonidase. Furthermore, lumbar instability and acupuncture-mediated intervertebral disc degeneration models were constructed in vitro. H&E staining and Safranin-Fix-Green staining showed that ACE2 gene knockout mice were more prone to intervertebral disc degeneration.

[0084] Figure 5 An in vitro model of human nucleus pulposus cells with ACE2 gene knockdown was constructed, further confirming that nucleus pulposus cells lacking the ACE2 gene are more prone to aging-related phenotypes, including high positivity rates for P16, P21, IL-1β, and cellular galacturonidase. Cellular transcriptome sequencing results indicated that ACE2 primarily promotes nucleus pulposus cell senescence by stimulating SERPINE1 expression through the TGFβ2-Smad2 / 3 axis.

[0085] Figure 6 To investigate the therapeutic effect of restoring ACE2 expression on intervertebral disc degeneration, we constructed a mouse model of ACE2 gene overexpression and in vitro models of lumbar instability and acupuncture-mediated intervertebral disc degeneration. H&E staining and Safranin-Fix-Green staining showed that the ACE2 gene overexpressing mice had less intervertebral disc degeneration compared with the wild-type control group.

[0086] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions will not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a reagent for detecting ACE2 expression levels in the preparation of diagnostic reagents for intervertebral disc degeneration, characterized in that: The diagnostic reagent mentioned is a reagent for detecting intervertebral disc nucleus pulposus tissue.

2. The application of the reagent for detecting ACE2 expression level according to claim 1 in the preparation of diagnostic reagents for intervertebral disc degeneration, characterized in that: The biological samples tested by the diagnostic reagents were obtained from the following sources: fresh tissues of the subject.

3. The application of the reagent for detecting ACE2 expression level according to claim 2 in the preparation of diagnostic reagents for intervertebral disc degeneration, characterized in that: The diagnostic reagent also includes probes that are specific for detecting ACE2.

4. The application of the reagent for detecting ACE2 expression according to claim 3 in the preparation of diagnostic reagents for intervertebral disc degeneration, characterized in that, The diagnostic reagent is used to detect ACE2 expression levels using the Real-time RT-PCR method.

Images