DNA sequence, expression vector and use thereof

Abstract

The application discloses a DNA sequence, an expression vector and application of the DNA sequence as a terminator in expression of a target gene, and the DNA sequence has a nucleotide sequence shown in SEQ ID NO.1 or a complementary sequence with more than 90% identity. The application provides a new DNA sequence, the DNA sequence has an enhancing effect on expression of a target gene, and compared with a commonly used terminator T-nos, the target gene expression amount is increased by more than 50%. The DNA sequence has very great potential application value as a terminator in overexpression of the target gene.

Description

(I) Technical Field

[0001] This invention relates to a DNA sequence, an expression vector, and its applications. (II) Background Technology

[0002] In plant transgenic technology, the expression of exogenous genes involves a series of steps, including transcription, post-transcriptional processing, translation, and post-translational processing, resulting in specific amino acid sequences at specific times and locations. By regulating different stages of gene expression, the mode and level of gene expression can be controlled. Among these regulatory mechanisms, in addition to the characteristics of the gene itself, the expression regulatory sequences at its ends, especially the 5' promoter sequence and the 3' non-coding sequence (terminator sequence), often have a strong influence on gene expression.

[0003] Transcription terminators are located downstream of genes or operons and are responsible for the dissociation of RNA polymerase and the release of transcribed RNA, thus terminating transcription. In eukaryotic cells, pre-mRNA requires further processing after transcription to form translationally active mRNA. During this process, a poly(A) tail consisting of 25-250 nucleotide residues is often added to the 3' end of the mRNA. This process is mainly determined by a nucleotide sequence in the 3' non-coding region of the gene, which is called the 3'-processing signal or terminator.

[0004] Previously, research on terminators mainly focused on prediction and identification, while their role in regulating gene expression or genetic circuits has only recently gained attention. Terminators not only prevent transcriptional readthrough but also significantly contribute to improving the stability of upstream mRNAs. However, to date, most research on terminator regulatory elements has concentrated on microorganisms, with only a small portion of the literature mentioning their applications in plants.

[0005] Although terminators do not function as enhancers, terminators from different plant sources have very different effects on the expression of exogenous Npt-II enzymes. Literature reports indicate that 3' end sequences from different sources have a strong influence on the expression level of Npt-II enzymes in transformed tobacco cells, with differences reaching up to 60-fold.

[0006] Currently, the most commonly used terminators in transgenic engineering are the caustic soda synthase (NOS) terminator (T-Nos) and the 35S terminator of (CaMV). However, when constructing multi-gene overexpression vectors, there are still too few alternative terminators, and the efficiency of terminators needs to be improved. Therefore, it is very important to discover new and efficient terminators. (III) Summary of the Invention

[0007] The purpose of this invention is to provide a DNA sequence, expression vector, and application. This DNA sequence, as a terminator, can significantly increase the expression level of target genes, especially the cp4 gene, in plants, and has great potential application value.

[0008] The technical solution adopted in this invention is:

[0009] The present invention provides a DNA sequence having more than 90% identity with the nucleotide sequence shown in SEQ ID NO.1 or its complementary sequence, preferably the nucleotide sequence of the DNA sequence shown in SEQ ID NO.1.

[0010] Due to the specific nature of nucleotide sequences, any nucleotide sequence in SEQ ID NO. 1 that contains one or more base deletions, substitutions, or additions, and that shares more than 90% identity with any region of nucleotide sequence consisting of 319 or more bases in the nucleotide sequence shown in SEQ ID NO. 1, falls within the scope of protection of this invention. The deletion, substitution, or addition of one or more bases refers to a deletion, substitution, or addition of no more than 10% of bases.

[0011] The DNA sequence described in this invention also includes a nucleotide sequence that can hybridize with the DNA sequence shown in SEQ ID NO.1 under highly stringent conditions. These highly stringent conditions can be hybridization at 60°C in a hybridization solution, followed by washing the membrane at 60°C in a solution of 0.5×SSC and 0.1% SDS.

[0012] The present invention also provides an expression vector containing the DNA sequence, the expression vector comprising a target gene and the DNA sequence, wherein the expression vector uses pCambia1300 (purchased from VWR, NCBI serial number: AF234296) as the base vector, and the DNA sequence is ligated to the 3' end of the target gene.

[0013] The present invention also provides an artificially introduced cell line, host bacterium, or plant cell containing the expression vector.

[0014] This invention also provides an application of the DNA sequence as a terminator in improving the expression efficiency of a target gene. The application involves constructing an expression vector containing the target gene using the DNA sequence as a terminator, transforming the expression vector into the cells or tissues of a plant host, and then cultivating the transformed tissue into plants to improve the expression efficiency of the target gene.

[0015] When constructing an expression vector using the DNA sequence of this invention as a terminator, any promoter sequence and target gene sequence can be added before the sequence. The target gene includes glyphosate resistance gene cp4, insect resistance gene cry1Ab, herbicide resistance gene bar, editing gene cas9, etc.; the promoter of the target gene includes the 35S promoter of cauliflower mosaic virus CaMV, the maize UBI promoter, and the rice Act1 promoter, etc. The expression vector can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation.

[0016] The plant host can be either a monocotyledonous plant or a dicotyledonous plant. Monocotyledonous plants can include turfgrass, wheat, barley, oats, sorghum, rice, or corn, while dicotyledonous plants can include potatoes, tobacco, cotton, lettuce, tomatoes, melons, soybeans, rapeseed, mulberry, cowpeas, cucumbers, peas, beets, or sunflowers.

[0017] Compared with existing technologies, the main advantages of this invention are: This invention provides a novel DNA sequence that enhances the expression of the target gene, increasing the expression level by more than 50% compared to the commonly used terminator T-nos. This DNA sequence has significant potential application value as a terminator in the overexpression of target genes. (iv) Description of the attached drawings

[0018] Figure 1 : A schematic diagram of the structure of the expression cassette constructed by using the DNA sequence described in this invention as a new terminator TOsHSP18.1.

[0019] Wherein, promoter refers to any promoter sequence that can mediate the expression of the target gene, gene refers to any target gene, and TOsHSP18.1 refers to the novel terminator in this invention. (V) Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0021] The molecular biology and biochemical methods used in the following embodiments of the present invention are all known techniques. They are described in detail in publications such as *Current Protocols in Molecular Biology* by Ausubel, John Wiley and Sons, and *Molecular Cloning: A Labortory Manual*, 3rd ed., by J. Sambrook et al., Cold Spring Harbor Laboratory Press (2001).

[0022] Example 1: Cloning of DNA Sequences

[0023] Using the genome of the inbred rice line (9311) as a template, and with TF1 and TR1 as primers, a DNA sequence fragment of approximately 0.3 kb was obtained by PCR. The PCR-obtained DNA fragment was cloned into the pMD-18-T-Vector (TaKaRa) and its sequence was determined. The nucleotide sequence is shown in SEQ ID NO.1.

[0024] TF1: 5'TAAGAAACTTCGGGTGTGACATGCACGGTG)

[0025] TR1: 5'CTCTCAATTTCCGAAATGAACTCTCCAGTCTCG).

[0026] SEQ ID NO.1

[0027] taagaaacttcgggtgtgacatgcacggtggagagcttcgattcgagccttcggtttgtgatcaattgcagtaaataaaagcgtcaaatctggtcctcagtgtttatgctgtgaaaaagttcaaagctatgttggaagtgagcaataaagacttttcttg ttttgtgaacgaacctgagattatactagtcctacacttgtttgtttaatctaatctccggtatattctgccatttttatctcgatgtttcagtacttttagcctttggttcttgaatccttctgtcgagactggagagttcatttcggaaattgagag.

[0028] Example 2: Construction of plant expression vectors

[0029] The cp4 and cry1ab genes can confer glyphosate tolerance and lepidopteran pest resistance traits in plants, respectively. Commercially available CP4 protein and cry1ab protein-linked immunosorbent assay (ELASA) kits are readily available, facilitating the quantification of CP4 and cry1ab proteins and thus simplifying their expression analysis. We selected cp4 and cry1ab as our target genes. The 35S promoter p35S of cauliflower mosaic virus (CaMV) is one of the most commonly used promoters in plant gene expression; we used p35S as the promoter to mediate the expression of the target genes cp4 and cry1ab. As controls, we constructed expression vectors using the DNA sequence from Example 1 (denoted as the novel terminator TOsHSP18.1) and the commonly used terminator Tnos, respectively.

[0030] To construct the aforementioned vector, we artificially synthesized the cp4 gene, the Tnos terminator (Shanghai Sangon Biotech), and the cry1ab gene. The nucleotide sequences of the cp4 gene, Tnos terminator, and cry1ab gene are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. pCambia1300 (purchased from VWR) was used as the base vector (NCBI sequence number: AF234296), hereinafter referred to as 1300.

[0031] cp4 gene (SEQ ID NO.2)

[0032]

[0033] cccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc.

[0034] cry1ab gene (SEQ ID NO. 4):

[0035]

[0036] 1. Construct the binary vector 1300-p35S-cp4-TOsHSP18.1 for cp4 gene expression.

[0037] Using the 1300 vector as a template and 1300-F1 / R1 as primers, the 1300 vector fragment was amplified by PCR. Using the CP4 gene nucleotide sequence (SEQ ID NO.2) as a template and cp4-F1 / R1 as primers, the cp4 gene fragment was amplified by PCR. Using the DNA sequence cloned in Example 1 (SEQ ID NO.1) as a template and TOs18.1-F1 / R1 as primers, the TOsHSP18.1 terminator fragment was amplified by PCR.

[0038] Using recombinase (MonClone Biotechnology) TM Hi-Fusion Cloning Mix V2) homologously recombines the above three fragments to obtain the binary vector 1300-P35S-cp4-TOsHSP18.1, which is the T-DNA plasmid.

[0039] 1300-F1:5'GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG;

[0040] 1300-R1:5'CTCGAGATTCGGCGTTAATTCAGTACATAAAAACGTC;

[0041] cp4-F1:5'AAATCTATCTCTGGACCACCATGGCGGCGACATGGCGTCC;

[0042] cp4-R1:5'GAAGTTTCTTATCAAGCGGCCTTCGTGTCAGACAGTTCGATCTTGG;

[0043] TOs18.1-F1:5'CCGCTTGATAAGAAACTTCGGGTGTGACATGCACGGTGGAG;

[0044] TOs18.1-R1:5'GAATTAACGCCGAATCTCGAGCTCTCAATTTCCGAAATGAAC.

[0045] 2. Construct the cry1ab gene expression binary vector 1300-p35S-cry1ab-TOsHSP18.1

[0046] Using the 1300 vector as a template and 1300-F1 / R1 as primers, the 1300 vector fragment was amplified by PCR. Using the cry1ab gene nucleotide sequence (SEQ ID NO.4) as a template and 1ab-F1 / R1 as primers, the cry1ab gene fragment was amplified by PCR. Using the DNA sequence cloned in Example 1 (SEQ ID NO.1) as a template and TOs18.1-F2 / R2 as primers, the TOsHSP18.1 terminator fragment was amplified by PCR.

[0047] Using recombinase (MonClone Biotechnology) TM Hi-Fusion Cloning Mix V2) homologously recombines the above three fragments to obtain the binary vector 1300-P35S-cry1ab-TOsHSP18.1, which is the T-DNA plasmid.

[0048] 1300-F1:5'GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG;

[0049] 1300-R1:5'CTCGAGATTCGGCGTTAATTCAGTACATAAAAACGTC;

[0050] 1ab-F1:5'AAATCTATCCTGGACCACCATGGACAACAACCCGAACATCAAC;

[0051] 1ab-R1:5'GAAGTTTCTTATCACTCGTCGGAGAGGCACTCCACGAGGTTGGAC;

[0052] TOs18.1-F2:5'GACGAGTGATAAGAAACTTCGGGTGTGACATGCACGGTGGAG;

[0053] TOs18.1-R2:5'GAATTAACGCCGAATCTCGAGCTCTCAATTTCCGAAATGAAC.

[0054] 3. Construct the binary vector 1300-p35S-cp4-Tnos for cp4 gene expression.

[0055] Using the 1300 vector as a template and 1300-F1 / R1 as primers, the 1300 vector fragment was amplified by PCR. Using the cp4 gene nucleotide sequence (SEQ ID NO.2) as a template and cp4-F2 / R2 as primers, the cp4 gene fragment was amplified by PCR. Using the Tnos terminator nucleotide sequence (shown in SEQ ID NO.3) as a template and nosF1 / R1 as primers, the Tnos terminator fragment was amplified by PCR.

[0056] Using recombinase (MonClone Biotechnology) TM Hi-Fusion Cloning Mix V2) homologously recombines the above three fragments to obtain the binary vector 1300-P35S-cp4-Tnos.

[0057] 1300-F1:5'GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG;

[0058] 1300-R1:5'CTCGAGATTCGGCGTTAATTCAGTACATAAAAACGTC;

[0059] cp4-F2:5'AAATCTATCTCTGGACCACCATGGCGGCGACATGGCGTCC;

[0060] cp4-R2:5'GTTTGAACGATCGGGTTATCAAGCGGCCTTCGTGTCAGACAGTTC;

[0061] nosF1:5'GCTTGATAACCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAG;

[0062] nosR1:5'GAATTAACGCCGAATCTCGAGATCTAGTAACATAGATGACACCGC

[0063] 4. Construct the binary vector 1300-p35S-cry1ab-Tnos for cry1ab gene expression.

[0064] Using the 1300 vector as a template and 1300-F1 / R1 as primers, the 1300 vector fragment was amplified by PCR. Using the cry1ab gene nucleotide sequence (SEQ ID NO.4) as a template and 1ab–F2 / R2 as primers, the cry1ab gene fragment was amplified by PCR. Using the Tnos terminator (shown in SEQ ID NO.3) nucleotide sequence as a template and nosF2 / R2 as primers, the Tnos terminator fragment was amplified by PCR.

[0065] Using recombinase (MonClone Biotechnology) TM Hi-Fusion Cloning Mix V2) homologously recombines the above three fragments to obtain the binary vector 1300-P35S-cry1ab-Tnos, which is the control T-DNA plasmid.

[0066] 1300-F1:5'GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG;

[0067] 1300-R1:5'CTCGAGATTCGGCGTTAATTCAGTACATAAAAACGTC;

[0068] 1ab-F2:5'AAATCTATCCTGGACCACCATGGACAACAACCCGAACATCAAC;

[0069] 1ab-R2:5'GTTTGAACGATCGGGTTATCACTCGTCGGAGAGGCACTCCACGAG;

[0070] nosF2:5'GATAACCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTG;

[0071] nosR2:5'GAATTAACGCCGAATCTCGAGATCTAGTAACATAGATGACACCGC.

[0072] 5. Transformation of Agrobacterium

[0073] Finally, the four T-DNA plasmids were transformed into Agrobacterium EHA105 by electroporation. Positive clones were selected using YEP solid medium containing 15 μg / mL tetracycline and 50 μg / mL kanamycin, yielding single clones 1300-P35S-cp4-TOsHSP18.1, 1300-P35S-cry1ab-TOsHSP18.1, and...

[0074] 1300-P35S-cp4-Tnos and 1300-P35S-cry1ab-Tnos were used to preserve the bacteria for subsequent plant transformation.

[0075] Example 3: Transient expression analysis of tobacco

[0076] Single clones of 1300-P35S-cp4-TOsHSP18.1, 1300-P35S-cry1ab-TOsHSP18.1, 1300-P35S-cp4-Tnos, and 1300-P35S-cry1ab-Tnos obtained in Example 2 were respectively placed in 5 ml of LB broth containing 100 μg / mL tetracycline and 50 μg / mL kanamycin, and cultured overnight at 28–30°C with shaking. 1 mL of the overnight Agrobacterium culture was transferred to 25 mL of LB broth containing 100 μg / mL tetracycline + 50 μg / mL kanamycin + 150 μmol / L sterile acetosyringone, and cultured overnight at 28–30°C. The OD600 value of the bacterial culture was measured. Centrifuge at 5000g for 15 minutes, collect the bacterial cells and resuspend them in a resuspension solution (0.2mM AS (acetylsyl syringone), 10mM MgCl2, pH 5.6 (adjusted with KOH) 10mM MES solution) until the OD600 is 0.4, which is the infection solution.

[0077] After the infection solution has been left at room temperature for 2–3 hours, it is loaded into a 5 mL syringe. Using the thumb, the syringe blade is pressed to inject the liquid into the tobacco leaf from the lower epidermis (do not use the cotyledons). The tobacco leaf will appear moist after injection. Two days later, leaves infected with the same mass of different infection solutions are used to detect the expression levels of the target proteins cp4 or cry1ab.

[0078] Method for checking the expression level of cp4 gene in tobacco: Take 0.1g of leaves, cut them into pieces, add 1-1.5mL of PBS, then add them to a homogenizer and grind them. Then strictly follow the instructions of the CP4 EPSPS transgenic detection kit (AP010 EnviroLogix). Specifically, dilute the sample extract 500 times with 1×PBS. Use the same tissue extract of non-transgenic rice plants with the same dilution as a control to detect the background signal generated by the test tissue. Each microplate contains a known concentration of CP4 standard produced by microorganisms (Liu SP et al. 2012. Journal of Agricultural Science and Technology. 14(1):97-103) to generate a standard curve (curve equation is Y=1.794X+0.605). Each microplate contains a blank buffer to detect the background signal of the extraction buffer. Envirologix QualiPlate TM The ELISA kit (catalog number AP010) was used to detect CP4 levels. Samples, controls, and standards were added to the microplate and incubated at room temperature for 30 minutes. Then, the plates were washed, and antibody conjugated solution was added to each plate, incubating for 30 minutes at room temperature. After antibody conjugation incubation, the plates were washed. The substrate solution was added to the plates and incubated for 30 minutes at room temperature. After incubation, the reaction stop solution was added to the plates, and the OD values ​​were read at 450 nm. The results were then converted to expression levels according to the standard curve equation (Table 1).

[0079] Table 1. Average content of cp4 gene in different tobacco leaves (μg / g±SD)

[0080]

[0081] Note: The mean fresh weight, standard deviation, and range of measurements are based on all readings for each tissue type (n = 10 different leaves). A Student's t-test was performed on the means for each group; different letters indicate a significant difference between the two groups (p < 0.05).

[0082] As shown in Table 1, the average expression level of the cp4 gene in leaves of vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of vector 1300-P35S-cp4-Tnos. This indicates that, compared to the commonly used Tnos terminator, the TOsHSP18.1 terminator can significantly increase the expression level of the target protein CP4 in transient tobacco expression.

[0083] Method for detecting cry1ab gene expression in tobacco: Take 0.1g of leaves, cut them into pieces, add 1-1.5mL of PBS, and then homogenize them in a homogenizer. Next, strictly follow the instructions for the Cry1Ab / Ac enzyme-linked immunosorbent assay kit (AA0342 Shanghai Youlong). Specifically, dilute the sample extract 500 times with 1×PBS. Use an extract from the same tissue of a non-transgenic rice plant containing the same dilution as a control to detect background signals generated by the test tissue. Each ELISA plate contains a known concentration of Cry1Ab standard produced by microorganisms to generate a standard curve (curve equation: Y = 1.302X + 0.163). Each ELISA plate contains blank buffer to detect background signals from the extraction buffer. Add the sample, control, and standard to the ELISA plate and incubate at room temperature for 30 minutes. Then, wash the ELISA plate, add the antibody conjugated solution to each ELISA plate, and incubate at room temperature for 30 minutes. After antibody conjugation incubation, wash the ELISA plate. Add the substrate solution to the microplate and incubate at room temperature for 30 minutes. After incubation, add the reaction stop solution to the microplate and read the OD value at a wavelength of 450 nm. Then, convert the OD value to the expression level according to the standard curve equation (Table 2).

[0084] Table 2. Average content of cry1ab gene in different tobacco leaves (μg / g±SD)

[0085]

[0086] Note: The mean fresh weight, standard deviation, and range of measurements are based on all readings for each tissue type (n = 10 different leaves). A Student's t-test was performed on the means for each group; different letters indicate a significant difference between the two groups (p < 0.05).

[0087] As shown in Table 2, the average expression level of the cry1ab gene in leaves of vector 1300-P35S-cry1ab-TOsHSP18.1 was significantly higher than that of vector 1300-P35S-cry1ab-Tnos. This indicates that, compared to the commonly used Tnos terminator, the TOsHSP18.1 terminator can significantly increase the expression level of the target protein Cry1Ab in transient tobacco expression.

[0088] Example 4: Agrobacterium-mediated maize transformation analysis

[0089] Transformation technology for maize is relatively mature. References include: Vladimir Sidorov & David Duncan (in M. Paul Scott (ed.), Methods in Molecular Biology: Transgenic Maize, vol: 526; Yuji Ishida, Yukoh Hiei & Toshihiko Komari (2007) Agrobacterium-mediated transformation of maize. Nature Protocols 2: 1614-1622. The basic method is as follows: Take Hi-II maize ears 8-10 days after pollination and collect all immature embryos (1.0-1.5 mm in size). The inoculum containing T-DNA vectors (1300-P35S-cp4-TOsHSP18.1 and 1300-P35S-cp4-Tnos) prepared in Example 3 is co-cultured with the immature embryos on MS medium (MS + 2 mg / L 2,4-D + 30 g / L sucrose + 3 g / L agar (sigma)). Co-cultured with 7921) + 40 mg / L acetylsyleugenol for 2-3 days (22℃). Immature embryos were transferred to callus induction medium (MS + 2 mg / L 2,4-D + 30 g / L sucrose + 2.5 g / L gelrite + 5 mg / L AgNO3 + 200 mg / L acetylsyleugenol) and cultured in the dark at 28℃ for 10-14 days. All calluses were transferred to selection medium (same as callus induction medium) containing 2 mM glyphosate and cultured in the dark at 28℃ for 2-3 weeks. All tissues were transferred to fresh selection medium containing 2 mM glyphosate and cultured in the dark at 28℃ for 2-3 weeks. Then, all viable embryogenic tissues after selection were transferred to regeneration medium (MS + 30 g / L sucrose + 0.5 mg / L 6-furfurylaminopurine (kinetin) + 2.5 g / L... Incubate the cells on gelrite (200 mg / L acetylsyleugenol) at 28°C in the dark for 10-14 days, one line per plate. Then transfer the embryogenic tissue to fresh regeneration medium and incubate at 26°C under light for 10-14 days. Transfer all fully developed plants to rooting medium (1 / 2 MS + 20 g / L sucrose + 2.5 g / L gelrite + 200 mg / L acetylsyleugenol) and incubate at 26°C under light until roots are fully developed. Transgenic maize plants containing the transformation vectors 1300-P35S-cp4-TOsHSP18.1 and 1300-P35S-cp4-Tnos were obtained.

[0090] Referring to the examination method in Example 3, the expression level of the cp4 gene in the leaves of the transgenic maize lines obtained by the above method at the 4-5 leaf stage and the early fruiting stage was detected.

[0091] Table 3: Average cp4 content (μg / g±SD) in different maize tissues

[0092]

[0093] Note: The mean fresh weight, standard deviation, and range of measurements are based on all readings for each tissue type (n = 10 different strains). A Student's t-test was performed on the means for each group; different letters indicate a significant difference between the two groups (p < 0.05).

[0094] As shown in Table 3, the average expression level of the cp4 gene in the leaves of maize transformants using vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of maize transformants using vector 1300-P35S-cp4-Tnos. This indicates that the new terminator TOsHSP18.1 can significantly increase the expression level of the target protein cp4 in maize compared to the control terminator Tnos.

[0095] Example 5: Agrobacterium-mediated soybean transformation analysis

[0096] The steps used here to obtain transgenic soybeans are derived from existing techniques (Deng et al., 1998, Plant Physiology Communications 34:381-387; Ma et al., 2008, Scientia Agricultura Sinica 41:661-668; Zhou et al., 2001, Journal of Northeast Agricultural University 32:313-319). Healthy, plump, and mature soybeans were selected, disinfected with 80% ethanol for 2 minutes, rinsed with sterile water, and then sterilized in a desiccator filled with chlorine gas (generated by the reaction of 50 ml NaClO and 2 ml concentrated HCl) for 4-6 hours. After sterilization, the soybeans were sown into B5 medium in a laminar flow hood and cultured at 25°C for 5 days, with an optical density of 90-150 μmol photons / m². 2 Horizontal. When the cotyledons turn green and break through the seed coat, a sterile bean sprout will emerge. The bean sprout, with the hypocotyl removed, is cut in half lengthwise, so that both explants have cotyledons and epicotyls. The explant is cut at the node between the cotyledons and epicotyl, about 7-8 mm long, and can then be used as the target tissue for infection.

[0097] The prepared explants were immersed in a concoction solution containing the vectors 1300-P35S-cp4-TOsHSP18.1 and 1300-P35S-cp4-Tnos, prepared as described in Example 3, and co-cultured at 26°C for 30 minutes. Then, excess concoction solution was absorbed from the infected tissues with absorbent paper, and the tissues were transferred to 1 / 10 B5 co-culture medium and incubated in the dark at 25°C for 3-5 days. The co-cultured plant tissues were washed with B5 liquid medium to remove excess Agrobacterium, and then placed in B5 solid medium and cultured at 25°C for 5 days until germination. The induced plumule tissues were transferred to B5 selection medium containing 0.1-0.5 mM glyphosate and cultured under light at 25°C for 4 weeks, changing the medium every two weeks. The selected plumule tissues were then transferred to B5 solid medium and cultured at 25°C until they grew into seedlings. Subsequently, the transgenic seedlings were transferred to 1 / 2 B5 medium for root induction. Finally, the grown seedlings are washed to remove the agar and then planted in a greenhouse.

[0098] Referring to the examination method in Example 3, the expression level of the cp4 gene in the V2 stage leaves of the transgenic soybean lines obtained by the above method was detected.

[0099] Table 4: Average cp4 content (μg / g±SD) in different soybean tissues

[0100]

[0101] Note: The mean fresh weight, standard deviation, and range of measurements are based on all readings for each tissue type (n = 10 different strains). A Student's t-test was performed on the means for each group; different letters indicate a significant difference between the two groups (p < 0.05).

[0102] As shown in Table 4, the average expression level of the cp4 gene in the leaves of soybean transformants using vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of soybean transformants using vector 1300-P35S-cp4-Tnos. This indicates that the new terminator TOsHSP18.1 can significantly increase the expression level of the target protein cp4 in soybean compared to the control terminator Tnos.

[0103] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention. sequence list <110> Hangzhou Fangyun Biotechnology Co., Ltd. <120> A DNA sequence, expression vector and its application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 319 <212> DNA <213> Unknown <400> 1 taagaaactt cgggtgtgac atgcacggtg gagagcttcg attcgagcct tcggtttgtg 60 atcaattgca gtaaataaaa gcgtcaaatc tggtcctcag tgtttatgct gtgaaaaagt 120 tcaaagctat gttggaagtg agcaataaag acttttcttg ttttgtgaac gaacctgaga 180 ttatactagt cctacacttg tttgtttaat ctaatctccg gtatattctg ccatttttat 240 ctcgatgttt cagtactttt agcctttggt tcttgaatcc ttctgtcgag actggagagt 300 tcatttcgga aattgagag 319 <210> 2 <211> 1846 <212> DNA <213> Unknown <400> 2 atggcggcga ccatggcgtc caacgctgcg gctgcggctg cggtgtccct ggaccaggcc 60 gtggctgcgt cggcagcgtt ctcgtcgcgg aagcagctgc ggctgcctgc cgcagcgcgc 120 ggagggatgc gggtgcgggt gcgggcgcgg ggtcggcggg aggcggtggt ggtggcgtcc 180 gcgtcgtcgt cgtcggtggc agcgccggcg gcgaaggctg agatgctaca cggtgcaagc 240 agccggccgg caaccgctcg caaatcttcc ggcctttcgg gaacggtcag gattccgggc 300 gataagtcca tatcccaccg gtcgttcatg ttcggcggtc ttgccagcgg tgagacgcgc 360 atcacgggcc tgcttgaagg tgaggacgtg atcaataccg ggaaggccat gcaggctatg 420 ggagcgcgta tccgcaagga aggtgacaca tggatcattg acggcgttgg gaatggcggt 480 ctgctcgccc ctgaggcccc tctcgacttc ggcaatgcgg cgacgggctg caggctcact 540 atgggactgg tcggggtgta cgacttcgat agcacgttca tcggagacgc ctcgctcaca 600 aagcgcccaa tgggccgcgt tctgaacccg ttgcgcgaga tgggcgtaca ggtcaaatcc 660 gaggatggtg accgtttgcc cgttacgctg cgcgggccga agacgcctac cccgattacc 720 taccgcgtgc caatggcatc cgcccaggtc aagtcagccg tgctcctcgc cggactgaac 780 actccgggca tcaccacggt gatcgagccc atcatgacca gggatcatac cgaaaagatg 840 cttcaggggt ttggcgccaa cctgacggtc gagacggacg ctgacggcgt caggaccatc 900 cgccttgagg gcaggggtaa actgactggc caagtcatcg atgttccggg agacccgtcg 960 tccacggcct tcccgttggt tgcggcgctg ctcgtgccgg ggagtgacgt gaccatcctg 1020 aacgtcctca tgaacccgac caggaccggc ctgatcctca cgcttcagga gatgggagcc 1080 gacatcgagg tgatcaaccc gcgcctggca ggcggtgaag acgttgcgga tctgcgcgtg 1140 cgctcctcta ccctgaaggg cgtgacggtc ccggaagatc gcgcgccgtc catgatagac 1200 gagtatccta ttctggccgt cgccgctgcg ttcgccgaag gggccacggt catgaacggt 1260 cttgaggaac tccgcgtgaa ggaatcggat cgcctgtcgg cggtggccaa tggcctgaag 1320 ctcaacggtg ttgactgcga cgagggtgag acctcactcg tggtccgtgg ccggcctgat 1380 ggcaagggcc tcggcaacgc cagtggagcg gccgtcgcca cgcacctcga tcatcgcatc 1440 gcgatgtcct tcttggtgat gggtctcgtc tcagagaacc cggtgaccgt cgatgacgcc 1500 acgatgatag cgacgagctt cccagagttc atggatctga tggcgggcct cggggccaag 1560 atcgaactgt ctgacacgaa ggccgcttga cccgatcgtt caaacatttg gcaataaagt 1620 ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 1680 tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 1740 atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 1800 aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 1846 <210> 3 <211> 256 <212> DNA <213> Unknown <400> 3 cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 60 gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 120 tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 180 tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 240 tctatgttac tagatc 256 <210> 4 <211> 1974 <212> DNA <213> Unknown <400> 4 atggacaaca acccgaacat caacgagtgc atcccgtaca actgcctctc caacccggag 60 gtggaggtgc tcggcggcga gcgcatcgag accggctaca ccccgatcga catctccctc 120 tccctcaccc agttcctcct ctccgagttc gtgccgggcg ccggcttcgt gctcggcctc 180 gtggacatca tctggggcat cttcggcccg tcccagtggg acgccttcct cgtgcagatc 240 gagcagctca tcaaccagcg catcgaggag ttcgcccgca accaggccat ctcccgcctg 300 gagggcctct ccaacctcta ccagatctac gccgagtcct tccgcgagtg ggaggccgac 360 ccgaccaacc cggccctccg cgaggagatg cgcatccagt tcaacgacat gaactccgcc 420 ctcaccaccg ccatcccgct cttcgccgtg cagaactacc aggtgccgct cctctccgtg 480 tacgtgcagg ccgccaacct ccacctctcc gtgctccgcg acgtgtccgt gttcggccag 540 cgctggggct tcgacgccgc caccatcaac tcccgctaca acgacctcac ccgcctcatc 600 ggcaactaca ccgaccacgc cgtgcgctgg tacaacaccg gcctggagcg cgtgtggggc 660 ccggactccc gcgactggat caggtacaac cagttccgcc gcgagctcac cctcaccgtg 720 ctcgacatcg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780 tcccagctca cccgcgagat ctacaccaac ccggtgctgg agaacttcga cggctccttc 840 cgcggctccg cccagggcat cgagggctcc atccgctccc cgcacctcat ggacatcctc 900 aactccatca ccatctacac cgacgcccac cgcggcgagt actactggtc cggccaccag 960 atcatggcct ccccggtggg cttctccggc ccggagttca ccttcccgct ctacggcacg 1020 atgggcaacg ccgccccgca gcagcgcatc gtggcccagc tcggccaggg cgtgtaccgc 1080 accctctcct ccaccctcta ccgccgcccg ttcaacatcg gcatcaacaa ccagcagctc 1140 tccgtgctcg acggcaccga gttcgcctac ggcacctcct ccaacctccc gtccgccgtg 1200 taccgcaagt ccggcaccgt ggactccctc gacgagatcc cgccgcagaa caacaacgtg 1260 ccgccgcgcc agggcttctc ccaccgcctc tcccacgtgt ccatgttccg ctccggcttc 1320 tccaactcct ccgtgtccat catccgcgcc ccgatgttct cctggattca ccgctccgcc 1380 gagttcaaca acatcatccc gtcctcccag atcacccaga tcccgctcac caagtccacc 1440 aacctcggct ccggcacctc cgtggtgaag ggcccgggct tcaccggcgg cgacatcctc 1500 cgccgcacct ccccgggcca gatctccacc ctccgcgtga acatcaccgc cccgctctcc 1560 cagcgctacc gcgtgcgcat ccgctacgcc tccaccacca acctccagtt ccacacctcc 1620 atcgacggcc gcccgatcaa ccagggcaac ttctccgcca ccatgtcctc cggctccaac 1680 ctccagtccg gctccttccg caccgtgggc ttcaccaccc cgttcaactt ctccaacggc 1740 tcctccgtgt tcaccctctc cgcccacgtg ttcaactccg gcaacgaggt gtacatcgac 1800 cgcatcgagt tcgtgccggc cgaggtgacc ttcgaggccg agtacgacct ggagcgcgcc 1860 cagaaggccg tgaacgagct cttcacctcc tccaaccaga tcggcctcaa gaccgacgtg 1920 accgactacc acatcgacca ggtgtccaac ctcgtggagt gcctctccga cgag 1974

Claims

1. A DNA, characterized in that, The DNA nucleotide sequence is shown in SEQ ID NO.

1.

2. An expression vector containing the DNA of claim 1.

3. The expression vector as described in claim 2, characterized in that, The expression vector includes a target gene and the DNA; the expression vector uses pCambia1300 as the base vector, and the DNA is linked to the 3' end of the target gene.

4. A plant cell comprising the expression vector of claim 2.

5. The application of the DNA of claim 1 as a terminator in improving the expression efficiency of a target gene in plants, characterized in that, The target gene is the glyphosate resistance gene cp4 or the insect-resistant gene cry1Ab, and the plant is tobacco, corn, or soybean.

6. The application as described in claim 5, characterized in that, The application involves using DNA as a terminator to construct an expression vector containing the target gene, then transforming the expression vector into the cells or tissues of a plant host, and finally cultivating the transformed tissue into a plant to improve the expression efficiency of the target gene.

Images