Extracellular vesicle delivery platform for loading proteins or polypeptides and applications thereof

Abstract

The application belongs to the field of drug delivery, and particularly relates to an extracellular vesicle delivery platform loaded with a target protein or polypeptide and application thereof. The application provides a plasmid combination for preparing an extracellular vesicle loaded with a target protein or polypeptide, wherein the plasmid combination comprises a pCAG-GOI plasmid and a pMD2.G plasmid; the GOI refers to a gene sequence corresponding to the target protein or polypeptide. The extracellular vesicle delivery platform loaded with the protein or polypeptide provided by the application can realize efficient loading of the target protein or polypeptide in the extracellular vesicle by double-plasmid co-transfecting cells, and further promotes the treatment effect of EVs as a carrier to deliver the target substances such as proteins or polypeptides into the clinic. With the good structural stability of EVs itself, the innate advantages of transporting bioactive substances and excellent biocompatibility, the systemic toxic side effects caused by traditional delivery carriers are reduced.

Description

Technical Field

[0001] This invention belongs to the field of drug delivery, specifically relating to extracellular vesicle delivery platforms for loading target proteins or peptides and their applications. Background Technology

[0002] Protein therapy refers to the regulation of cellular biological functions and the treatment of diseases based on exogenous proteins or peptides and other biomolecules. Compared to gene / chemotherapy, protein therapy does not cause permanent genetic alterations or serious adverse reactions. Due to the unique properties of proteins, such as large size, hydrophilicity, membrane impermeability, and easy degradation, currently approved protein drug targets are limited to ligands in the extracellular environment or disease targets on the cell surface. However, approximately 70% of human proteins are intracellular proteins.

[0003] Current intracellular protein delivery systems typically rely on cationic liposomes, polymers, and inorganic nanomaterials as protein encapsulation carriers. However, nanocarriers (liposomes, polymers, nanomaterials, etc.) often require covalent modification of proteins, resulting in low efficiency in protein loading and lysosomal escape. Achieving efficient intracellular protein delivery remains a challenge. Therefore, there is an urgent need to develop stable delivery systems that efficiently deliver target proteins to target cells and enable them to function under biological conditions.

[0004] Extracellular vesicles (EVs) are a class of naturally occurring nanoscale particles with a double-membrane structure, actively secreted by cells, and a diameter of 30–200 nm (exosomes) or <1000 nm (microvesicles). As important cell communication carriers, EVs participate in processes such as immune regulation, inflammation, tumorigenesis, metabolic disorders, and angiogenesis, playing a crucial regulatory role in physiological and pathological processes. Due to their excellent structural stability, inherent advantages in transporting bioactive substances, and superior biocompatibility, EVs have attracted considerable attention as potential delivery carriers. By artificially loading functional proteins, nucleic acids, and small molecule drugs, combined with targeted modification strategies to endow them with cell and tissue-specific targeting, drug delivery efficiency can be improved, dosing frequency reduced, and side effects lessened, showing great promise in fields such as immunotherapy and drug delivery. However, achieving the required concentrations, stability, safety, and biocompatibility levels for therapeutic use in engineered EVs still faces numerous challenges. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] The technical problem to be solved by this invention is how to use an engineered extracellular vesicle delivery platform to obtain an intracellular extracellular vesicle delivery system that efficiently carries biologically active proteins or peptides.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, in one embodiment of the present invention, a plasmid combination for preparing extracellular vesicles loaded with a target protein or polypeptide is provided, the plasmid combination comprising the pCAG-GOI (gene of interest) plasmid and the pMD2.G plasmid; wherein the GOI refers to the gene sequence corresponding to the target protein or polypeptide. In one embodiment, the protein comprises an intracellular protein.

[0009] In one embodiment, the pCAG-GOI plasmid is selected from pCAG-cGAS and / or pCAG-Cre.

[0010] In one embodiment, the present invention provides cells for preparing extracellular vesicles, said cells being transfected with the plasmid combination described above for preparing extracellular vesicles loaded with a target protein or polypeptide. The cells do not include human embryonic stem cells, nor do they include human cells at any stage of formation and development, such as human germ cells, fertilized eggs, or embryos. The cells include any cells capable of producing extracellular vesicles loaded with a target drug.

[0011] In one embodiment, the cells are selected from HEK293F cells.

[0012] In one embodiment, the present invention provides an extracellular vesicle comprising cGAS and / or Cre protein; preferably, the extracellular vesicle is prepared by transfecting cells with the plasmid combination described above for preparing extracellular vesicles loaded with a target protein or polypeptide.

[0013] In one embodiment, the present invention provides the use of the extracellular vesicles in the preparation of a cancer treatment drug.

[0014] In one embodiment, the present invention provides the use of the extracellular vesicles and immune checkpoint inhibitors and / or immune checkpoint antagonists in the preparation of a cancer treatment drug.

[0015] In one embodiment, the immune checkpoints include CTLA-4, PD-1, PD-L1, IDO-1, TIM-3, LAG-3, KIR, GITR, VISTA, 4-1BB, OX40, B7-H3, and CD27. The inhibitors and / or antagonists include small molecule compounds or antibodies.

[0016] In one embodiment, the cancer is selected from colon cancer and melanoma.

[0017] In one embodiment, the present invention provides a method for loading a target protein or polypeptide into extracellular vesicles, the method comprising transfecting the plasmid combination described above for preparing extracellular vesicles loaded with the target protein or polypeptide into cells for expression.

[0018] In one embodiment, the method includes: (1) transfecting the plasmid combination into cells for a period of time, collecting the culture supernatant, and storing it at low temperature; and (2) separating extracellular vesicles (EVs) from the collected culture supernatant.

[0019] In one embodiment, the plasmid combination includes the pCAG-GOI (gene of interest) plasmid and the pMD2.G plasmid; the GOI refers to the gene sequence corresponding to the target protein or polypeptide.

[0020] In one embodiment, the time period is the fourth day after transfection when the culture supernatant is collected. The cryopreservation is long-term storage at -80°C. Preferably, the separation of extracellular vesicles includes separating EVs from the collected culture supernatant using ultracentrifugation.

[0021] In one embodiment, the detailed rotation speed and time of the ultracentrifugation method include: centrifuging the culture supernatant at 300g for 10 min, collecting the supernatant into a new centrifuge tube, and continuing to centrifuge at 2000g for 10 min, collecting the supernatant into a new centrifuge tube, and continuing to centrifuge at 100000g for 70 min, discarding the supernatant, adding sufficient sterile PBS to the precipitate, continuing to wash the extracellular vesicles at 100000g for 70 min, and finally resuspending the above extracellular vesicles with PBS and storing them at -80℃ for long-term storage.

[0022] In one embodiment, the cells are selected from HEK293F cells.

[0023] In one embodiment, the present invention provides an extracellular vesicle prepared by any of the methods described above.

[0024] In one embodiment, the sequence of the pMD2.G plasmid is shown in SEQ ID NO.1; the sequence of the pCAG plasmid is shown in SEQ ID NO.2. In this invention, pMD2.G is also referred to as VSV-G.

[0025] (III) Beneficial Effects

[0026] This invention provides an extracellular vesicle delivery platform for loading proteins or peptides. By using dual plasmid co-transfection of cells, the target protein or peptide can be efficiently loaded into extracellular vesicles, further promoting the clinical application of EVs as carriers to deliver target substances such as proteins or peptides for therapeutic purposes. Due to the inherent structural stability, transport advantages of bioactive substances, and excellent biocompatibility of EVs, the systemic toxicity of traditional delivery carriers is reduced. In particular, the extracellular vesicle delivery platform enables the efficient delivery of intracellular proteins within the patient's body. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Western blot analysis of Cre protein expression;

[0029] Figure 2 The efficiency of engineered extracellular vesicle delivery of Cre protein, i.e., the percentage of GFP+ cells;

[0030] Figure 3 Structures of each group of EVs under a transmission electron microscope;

[0031] Figure 4 Nanoparticle tracking and analysis instrument detects the particle size distribution of extracellular vesicles;

[0032] Figure 5 Nanoparticle tracking and analysis instrument detects the particle concentration of extracellular vesicles;

[0033] Figure 6 Western blot analysis of EV marker protein expression;

[0034] Figure 7 Western blot analysis of cGAS protein expression;

[0035] Figure 8 Extracellular vesicles loaded with cGAS protein efficiently induce IFN expression;

[0036] Figure 9 Extracellular vesicles loaded with cGAS protein enhance the expression of various inflammatory factors in immune cells;

[0037] Figure 10 Extracellular vesicles loaded with cGAS protein were used to treat tumor volume of colon cancer in mice.

[0038] Figure 11 Extracellular vesicles loaded with cGAS protein were used to treat tumor volume of melanoma in mice.

[0039] Figure 12 H&E staining, safety testing;

[0040] Figure 13 Extracellular vesicles loaded with cGAS protein, combined with immune checkpoint inhibitors, were used to treat tumor volume in mice with colon cancer.

[0041] Figure 14 Survival time of mice with colon cancer treated with extracellular vesicles loaded with cGAS protein in combination with immune checkpoint inhibitors. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] The following detailed description uses specific examples.

[0044] The instruments, reagents, and materials used in this invention are all well-known to those skilled in the art and can be purchased commercially. The methods used in this invention, such as transmission electron microscopy and Western blot, are well-known in the art and can be described in textbooks or relevant literature; therefore, they will not be repeated here. Where described in this invention's specification, refer to the methods described in this invention.

[0045] In the embodiments, the sequence of the pMD2.G plasmid is shown in SEQ ID NO.1; the sequence of the CAG plasmid is shown in SEQ ID NO.2.

[0046] The sequence of SEQ ID NO.1 (pMD2.G plasmid) is shown below:

[0047] ATGAAGTGCCTTTTGTACTTAGCCTTTTTATTCATTGGGGTGAATTGCAAGTTCACCATAGTTTTTCCACACAACCAAAAAGGAAACTGGAAAAATGTTCCTTCTAATTACCATTATTGCCCGTCAAGCTCAGATTTAAATTGGCATAATGACTTAATAGGCACAGCCTTACAAGTCAAAATGCCCAAGAGTCACAAGGCTATTCAAGCAGACGGTTGGATGTGTCATGCTTCCAAATGGGTCACTACTTGTGATTTCCGCTGGTATGG

[0048] ACCGAAGTATATAACACATTCCATCCGATCCTTCACTCCATCTGTA

[0049] GAACAATGCAAGGAAAGCATTGAACAAACGAAACAAGGAACTT

[0050] GGCTGAATCCAGGCTTCCCTCCTCAAAGTTGTGGATATGCAACTG

[0051] TGACGGATGCCGAAGCAGTGATTGTCCAGGTGACTCCTCACCAT

[0052] GTGCTGGTTGATGAATACACAGGAGAATGGGTTGATTCACAGTTC

[0053] ATCAACGGAAAATGCAGCAATTACATATGCCCCACTGTCCATAAC

[0054] TCTACAACCTGGCATTCTGACTATAAGGTCAAAGGGCTATGTGAT

[0055] TCTAACCTCATTTCCATGGACATCACCTTCTTCTCAGAGGACGGA

[0056] GAGCTATCATCCCTGGGAAAGGAGGGCACAGGGTTCAGAAGTAA

[0057] CTACTTTGCTTATGAAACTGGAGGCAAGGCCTGCAAAATGCAATA

[0058] CTGCAAGCATTGGGGAGTCAGACTCCCATCAGGTGTCTGGTTCG

[0059] AGATGGCTGATAAGGATCTCTTTGCTGCAGCCAGATTCCCTGAAT

[0060] GCCCAGAAGGGTCAAGTATCTCTGCTCCATCTCAGACCTCAGTGG

[0061] ATGTAAGTCTAATTCAGGACGTTGAGAGGATCTTGGATTATTCCCT

[0062] CTGCCAAGAAACCTGGAGCAAAATCAGAGCGGGTCTTCCAATCT

[0063] CTCCAGTGGATCTCAGCTATCTTGCTCCTAAAAACCCAGGAACCG

[0064] GTCCTGCTTTCACCATAATCAATGGTACCCTAAAATACTTTGAGAC

[0065] CAGATACATCAGAGTCGATATTGCTGCTCCAATCCTCTCAAGAAT

[0066] GGTCGGAATGATCAGTGGAACTACCACAGAAAGGGAACTGTGGG

[0067] ATGACTGGGCACCATATGAAGACGTGGAAATTGGACCCAATGGA

[0068] GTTCTGAGGACCAGTTCAGGATATAAGTTTCCTTTATACATGATTG

[0069] GACATGGTATGTTGGACTCCGATCTTCATCTTAGCTCAAAGGCTC

[0070] AGGTGTTCGAACATCCTCACATTCAAGACGCTGCTTCGCAACTTC

[0071] CTGATGATGAGAGTTTATTTTTTGGTGATACTGGGCTATCCAAAAA

[0072] TCCAATCGAGCTTGTAGAAGGTTGGTTCAGTAGTTGGAAAAGCT

[0073] CTATTGCCTCTTTTTTCTTTATCATAGGGTTAATCATTGGACTATTC

[0074] TTGGTTCTCCGAGTTGGTATCCATCTTTGCATTAAATTAAAGCACA

[0075] CCAAGAAAAGACAGATTTATACAGACATAGAGATGAACCGACTT

[0076] GGAAAGTAA

[0077] The sequence of SEQ ID NO. 2 (CAG plasmid) is shown below:

[0078]

[0079] The sequence of SEQ ID NO. 3 (CMV plasmid) is shown below:

[0080] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0081] The sequence of SEQ ID NO. 4 (EF1α plasmid) is shown below:

[0082]

[0083] The sequence of SEQ ID NO.5 (PGK plasmid) is shown below:

[0084] GGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCT CTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGT AGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTTCCTCATCTCCGGGCCTTTCG

[0085] Example 1: Extraction and Identification of Extracellular Vesicles Loaded with Cre Protein

[0086] (1) Cell transfection and collection of culture supernatant

[0087] The culture system for HEK293F cells was Union 293 medium + 1X penicillin-streptomycin mixture. An appropriate amount of HEK293F cells were cultured in shake flasks, and transfection experiments were performed when the cell density reached 3 M / ml. Using PEI transfection reagent, different plasmids were transfected into HEK293F cells according to the instructions: CAG-Cre+VSV-G (co-transfection of pCAG-cre and pMD2.G), CMV-Cre+VSV-G (co-transfection of pCMV-Cre and pMD2.G), pEF1α-Cre+VSV-G (co-transfection of pEF1α-Cre and pMD2.G), and PGK-Cre+VSV-G (co-transfection of pPGK-Cre and pMD2.G). The culture supernatant was collected on day 4 post-transfection and stored at -80℃.

[0088] (2) Isolation of extracellular vesicles

[0089] Extracellular vesicles (EVs) were isolated from the collected culture supernatant using ultracentrifugation. The detailed speed and time of ultracentrifugation were as follows: the culture supernatant was centrifuged at 300g for 10 min, the supernatant was collected into a new centrifuge tube, and centrifuged again at 2000g for 10 min. The supernatant was collected into a new centrifuge tube, and centrifuged again at 100000g for 70 min. The supernatant was discarded, and sufficient sterile PBS was added to the pellet. The extracellular vesicles were washed again by centrifugation at 100000g for 70 min. Finally, the extracellular vesicles were resuspended in PBS and stored at -80℃ for long-term storage.

[0090] (3) Identification of extracellular vesicles

[0091] Western blot was used to detect the expression of the target protein Cre carried by extracellular vesicles in different groups. Figure 1 As shown, the above results indicate that extracellular vesicles prepared by co-transfection with different promoter plasmids and pMD2.G double plasmid can deliver target proteins. Among them, pCAG-GOI with pMD2.G double plasmid has the best effect. For example, extracellular vesicles prepared by co-transfection with pCAG-Cre with pMD2.G double plasmid can efficiently deliver Cre protein.

[0092] Example 2: Application of extracellular vesicles loaded with Cre protein

[0093] (1) Cell transfection and collection of culture supernatant were mainly the same as in Example 1. The addition compared to Example 1 was that PEI transfection reagent was used to transfect different plasmids into HEK293F cells according to the instructions, namely VSVG (transfecting only pMD.2G plasmid), CAG-Cre (transfecting only pCAG-Cre plasmid), CMV-Cre (transfecting only pCMV-Cre plasmid), EF1α-Cre (transfecting only pEF1α-Cre plasmid), and PGK-Cre (transfecting only pPGK-Cre plasmid). The culture supernatant was collected on the 4th day after transfection and stored at -80℃.

[0094] (2) Isolation of extracellular vesicles, same as in Example 1.

[0095] (3) Applications of extracellular vesicles:

[0096] The Cre-LoxP reporter gene system was used to evaluate the efficiency of extracellular vesicles (EVs) generating Cre protein delivery in different transfection systems. First, different combinations of target plasmids were transfected into 293F cells. Extracellular vesicles were collected and purified, and then added to reporter cell lines with a "LoxP-Stop-LoxP-GFP" structure. The efficiency of Cre protein delivery by engineered EVs, i.e., the proportion of GFP+ cells, was then detected by flow cytometry (if an EV successfully delivers Cre protein into the reporter cell line, it cleaves the LoxP site, causing the reporter cell line to express GFP fluorescence). The NC group served as a negative control group without EVs. Figure 2 As shown, the results indicate that the extravesicles prepared by co-transfection of pCAG-Cre with pMD2.G have the highest delivery efficiency.

[0097] Example 3: Extraction and Identification of Extracellular Vesicles Loaded with cGAS Protein

[0098] (1) Cell transfection and collection of culture supernatant

[0099] The culture system for HEK293F cells was Union 293 medium + penicillin-streptomycin mixture. An appropriate amount of HEK293F cells were seeded and cultured in a shaker. Transfection experiments were performed when the cell density reached 3 M / ml. Using PEI transfection reagent, different plasmids were transfected into HEK293F cells according to the instructions: native EVs (no transfection), CtrlEVs (transfected only with pCAG-cGAS plasmid), and cGAS EVs (co-transfected with pCAG-cGAS and pMD2.G plasmids). The culture supernatant was collected on day 4 post-transfection and stored at -80℃ for long-term preservation.

[0100] (2) Isolation of extracellular vesicles

[0101] Extracellular vesicles (EVs) were isolated from the collected culture supernatant using ultracentrifugation. The detailed speed and time of ultracentrifugation were as follows: the culture supernatant was centrifuged at 300g for 10 min, the supernatant was collected into a new centrifuge tube, and centrifuged again at 2000g for 10 min. The supernatant was collected into a new centrifuge tube, and centrifuged again at 100000g for 70 min. The supernatant was discarded, and sufficient sterile PBS was added to the pellet. The extracellular vesicles were washed again by centrifugation at 100000g for 70 min. Finally, the extracellular vesicles were resuspended in PBS and stored at -80℃ for long-term storage.

[0102] (3) Identification of extracellular vesicles

[0103] The isolated extracellular vesicles were examined using transmission electron microscopy, such as... Figure 3As shown, the isolated extracellular vesicles all exhibited a biconcave disc shape and a size ≤200 nm. These results are consistent with literature reports.

[0104] The particle size distribution and concentration of extracellular vesicles were detected using a nanoparticle tracking analyzer, such as... Figure 4 , 5 As shown, the collected extracellular vesicles have a particle size distribution in the range of 50-200 nm. These results are consistent with previous literature reports.

[0105] Western blot was used to detect the expression of positive marker proteins (including Alix, TSG101, and CD63) and negative marker proteins (Calnexin) in extracellular vesicles. Figure 6 As shown, the collected extracellular vesicles all expressed Alix, TSG101, and CD63, but not Calnexin. These results are consistent with previous literature reports.

[0106] The expression of the target protein cGAS in extracellular vesicles was detected using Western blot. Figure 7 As shown, only the extracellular vesicles collected by double plasmid co-transfection expressed cGAS protein.

[0107] Example 4: In vitro functional identification of extracellular vesicles loaded with cGAS protein (cGAS EVs)

[0108] THP1-Lucia TM ISG cells are a commonly used reporter cell line for examining IFN expression levels; fluorescence is detected when the cGAS-STING-IFN signaling pathway is activated. THP-1 cells were seeded in 96-well plates, and cGAMP (positive control), 10 μL of Native EVs, 10 μL of Ctrl EVs, and cGAS EVs were added, with cGAS EVs at concentrations of 1, 2, 5, and 10 μL respectively. After incubation for 4 hours, luciferin substrate was added to each well, and OD values ​​were measured. Figure 8 As shown, the results indicate that cGAS EVs can activate the cGAS-STING-IFN signaling pathway and significantly increase the expression level of IFN in a dose-dependent manner.

[0109] Human monocytes (THP-1) were seeded in 24-well plates, and cGAMP (positive control), 10 μL of CtrlEVs, and 10 μL of cGASEVs were added respectively. After incubation for 4 hours, RNA from each group was collected and analyzed by qRT-PCR. Figure 9 As shown, the results indicate that cGAS EVs can significantly increase the gene expression levels of various inflammatory factors.

[0110] Example 5: Extracellular vesicles loaded with cGAS protein (cGAS EVs) for the treatment of colon cancer

[0111] The method for preparing cGAS EVs was the same as in the previous examples. MC38 colon cancer cells were injected into the right lower abdomen of C57 female mice to construct a subcutaneous tumor model. The tumor was allowed to grow to 50 mm in size. 3 Mice were randomly divided into four groups: the experimental group received intratumoral injection of cGAS EVs; the control group received intratumoral injections of Ctrl EVs, cGAMP, and PBS, respectively. Administered the drugs every three days for a total of three doses. Tumor volume was measured every three days. On day 25 after drug intervention, subcutaneous xenografts from each group of mice were removed and tumor volume was measured. Figure 10 As shown in the figure, the experimental results indicate that cGAS EVs can significantly inhibit the growth of colon cancer tumors compared with other groups.

[0112] Example 6: Extracellular vesicles loaded with cGAS protein (cGAS EVs) for the treatment of melanoma

[0113] The method for preparing cGAS EVs was the same as described in the previous examples. B16 / F10 melanoma cells were injected into the right lower ventral side of C57 female mice to construct a subcutaneous tumor model. The tumor was allowed to grow to 50 mm in size. 3 Mice were randomly divided into four groups: the experimental group received intratumoral injection of cGAS EVs; the control group received intratumoral injections of Ctrl EVs, cGAMP, and PBS, respectively. Administered the drugs every three days for a total of three doses. Tumor volume was measured every three days. On day 25 after drug intervention, subcutaneous xenografts from each group of mice were removed and tumor volume was measured. Figure 11 As shown in Figure 12, the experimental results show that compared with other groups, cGAS EVs can significantly inhibit the growth of melanoma without toxic side effects.

[0114] Example 7: Extracellular vesicles loaded with cGAS protein enhance the efficacy of immune checkpoint inhibitors.

[0115] The method for preparing cGAS EVs was the same as in the previous examples. MC38 colon cancer cells were injected into the right lower abdomen of C57 female mice to construct a subcutaneous tumor model. The tumor was allowed to grow to 50 mm in size. 3Mice were randomly divided into four groups: the experimental group received intratumoral injection of 50 μL cGAS EVs and intraperitoneal injection of 200 μg PD-1 antibody; the control group received intratumoral injection of 50 μL cGAS EVs, 50 μL PBS, and intraperitoneal injection of 200 μg PD-1, respectively. The drugs were administered intratumorally and intraperitoneally every three days, for a total of three doses. Tumor volume was measured every three days. On day 25 after drug intervention, subcutaneous xenografts from each group of mice were removed for tumor volume measurement and survival time analysis. Figure 13 As shown in Figure 14, the experimental results showed that compared with the single treatment group, cGAS EVs could enhance the anti-tumor effect of PD-1 and significantly prolong the survival period of mice.

[0116] In summary, the technical solution provided by this invention has the following beneficial technical effects:

[0117] (1) The plasmid combination provided by the present invention, especially the co-transfection of specific dual plasmids, can achieve efficient loading of target proteins into extracellular vesicles.

[0118] (2) The extracellular vesicles with high efficiency in loading functional proteins provided by the present invention still have biological activity, can effectively exert anti-tumor effects, and have no systemic toxic side effects.

[0119] (3) The extracellular vesicles with high efficiency loading of functional proteins provided by the present invention can be used in combination with immune checkpoint inhibitors, which have a synergistic effect and further exert anti-tumor effects, providing patients with more and more effective drug options.

[0120] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0121] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A plasmid assembly for preparing extracellular vesicles loaded with a target protein or polypeptide, the plasmid assembly comprising pCAG-GOI plasmid and pMD2.G plasmid; wherein GOI refers to the gene sequence corresponding to the target protein or polypeptide; and wherein the pCAG-GOI plasmid is selected from pCAG-cGAS.

2. A cell for preparing extravesicles, characterized in that, The cells are transfected with the plasmid combination described in claim 1 for preparing extracellular vesicles loaded with the target protein or polypeptide.

3. The cell as described in claim 2, characterized in that, The cells were selected from HEK293F cells.

4. An extracellular vesicle, characterized in that, The extracellular vesicles include cGAS protein; the extracellular vesicles are prepared by transfecting cells with the plasmid combination used in claim 1 for preparing extracellular vesicles loaded with the target protein or polypeptide.

5. The use of the extracellular vesicles as described in claim 4 in the preparation of a cancer prevention / treatment drug.

6. The use of a composition comprising the extracellular vesicles as described in claim 4 and an immune checkpoint inhibitor and / or immune checkpoint antagonist in the preparation of a cancer prevention / treatment medicament.

7. The application as described in claim 6, characterized in that, The immune checkpoints include CTLA-4, PD-1, PD-L1, IDO-1, TIM-3, LAG-3, KIR, GITR, VISTA, 4-1BB, OX40, B7-H3, and CD27.

8. The application as described in claim 6, characterized in that, The inhibitors and / or antagonists include small molecule compounds or antibodies.

9. The application as described in claim 5 or 6, characterized in that, The cancers mentioned are selected from colon cancer and melanoma.

10. A method for loading a target protein or polypeptide into an extracellular vesicle, characterized in that, The method includes transfecting the plasmid combination of claim 1, used to prepare extracellular vesicles loaded with the target protein or polypeptide, into cells for expression.

11. The method as described in claim 10, characterized in that, The method includes: (1) transfecting the plasmid combination into cells for a period of time, collecting the culture supernatant, and storing it at low temperature; (2) separating extracellular vesicles from the collected culture supernatant.

12. The method as described in claim 10, characterized in that, The specified time period refers to collecting the culture supernatant on the fourth day after transfection; the specified low-temperature storage refers to long-term storage at -80℃.

13. The method as described in claim 11, characterized in that, The separation of extracellular vesicles includes the separation of extracellular vesicles from the collected culture supernatant by ultracentrifugation.

Images