Specific primers for identifying peach germplasm resistance to freezing and method for identifying peach germplasm resistance to freezing

Abstract

The present application belongs to the technical field of molecular biology, and particularly relates to a specific primer for identifying the frost resistance of peach germplasm and a method for identifying the frost resistance of peach germplasm. The specific primer for identifying the frost resistance of peach germplasm comprises a primer FW and a primer RV, the nucleotide sequence of the primer FW is 5' TAAAACTTGAACACTA ACCATGTTCT 3', and the nucleotide sequence of the primer RV is 5' GTTTAGACTGTTTGTGGCATGAGTA 3'. The specific primer has a strong positive correlation with the frost resistance of peach germplasm, and the accuracy is as high as 100%, so that the specific primer can be used for identifying the frost resistance of peach germplasm and facilitating subsequent molecular breeding work, and has important application value for identifying the frost resistance of peach germplasm in the process of agricultural production and variety breeding. The identification method has the advantages of simple operation, low cost, high efficiency for frost resistance identification, high accuracy and the like, greatly shortens the identification period, has strong commercial application value, and has a very broad prospect.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to specific primers for identifying the freeze resistance of peach germplasm and methods for identifying the freeze resistance of peach germplasm. Background Technology

[0002] Molecular marker-assisted breeding utilizes the close linkage between molecular markers and genes that determine target traits. By detecting molecular markers, the presence of the target gene can be identified, thus achieving the goal of selecting for the target trait. It has the advantages of being rapid, accurate, and unaffected by environmental conditions. It can be used as an auxiliary tool in various breeding stages, such as identifying parental relationships, detecting the transfer of quantitative and recessive traits in backcross breeding, selecting hybrid offspring, predicting heterosis, and determining variety purity.

[0003] Marker-assisted selection (MAG) refers to the selection of genotypes for target traits by analyzing the genotypes of molecular markers closely linked to target genes. MAG-assisted breeding has shortened breeding time, accelerated the breeding process, improved breeding efficiency, and overcome many difficulties found in conventional breeding methods. This is accompanied by the development of new molecular markers, addressing various aspects including disease resistance, insect resistance, drought resistance, high yield, and quality improvement.

[0004] Current methods for identifying resistance in peach germplasm mostly rely on physiological treatments, which are inconsistent in standards, cumbersome in procedure, and have low accuracy. No molecular techniques for identifying resistance in peach germplasm have yet been reported. Summary of the Invention

[0005] To address the problems existing in the prior art, the present invention provides specific primers for identifying the freeze resistance of peach germplasm and a method for identifying the freeze resistance of peach germplasm.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] One objective of this invention is to provide specific primers for identifying the freeze resistance of peach germplasm, including primer FW and primer RV, wherein the nucleotide sequence of primer FW is 5'TAAAACTTGAACACTAACCATGTTCT 3' and the nucleotide sequence of primer RV is 5'GTTTAGACTGTTTGTGGCATGAGTA 3'.

[0008] The present invention also provides a kit or DNA chip containing the primers FW and RV described above.

[0009] The kit or DNA chip can be used to identify the freeze resistance of peach germplasm.

[0010] This invention also provides a method for identifying the frost resistance of peach germplasm, the main steps of which include:

[0011] (1) Extract genomic DNA from the sample to be tested;

[0012] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the specific primers described in this invention to obtain the amplification product;

[0013] (3) Perform agarose gel electrophoresis on the amplification products obtained in step (2);

[0014] (4) Analyze the results of the agarose gel obtained in step (3) and determine the resistance based on the presence or absence of bands.

[0015] Preferably, the PCR amplification system in step (2) includes:

[0016] Peach PCR amplification system, total reaction volume 20 μL;

[0017] Peach DNA template (50-75 ng / μL) 1.0 μL;

[0018] 2×Ex Taq Mix (containing Mg) 2+ , dNTPs, loading buffer) 10.0μL;

[0019] The primers were: FW (10 μmol / L) 1.0 μL and RV (10 μmol / L) 1.0 μL.

[0020] dd H2O 8.0μL.

[0021] Preferably, the PCR amplification program in step (2) is as follows: The reaction program is as follows:

[0022] Pre-denaturation at 94℃ for 5 minutes;

[0023] Denaturation at 94℃ for 30 seconds;

[0024] Anneal at 56℃ for 30 seconds;

[0025] Extend at 72℃ for 30 seconds, repeat 35 cycles;

[0026] Extend at 72℃ for 5 minutes;

[0027] Cool down to 4℃.

[0028] Preferably, the step (3) of determining resistance based on the presence or absence of a stripe specifically involves:

[0029] (1) It has stripes and no frost resistance;

[0030] (2) No stripes, and has frost resistance.

[0031] The inventors used third-generation whole-genome sequencing technology to assemble the genome of the Feicheng peach. By comparing it with the genome of the resistant rootstock Lovell, they discovered a 125kb segment inversion on chromosome 8. One of the inversion sites caused a 5'UTR break in the resistance gene Ppersica08G000108. Based on the resistance gene Ppersica08G000108, this invention independently designed primers FW:5'TAAAACTTGAACACTAACCATGTTCT 3' and RV:5'GTTTAGACTGTTTGTGGCATGAGTA3', and established a method for identifying the freeze resistance of peach germplasm.

[0032] Ppersica08G000108 gene annotation: a broad-spectrum stress protein, widely found in bacteria, archaea, fungi, protozoa, and plants, endowing organisms with functions such as salt and alkali tolerance, extreme temperature tolerance, antibiotic tolerance, and nutrient deficiency tolerance.

[0033] Beneficial effects

[0034] This invention discloses specific primers for identifying the freeze resistance of peach germplasm and a method for identifying the freeze resistance of peach germplasm. Compared with the prior art, this invention has the following advantages:

[0035] 1. The specific primers described in this invention have a strong positive correlation with the frost resistance of peach germplasm, with an accuracy rate of up to 100%. They can be used to identify the frost resistance of peach germplasm, which is convenient for assisting subsequent molecular breeding work. They have important application value for the identification of frost resistance of peach germplasm in agricultural production and variety selection.

[0036] 2. The identification method described in this invention has the advantages of simple operation, low cost, high efficiency and high accuracy in resistance identification, which greatly shortens the identification cycle, has strong commercial application value and a very broad prospect. Attached Figure Description

[0037] Figure 1 Schematic diagram of the inversion sites of the Feicheng peach gene and the Lovell genome;

[0038] Figure 2 Schematic diagram of the fracture site;

[0039] Figure 3 Results of frost resistance tests on Feicheng peaches and LOVOLL;

[0040] Figure 4 Results of the identification of the frost resistance of 23 peach germplasms in the field. Detailed Implementation

[0041] The present invention will now be described in detail. Before proceeding with the description, it should be understood that the terminology used in this specification and the appended claims should not be construed as limited to its general or dictionary meaning, but rather should be interpreted according to the meaning and concept corresponding to the technical aspects of the invention, based on the principle that the inventors are allowed to appropriately define the terms for the best interpretation. Therefore, the description presented herein is merely a preferred example for illustrative purposes and is not intended to limit the scope of the invention. It should be understood that other equivalents or modifications can be obtained from it without departing from the spirit and scope of the invention.

[0042] The following embodiments are merely examples illustrating implementations of the present invention and do not constitute any limitation on the present invention. Those skilled in the art will understand that modifications made without departing from the spirit and concept of the present invention fall within the protection scope of the present invention. Unless otherwise specified, the reagents and instruments used in the following embodiments are commercially available products.

[0043] Example 1: Obtaining specific primers for identifying the freeze resistance of peach germplasm

[0044] The inventors used third-generation whole-genome sequencing technology to assemble the Feicheng peach genome. By comparing it with the genome of the resistant rootstock *Lovell*, they discovered a 125kb segment inversion on chromosome 8. One of these inversion sites caused a 5' UTR break in the resistance gene *Ppersica08G000108*. Figure 1 As shown.

[0045] Primers FW: 5'TAAAACTTGAACACTAACCATGTTCT 3' and RV: 5'GTTTAGACTGTTTGTGGCATGAGTA 3' were designed using the breakpoint.

[0046] Example 2: Method for identifying freeze resistance using specific primers developed in Example 1

[0047] Step (1) Extract genomic DNA from Feicheng peaches and LOVOLL samples to be tested;

[0048] Step (2) uses the genomic DNA extracted in step (1) as a template, and the PCR amplification system described in the primers FW:5'TAAAACTTGAACACTAACCATGTTCT 3' and RV:5'GTTTAGACTGTTTGTGGCATGAGTA 3' designed in this invention includes:

[0049] Peach PCR amplification system, total reaction volume 20 μL;

[0050] Peach DNA template (50-75 ng / μL) 1.0 μL;

[0051] 10.0 μL of 2×Ex Taq Mix (containing Mg2+, dNTPs, and loading buffer);

[0052] 1.0 μL each of the aforementioned forward and reverse primers (10 μmol / L);

[0053] dd H2O (ultrapure water) 8.0 μL.

[0054] The PCR amplification procedure described in step (2) is as follows:

[0055] The reaction procedure is as follows:

[0056] Pre-denaturation at 94℃ for 5 minutes;

[0057] Denaturation at 94℃ for 30 seconds;

[0058] Anneal at 56℃ for 30 seconds;

[0059] Extend at 72℃ for 30 seconds, repeat 35 cycles;

[0060] Extend at 72℃ for 5 minutes;

[0061] Cool down to 4℃.

[0062] The electrophoresis of the PCR products on agarose gel in step (3) is performed as follows:

[0063] Prepare a 1% agarose gel with added Gelred indicator. Add the peach PCR amplification product obtained in step (2) to the agarose gel and place it in an electrophoresis tank with 1×TAE buffer. The electrophoresis voltage is 5V / cm. When the bromophenol blue migrates to 2 / 3 of the agarose gel, remove the gel and rinse it with water. Place it in a UVI FireReader automatic gel imaging system to observe, photograph and record the results.

[0064] In step (4), the agarose gel electrophoresis results were analyzed using the software Quantity One.

[0065] The results are as follows Figure 3 As shown, Figure 3 In the diagram, M: marker; 1: Feicheng peach; 2: Lovell; 3: negative control.

[0066] With straps: No frost resistance;

[0067] Not brought: It has antifreeze properties.

[0068] Example 3 uses the specific primers developed in Example 1 to identify the frost resistance of 23 field-grown planting resources.

[0069] The primers of Example 1 of this invention were used to identify 23 field planting resources, and the specific identification method was the same as in Example 2.

[0070] The results of the identification are as follows Figure 4 As shown in Table 1 below, no bands were found in the three rootstocks (superior lines) with excellent frost resistance (arrows), indicating that our primer has a strong positive correlation with frost resistance and an accuracy of up to 100%, which is convenient for assisting subsequent molecular breeding work.

[0071] Table 1. Results of resistance identification of 23 peach germplasm accessions

[0072]

[0073]

[0074] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. Specific primers for identifying the freeze resistance of peach germplasm, characterized in that: Includes primer FW and primer RV, wherein primer FW The nucleotide sequence is 5' TAAAACTTGAACACTAACCATGTTCT 3', and the nucleotide sequence of primer RV is 5' GTTTAGACTGTTTGTGGCATGAGTA 3'.

2. A reagent kit or DNA chip, characterized in that: Includes primers FW and RV as described in claim 1.

3. The application of the kit or DNA chip described in claim 2 in identifying the freeze resistance of peach germplasm.

4. A method for identifying the frost resistance of peach germplasm, characterized in that, The main steps of the method include: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the specific primers described in claim 1. Increase, and obtain the amplified product; (3) The amplification products obtained in step (2) were detected by agarose gel electrophoresis; (4) Analyze the results of agarose gel electrophoresis obtained in step (3) and judge the antifreeze properties based on the presence or absence of bands; The step (4) of judging frost resistance based on the presence or absence of a stripe specifically involves: (1) It has stripes and no frost resistance; (2) No stripes, and has antifreeze properties.

5. The method according to claim 4, characterized in that, The PCR amplification procedure described in step (2) is as follows: Pre-denaturation at 94 ℃ for 5 min; Denaturation at 94 ℃ for 30 s Anneal at 56℃ for 30 seconds. 72 ℃ for 30 s, for a total of 35 cycles; Extend at 72 ℃ for 5 min; Cool down to 4 ℃.

Images