Primers, probes, kits, and applications for quantitative real-time detection of human papillomavirus E6 / E7 mRNA.

CN117126963BActive Publication Date: 2026-09-25DAAN GENE CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210551144.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-18
Publication Date
2026-09-25
Estimated Expiration
2042-05-18

AI Technical Summary

Technical Problem

因此,亟需提供一种针对E6/E7 mRNA为检测靶点的HPV检测方法,以避免HPV漏检的问题

Benefits of technology

本申请提供的用于荧光定量检测人乳头瘤病毒E6/E7 mRNA的引物和探针,引物包括高危型HPV检测引物和外源性内标引物对,探针包括高危型HPV检测探针和外源性内标探针,可以同时检测14种高危型HPV E6/E7 mRNA,并区分具体型别,避免漏检的问题,同时,可以提高检测的准确性和灵敏度。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117126963B_ABST
    Figure CN117126963B_ABST
Patent Text Reader

Abstract

The embodiment of the application belongs to the technical field of biology and relates to a primer, a probe and a kit for fluorescent quantitative detection of human papilloma virus E6 / E7 mRNA. The primer comprises a high-risk HPV detection primer group and an exogenous internal standard primer pair. The probe comprises a high-risk HPV detection probe and an exogenous internal standard probe. The application can simultaneously detect different types of high-risk HPV E6 / E7 mRNA and distinguish specific types, thereby avoiding the problem of missed detection, and can improve the accuracy and sensitivity of detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to primers and probes, kits, and applications for the quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA. Background Technology

[0002] Human papillomavirus (HPV) is a genus of papillomavirus A belonging to the family Papillomaviridae. It is a spherical DNA virus that can cause proliferation of squamous epithelium in human skin and mucous membranes. Currently, more than 130 types have been isolated, each causing different clinical manifestations. Based on the tissue site affected, they can be divided into: low-risk cutaneous types, high-risk cutaneous types, low-risk mucosal types, and high-risk mucosal types. High-risk HPV includes 14 types: HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68. Low-risk HPV includes HPV6, 11, 42, 43, and 81. Infection with low-risk HPV can cause genital warts on the cervix, vagina, or perineum. Persistent infection with high-risk HPV can cause precancerous lesions of the cervix; if left untreated, persistent infection for more than 5 years can lead to cervical cancer.

[0003] The HPV genome can be divided into three parts: the early transcription region (E), the late transcription region (L), and the upstream regulatory region (LCR). The E region is about 4500 bp long and encodes early proteins E1, E2, E4, E5, E6, and E7, which are involved in regulating the viral life cycle and regulating DNA replication, transcription, and translation of viral proteins.

[0004] The pathogenesis of cervical cancer caused by HPV infection is mainly as follows: HPV has high host specificity and is one of the important pathogens causing reproductive complications. Sexual contact is the main route of transmission. It mainly infects the stratified squamous epithelium of the skin and mucous membranes in specific parts of the human body, causing poor differentiation, disordered arrangement, large and deeply stained nuclei, and abnormal proliferation of epithelial cells in these areas, leading to malignant transformation. The oncogenes encoded by the E6 / E7 genes are important factors leading to cervical epithelial carcinogenesis. The binding and regulation of these two proteins with the two major intracellular tumor suppressor proteins p53 and pRb can significantly alter the cell cycle and DNA repair, resulting in genomic instability, which is a necessary condition for cell transformation and immortalization.

[0005] During the development of cancer from low-grade lesions, the HPV genome integrates. During this integration, the oncogenic E6 / E7 genes persist, while the L1 gene may be lost. However, because the L1 gene sequence is relatively conserved, it is more suitable as a target for detection using universal primers. Currently, almost all HPV testing products target L1. During the process of lesions becoming cancerous, the L1 gene may be lost during genome integration, potentially leading to missed detections if used as a detection target. Therefore, there is an urgent need for an HPV detection method targeting E6 / E7 mRNA to avoid this problem of missed HPV detection. Summary of the Invention

[0006] The purpose of this application is to solve the technical problem of missed detection in HPV detection in related technologies.

[0007] To address the aforementioned technical problems, this application provides primers and probes for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA, employing the following technical solution: The primers include a high-risk HPV detection primer set and an exogenous internal standard primer pair; the probes include a high-risk HPV detection probe and an exogenous internal standard probe.

[0008] Furthermore, the high-risk HPV detection primer set includes HPV16 primer pairs, HPV18 primer pairs, HPV31 primer pairs, HPV33 primer pairs, HPV35 primer pairs, HPV39 primer pairs, HPV45 primer pairs, HPV51 primer pairs, HPV52 primer pairs, HPV56 primer pairs, HPV58 primer pairs, HPV59 primer pairs, HPV66 primer pairs, and HPV68 primer pairs; and The high-risk HPV detection probes include HPV16 probe, HPV18 probe, HPV31 probe, HPV33 probe, HPV35 probe, HPV39 probe, HPV45 probe, HPV51 probe, HPV52 probe, HPV56 probe, HPV58 probe, HPV59 probe, HPV66 probe, and HPV68 probe.

[0009] Furthermore, the HPV16 primer pair includes an HPV16 upstream primer and an HPV16 downstream primer, wherein the sequence number of the HPV16 upstream primer is SEQ ID NO.:1, the sequence number of the HPV16 downstream primer is SEQ ID NO.:2, and the sequence number of the HPV16 probe is SEQ ID NO.:3; The HPV18 primer pair includes an HPV18 upstream primer and an HPV18 downstream primer, wherein: the sequence number of the HPV18 upstream primer is SEQ ID NO.:4, the sequence number of the HPV18 downstream primer is SEQ ID NO.:5, and the sequence number of the HPV18 probe is SEQ ID NO.:6; The HPV31 primer pair includes an HPV31 upstream primer and an HPV31 downstream primer, wherein the sequence number of the HPV31 upstream primer is SEQ ID NO.:7, the sequence number of the HPV31 downstream primer is SEQ ID NO.:8, and the sequence number of the HPV31 probe is SEQ ID NO.:9; The HPV33 primer pair includes an HPV33 upstream primer and an HPV33 downstream primer, wherein the sequence number of the HPV33 upstream primer is SEQ ID NO.:10, the sequence number of the HPV33 downstream primer is SEQ ID NO.:11, and the sequence number of the HPV33 probe is SEQ ID NO.:12; The HPV35 primer pair includes an HPV35 upstream primer and an HPV35 downstream primer, wherein the sequence number of the HPV35 upstream primer is SEQ ID NO.:13, the sequence number of the HPV35 downstream primer is SEQ ID NO.:14, and the sequence number of the HPV35 probe is SEQ ID NO.:15; The HPV39 primer pair includes an HPV39 upstream primer and an HPV39 downstream primer, wherein the sequence number of the HPV39 upstream primer is SEQ ID NO.:16, the sequence number of the HPV39 downstream primer is SEQ ID NO.:17, and the sequence number of the HPV39 probe is SEQ ID NO.:18; The HPV45 primer pair includes an HPV45 upstream primer and an HPV45 downstream primer, wherein the sequence number of the HPV45 upstream primer is SEQ ID NO.:19, the sequence number of the HPV45 downstream primer is SEQ ID NO.:20, and the sequence number of the HPV45 probe is SEQ ID NO.:21; The HPV51 primer pair includes an HPV51 upstream primer and an HPV51 downstream primer, wherein the sequence number of the HPV51 upstream primer is SEQ ID NO.:22, the sequence number of the HPV51 downstream primer is SEQ ID NO.:23, and the sequence number of the HPV51 probe is SEQ ID NO.:24; The HPV52 primer pair includes an HPV52 upstream primer and an HPV52 downstream primer, wherein the sequence number of the HPV52 upstream primer is SEQ ID NO.:25, the sequence number of the HPV52 downstream primer is SEQ ID NO.:26, and the sequence number of the HPV52 probe is SEQ ID NO.:27; The HPV56 primer pair includes an HPV56 upstream primer and an HPV56 downstream primer, wherein the sequence number of the HPV56 upstream primer is SEQ ID NO.:28, the sequence number of the HPV56 downstream primer is SEQ ID NO.:29, and the sequence number of the HPV56 probe is SEQ ID NO.:30; The HPV58 primer pair includes an HPV58 upstream primer and an HPV58 downstream primer, wherein the sequence number of the HPV58 upstream primer is SEQ ID NO.:31, the sequence number of the HPV58 downstream primer is SEQ ID NO.:32, and the sequence number of the HPV58 probe is SEQ ID NO.:33; The HPV59 primer pair includes an HPV59 upstream primer and an HPV59 downstream primer, wherein the sequence number of the HPV59 upstream primer is SEQ ID NO.:34, the sequence number of the HPV59 downstream primer is SEQ ID NO.:35, and the sequence number of the HPV59 probe is SEQ ID NO.:36; The HPV66 primer pair includes an HPV66 upstream primer and an HPV66 downstream primer, wherein the sequence number of the HPV66 upstream primer is SEQ ID NO.:37, the sequence number of the HPV66 downstream primer is SEQ ID NO.:38, and the sequence number of the HPV66 probe is SEQ ID NO.:39; The HPV68 primer pair includes an HPV68 upstream primer and an HPV68 downstream primer, wherein the sequence number of the HPV68 upstream primer is SEQ ID NO.:40, the sequence number of the HPV68 downstream primer is SEQ ID NO.:41, and the sequence number of the HPV68 probe is SEQ ID NO.:42; The exogenous internal standard primer pair includes an upstream internal standard primer and a downstream internal standard primer, wherein the sequence number of the upstream internal standard primer is SEQ ID NO.:43, the sequence number of the downstream internal standard primer is SEQ ID NO.:44, and the sequence number of the exogenous internal standard probe is SEQ ID NO.:45.

[0010] Furthermore, the nucleotide sequence corresponding to SEQ ID NO.:1 is AAACCGTTGTGTGATTTGTTA, the nucleotide sequence corresponding to SEQ ID NO.:2 is CCGACCCCTTATATTATGGAA, and the nucleotide sequence corresponding to SEQ ID NO.:3 is FAM-CTGTCAAAAGCCACTGTGTCC-BHQ1; The nucleotide sequence corresponding to SEQ ID NO.:4 is CGACGCAGAGAAACACAA, the nucleotide sequence corresponding to SEQ ID NO.:5 is TCGGATGTCGCTTAATTGCT, and the nucleotide sequence corresponding to SEQ ID NO.:6 is FAM–ATGCATGGACCTAAGGCAAC-BHQ1; The nucleotide sequence corresponding to SEQ ID NO.:7 is TTGTTAATTAGGTGTATAACGTG, the nucleotide sequence corresponding to SEQ ID NO.:8 is TATGCAACGTCCTGTCCA, and the nucleotide sequence corresponding to SEQ ID NO.:9 is FAM-AAGACCGTTGTGTCCAGA-BHQ1; The nucleotide sequence corresponding to SEQ ID NO.:10 is ATTTCATAATATTTCGGGTCGTT, the nucleotide sequence corresponding to SEQ ID NO.:11 is TTTACACGTCACAGTGCAG, and the nucleotide sequence corresponding to SEQ ID NO.:12 is Texas Red-CTACGTCGGGACCTCCAAC-BHQ2; The nucleotide sequence corresponding to SEQ ID NO.:13 is TTCCATAACATCGGTGGAC, the nucleotide sequence corresponding to SEQ ID NO.:14 is ATGATTACACCTCGGTTT, and the nucleotide sequence corresponding to SEQ ID NO.:15 is Texas Red-AACAGGACATACACCGACC-BHQ2; The nucleotide sequence corresponding to SEQ ID NO.:16 is GGACATTACAATAGCCTG, the nucleotide sequence corresponding to SEQ ID NO.:17 is AATCATATACCTCGGTTT, and the nucleotide sequence corresponding to SEQ ID NO.:18 is Cy5-TCTATTGCAGACGACCACT-BHQ2. The nucleotide sequence corresponding to SEQ ID NO.:19 is TTAGTCATGCACAACTACCAG, the nucleotide sequence corresponding to SEQ ID NO.:20 is GCTCAATTCTGCCGTCACA, and the nucleotide sequence corresponding to SEQ ID NO.:21 is Texas Red-CCGACGAGCCGAACCACA-BHQ2; The nucleotide sequence corresponding to SEQ ID NO.:22 is TTGGGCCTGAAGAAAAGCAAA, the nucleotide sequence corresponding to SEQ ID NO.:23 is GCTTTTATTACACTTGGGTTTC, and the nucleotide sequence corresponding to SEQ ID NO.:24 is FAM-ATTAGCGCATTGCCCCGTC-BHQ1; The nucleotide sequence corresponding to SEQ ID NO.:25 is TTGAGGATCCAGCAACAC, the nucleotide sequence corresponding to SEQ ID NO.:26 is CCTTATTTTCATGCACCGAT, and the nucleotide sequence corresponding to SEQ ID NO.:27 is Texas Red–CAGCACCTCACACAATTCGT-BHQ2; The nucleotide sequence corresponding to SEQ ID NO.:28 is TAATACACGTACCTTGTTGTGAG, the nucleotide sequence corresponding to SEQ ID NO.:29 is TAACGCACCCATAAGCAG, and the nucleotide sequence corresponding to SEQ ID NO.:30 is FAM-ACACGCAGGTCCTCTTTGGTA-BHQ1; The nucleotide sequence corresponding to SEQ ID NO.:31 is GTTCATAATATTTCGGGTCGTTG, the nucleotide sequence corresponding to SEQ ID NO.:32 is TATATTTCTCTTAGCGTTGGGTT, and the nucleotide sequence corresponding to SEQ ID NO.:33 is Cy5-CTCTCATGGCGTTGTTACAGG-BHQ2. The nucleotide sequence corresponding to SEQ ID NO.:34 is ATTAGAGGCTGAAACCAAG, the nucleotide sequence corresponding to SEQ ID NO.:35 is ACATAGAGGTTTTAGGCAT, and the nucleotide sequence corresponding to SEQ ID NO.:36 is Cy5 – ATAACAGCGTATCAGCAGCTC-BHQ2; The nucleotide sequence corresponding to SEQ ID NO.:37 is TAAGTGTTACCTAATTCACGTACC, the nucleotide sequence corresponding to SEQ ID NO.:38 is TTGTACCACACGTAGCT, and the nucleotide sequence corresponding to SEQ ID NO.:39 is Cy5-TCTGAATGTCCAACTGCACCAC-BHQ2. The nucleotide sequence corresponding to SEQ ID NO.:40 is TGAGTTGCCTGAAACCAT, the nucleotide sequence corresponding to SEQ ID NO.:41 is TCCTGTAAAGTTTCCTGCTA, and the nucleotide sequence corresponding to SEQ ID NO.:42 is Cy5–AAGGCACCTAACAACAAAACGA-BHQ2; and The nucleotide sequence corresponding to SEQ ID NO.:43 is TGCACTTGAATATGTGGCT, the nucleotide sequence corresponding to SEQ ID NO.:44 is GTTTTCACAATCGGACCT, and the nucleotide sequence corresponding to SEQ ID NO.:45 is VIC-ATTCACTTGAGATCAAAGTACCCA-BHQ1.

[0011] To address the aforementioned technical problems, this application also provides a kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA, employing the following technical solution: The kit includes primers and probes as described above, as well as PCR buffer, wherein the components of the PCR buffer include (NH4)2SO4, KCl, Tris-HCl, and MgCl2.

[0012] Furthermore, the kit also includes one or more of dUTPs, Taq enzyme, reverse transcriptase, UDG enzyme, and RNase inhibitors.

[0013] Furthermore, the kit also includes a negative control and a positive control, wherein the negative control is DEPC water and the positive control comprises a pseudovirus containing high-risk HPV E6 / E7 mRNA fragments.

[0014] Furthermore, the kit also includes an internal standard solution, the components of which include a pseudovirus containing an exogenous internal standard fragment.

[0015] Furthermore, the kit also includes a DNA digestion reagent comprising DNase I and DNase I buffer.

[0016] To address the aforementioned technical problems, this application also provides an application of the kit described above for non-diagnostic purposes in detecting human papillomavirus E6 / E7 mRNA.

[0017] Compared with the prior art, the embodiments of this application have the following main advantages: The primers and probes provided in this application for the quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA include primers for high-risk HPV detection and exogenous internal standard primer pairs, and probes include high-risk HPV detection probes and exogenous internal standard probes. They can simultaneously detect 14 types of high-risk HPV E6 / E7 mRNA and distinguish specific types to avoid missed detection. At the same time, they can improve the accuracy and sensitivity of the detection. Attached Figure Description

[0018] To more clearly illustrate the solutions in this application, the accompanying drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a flowchart of an embodiment of the method for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA according to this application. Detailed Implementation

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the terminology used herein in the specification of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application; the terms "comprising" and "having," and any variations thereof, in the specification, claims, and foregoing drawings of this application, are intended to cover non-exclusive inclusion. The terms "first," "second," etc., in the specification, claims, or foregoing drawings of this application are used to distinguish different objects, not to describe a particular order.

[0021] In this document, the term "embodiment" means that a particular feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places throughout the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.

[0022] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings.

[0023] This application provides primers and probes for quantitative real-time detection of human papillomavirus E6 / E7 mRNA. The primers include 15 pairs of upstream and downstream primers, and the probes include 15 pairs of specific probes. Specifically, the primers include a high-risk HPV detection primer set and an exogenous internal standard primer pair, and the probes include a high-risk HPV detection probe and an exogenous internal standard probe. The high-risk HPV detection primer set includes HPV16 primer pairs, HPV18 primer pairs, HPV31 primer pairs, HPV33 primer pairs, HPV35 primer pairs, HPV39 primer pairs, HPV45 primer pairs, and HPV51 primer pairs. HPV52 primer pair, HPV56 primer pair, HPV58 primer pair, HPV59 primer pair, HPV66 primer pair and HPV68 primer pair, and high-risk HPV detection probes include HPV16 probe, HPV18 probe, HPV31 probe, HPV33 probe, HPV35 probe, HPV39 probe, HPV45 probe, HPV51 probe, HPV52 probe, HPV56 probe, HPV58 probe, HPV59 probe, HPV66 probe and HPV68 probe.

[0024] The HPV16 primer pair includes an HPV16 upstream primer and an HPV16 downstream primer. The sequence number of the HPV16 upstream primer is SEQ ID NO.:1, the sequence number of the HPV16 downstream primer is SEQ ID NO.:2, and the sequence number of the HPV16 probe is SEQ ID NO.:3. The nucleotide sequence corresponding to SEQ ID NO.:1 is AAACCGTTGTGTGATTTGTTA, the nucleotide sequence corresponding to SEQ ID NO.:2 is CCGACCCCTTATATTATGGAA, and the nucleotide sequence corresponding to SEQ ID NO.:3 is FAM-CTGTCAAAAGCCACTGTGTCC-BHQ1.

[0025] The HPV18 primer pair includes an HPV18 upstream primer and an HPV18 downstream primer. The sequence number of the HPV18 upstream primer is SEQ ID NO.:4, the sequence number of the HPV18 downstream primer is SEQ ID NO.:5, and the sequence number of the HPV18 probe is SEQ ID NO.:6. The nucleotide sequence corresponding to SEQ ID NO.:4 is CGACGCAGAGAAACACAA, the nucleotide sequence corresponding to SEQ ID NO.:5 is TCTGAGTCGCTTAATTGCT, and the nucleotide sequence corresponding to SEQ ID NO.:6 is FAM-ATGCATGGACCTAAGGCAAC-BHQ1.

[0026] The HPV31 primer pair includes an upstream primer and a downstream primer. The sequence number of the upstream primer is SEQ ID NO.:7, the sequence number of the downstream primer is SEQ ID NO.:8, and the sequence number of the HPV31 probe is SEQ ID NO.:9. The nucleotide sequence corresponding to SEQ ID NO.:7 is TTGTTAATTAGGTGTATAACGTG, the nucleotide sequence corresponding to SEQ ID NO.:8 is TATGCAACGTCCTGTCCA, and the nucleotide sequence corresponding to SEQ ID NO.:9 is FAM-AAGACCGTTGTGTCCAGA-BHQ1.

[0027] The HPV33 primer pair includes an HPV33 upstream primer and an HPV33 downstream primer. The sequence number of the HPV33 upstream primer is SEQ ID NO.:10, the sequence number of the HPV33 downstream primer is SEQ ID NO.:11, and the sequence number of the HPV33 probe is SEQ ID NO.:12. The nucleotide sequence corresponding to SEQ ID NO.:10 is ATTTCATAATATTTCGGGTCGTT, the nucleotide sequence corresponding to SEQ ID NO.:11 is TTTACACGTCACAGTGCAG, and the nucleotide sequence corresponding to SEQ ID NO.:12 is Texas Red-CTACGTCGGGACCTCCAAC-BHQ2.

[0028] The HPV35 primer pair includes an HPV35 upstream primer and an HPV35 downstream primer. The sequence number of the HPV35 upstream primer is SEQ ID NO.:13, the sequence number of the HPV35 downstream primer is SEQ ID NO.:14, and the sequence number of the HPV35 probe is SEQ ID NO.:15. The nucleotide sequence corresponding to SEQ ID NO.:13 is TTCCATAACATCGGTGGAC, the nucleotide sequence corresponding to SEQ ID NO.:14 is ATGATTACACCTCGGTTT, and the nucleotide sequence corresponding to SEQ ID NO.:15 is TexasRed-AACAGGACATACACCGACC-BHQ2.

[0029] The HPV39 primer pair includes an HPV39 upstream primer and an HPV39 downstream primer. The sequence number of the HPV39 upstream primer is SEQ ID NO.:16, the sequence number of the HPV39 downstream primer is SEQ ID NO.:17, and the sequence number of the HPV39 probe is SEQ ID NO.:18. The nucleotide sequence corresponding to SEQ ID NO.:16 is GGACATTACAATAGCCTG, the nucleotide sequence corresponding to SEQ ID NO.:17 is AATTTCATATACCTCGGTTT, and the nucleotide sequence corresponding to SEQ ID NO.:18 is Cy5-TCTATTGCAGACGACCACT-BHQ2.

[0030] The HPV45 primer pair includes an HPV45 upstream primer and an HPV45 downstream primer. The sequence number of the HPV45 upstream primer is SEQ ID NO.:19, the sequence number of the HPV45 downstream primer is SEQ ID NO.:20, and the sequence number of the HPV45 probe is SEQ ID NO.:21. The nucleotide sequence corresponding to SEQ ID NO.:19 is TTAGTCATGCACAACTACCAG, the nucleotide sequence corresponding to SEQ ID NO.:20 is GCTCAATTCTGCCGTCACA, and the nucleotide sequence corresponding to SEQ ID NO.:21 is TexasRed-CCGACGAGCCGAACCACA-BHQ2.

[0031] The HPV51 primer pair includes an HPV51 upstream primer and an HPV51 downstream primer. The sequence number of the HPV51 upstream primer is SEQ ID NO.:22, the sequence number of the HPV51 downstream primer is SEQ ID NO.:23, and the sequence number of the HPV51 probe is SEQ ID NO.:24. The nucleotide sequence corresponding to SEQ ID NO.:22 is TTGGGCCTGAAGAAAAGCAAA, the nucleotide sequence corresponding to SEQ ID NO.:23 is GCTTTTATTACACTTGGGTTTC, and the nucleotide sequence corresponding to SEQ ID NO.:24 is FAM-ATTAGCGCATTGCCCCGTC-BHQ1.

[0032] The HPV52 primer pair includes an HPV52 upstream primer and an HPV52 downstream primer. The sequence number of the HPV52 upstream primer is SEQ ID NO.:25, the sequence number of the HPV52 downstream primer is SEQ ID NO.:26, and the sequence number of the HPV52 probe is SEQ ID NO.:27. The nucleotide sequence corresponding to SEQ ID NO.:25 is TTGAGGATCCAGCAACAC, the nucleotide sequence corresponding to SEQ ID NO.:26 is CCTTTATTTCATGCACCGAT, and the nucleotide sequence corresponding to SEQ ID NO.:27 is Texas Red-CAGCACCTCACACAATTCGT-BHQ2.

[0033] The HPV56 primer pair includes an HPV56 upstream primer and an HPV56 downstream primer. The sequence number of the HPV56 upstream primer is SEQ ID NO.:28, the sequence number of the HPV56 downstream primer is SEQ ID NO.:29, and the sequence number of the HPV56 probe is SEQ ID NO.:30. The nucleotide sequence corresponding to SEQ ID NO.:28 is TAATACACGTACCTTGTTGTGAG, the nucleotide sequence corresponding to SEQ ID NO.:29 is TAACGCACCCATAAGCAG, and the nucleotide sequence corresponding to SEQ ID NO.:30 is FAM-ACACGCAGGTCCTCTTTGGTA-BHQ1.

[0034] The HPV58 primer pair includes an HPV58 upstream primer and an HPV58 downstream primer. The sequence number of the HPV58 upstream primer is SEQ ID NO.:31, the sequence number of the HPV58 downstream primer is SEQ ID NO.:32, and the sequence number of the HPV58 probe is SEQ ID NO.:33. The nucleotide sequence corresponding to SEQ ID NO.:31 is GTTTCATAATATTTCGGGTCGTTG, the nucleotide sequence corresponding to SEQ ID NO.:32 is TATATTCTCTTAGCGTTGGGTT, and the nucleotide sequence corresponding to SEQ ID NO.:33 is Cy5-CTCTCATGGCGTTGTTACAGG-BHQ2.

[0035] The HPV59 primer pair includes an HPV59 upstream primer and an HPV59 downstream primer. The sequence number of the HPV59 upstream primer is SEQ ID NO.:34, the sequence number of the HPV59 downstream primer is SEQ ID NO.:35, and the sequence number of the HPV59 probe is SEQ ID NO.:36. The nucleotide sequence corresponding to SEQ ID NO.:34 is ATTAGAGGCTGAAACCAAG, the nucleotide sequence corresponding to SEQ ID NO.:35 is ACATAGAGGTTTTAGGCAT, and the nucleotide sequence corresponding to SEQ ID NO.:36 is Cy5-ATAACAGCGTATCAGCAGCTC-BHQ2.

[0036] The HPV66 primer pair includes an HPV66 upstream primer and an HPV66 downstream primer. The sequence number of the HPV66 upstream primer is SEQ ID NO.:37, the sequence number of the HPV66 downstream primer is SEQ ID NO.:38, and the sequence number of the HPV66 probe is SEQ ID NO.:39. The nucleotide sequence corresponding to SEQ ID NO.:37 is TAAGTGTTACCTAATTCACGTACC, the nucleotide sequence corresponding to SEQ ID NO.:38 is TTGTACCACACGTAGCT, and the nucleotide sequence corresponding to SEQ ID NO.:39 is Cy5-TCTGAATGTCCAACTGCACCAC-BHQ2.

[0037] The HPV68 primer pair includes an HPV68 upstream primer and an HPV68 downstream primer. The sequence number of the HPV68 upstream primer is SEQ ID NO.:40, the sequence number of the HPV68 downstream primer is SEQ ID NO.:41, and the sequence number of the HPV68 probe is SEQ ID NO.:42. The nucleotide sequence corresponding to SEQ ID NO.:40 is TGAGTTGCCTGAAACCAT, the nucleotide sequence corresponding to SEQ ID NO.:41 is TCCTGTAAAGTTTCCTGCTA, and the nucleotide sequence corresponding to SEQ ID NO.:42 is Cy5-AAGGCACCTAACAACAAAACGA-BHQ2.

[0038] The exogenous internal standard primer pair includes an upstream internal standard primer and a downstream internal standard primer. The sequence number of the upstream internal standard primer is SEQ ID NO.:43, and the nucleotide sequence corresponding to SEQ ID NO.:43 is TGCACTTGAATATGTGGCT. The sequence number of the downstream internal standard primer is SEQ ID NO.:44, and the nucleotide sequence corresponding to SEQ ID NO.:44 is GTTTTTCACAATCGGACCT. The sequence number of the exogenous internal standard probe is SEQ ID NO.:45, and the nucleotide sequence corresponding to SEQ ID NO.:45 is VIC-ATTCACTTGAGATCAAAGTACCCA-BHQ1.

[0039] It should be understood that exogenous internal standard primers and exogenous internal standard probes are used for internal quality control of the PCR amplification reaction system in real time.

[0040] In this embodiment, the nucleotide sequences corresponding to HPV16, HPV18, HPV31, HPV51, and HPV56 probes are labeled with FAM at the 5' end and BHQ1 at the 3' end; the nucleotide sequences corresponding to HPV33, HPV35, HPV45, and HPV52 probes are labeled with Texas Red at the 5' end and BHQ2 at the 3' end; the nucleotide sequences corresponding to HPV39, HPV58, HPV59, HPV66, and HPV68 probes are labeled with Cy5 at the 5' end and BHQ2 at the 3' end; and the nucleotide sequences corresponding to the exogenous internal standard probe are labeled with VIC at the 5' end and BHQ1 at the 3' end.

[0041] The high-risk HPV detection primer set and high-risk HPV detection probe bind to the mutated E6 / E7 mRNA on the gene fragment and release a fluorescent signal to detect 14 high-risk HPV E6 / E7 mRNA and distinguish specific types.

[0042] This application also provides a kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA. The kit includes primers and probes as described above, as well as PCR buffer. Specifically, the PCR buffer is tris(hydroxymethyl)aminomethane-hydrochloric acid buffer, and the main components of the tris(hydroxymethyl)aminomethane-hydrochloric acid buffer include (NH4)2SO4, KCl, Tris-HCl, and MgCl2.

[0043] In this embodiment, the kit includes reaction solution A and reaction solution B. Reaction solution A includes reaction solution A1, reaction solution A2, reaction solution A3, reaction solution A4, and reaction solution A5. Reaction solution A and reaction solution B constitute a PCR amplification reaction system.

[0044] Specifically, reaction solution A1 includes the HPV16 primer pair, HPV33 primer pair, HPV58 primer pair, exogenous internal standard primer pair, HPV16 probe, HPV33 probe, HPV58 probe, exogenous internal standard probe, and PCR buffer as described above; reaction solution A2 includes the HPV18 primer pair, HPV45 primer pair, HPV68 primer pair, exogenous internal standard primer pair, HPV18 probe, HPV45 probe, HPV68 probe, exogenous internal standard probe, and PCR buffer as described above; reaction solution A3 includes the HPV31 primer pair, HPV35 primer pair, and HPV16 primer pair as described above. The reaction solution A4 includes the following primer pairs: primer pair A39, exogenous internal standard primer pair A4, exogenous internal standard probe A5, exogenous internal standard probe A6, and PCR buffer; reaction solution A5 includes the following primer pairs: primer pair A4, primer pair A5, primer pair A6, exogenous internal standard primer pair A5, exogenous internal standard probe A6, and PCR buffer. Each primer pair includes one upstream primer and one downstream primer.

[0045] In some optional implementations, the final concentration of the above 15 upstream primers in the PCR amplification reaction system is 0.10 μmol / L, the final concentration of the above 15 downstream primers in the PCR amplification reaction system is 0.10 μmol / L, the final concentration of the 14 high-risk HPV detection probes in the PCR amplification reaction system is 0.05 μmol / L, and the final concentration of the exogenous internal standard probe in the PCR amplification reaction system is 0.03 μmol / L.

[0046] In this embodiment, the components of reaction solution B include one or more of dUTPs, Taq enzyme, reverse transcriptase, UDG enzyme, and RNase inhibitors. Taq enzyme is an enzyme that requires high temperature to activate; it is inactive before denaturation in the initial cycle, thus preventing non-specific amplification and significantly improving the specificity of PCR amplification. UDG enzyme works by selectively hydrolyzing and breaking uracil glycosidic bonds in double-stranded or single-stranded DNA containing dU, forming DNA strands with missing bases. The addition of UDG enzyme improves the accuracy of the detection results.

[0047] In this embodiment, the kit also includes a DNA digestion reagent, which includes DNase I and DNase I buffer, for digesting DNA and improving detection efficiency.

[0048] In this embodiment, the kit also includes negative and positive controls. The negative control is DEPC water, and the positive control contains pseudoviruses containing high-risk HPV E6 / E7 mRNA fragments. The DEPC water is ultrapure water (Grade I water) treated with DEPC (Diethyl Pyrocarbonate) and autoclaved, and is a colorless liquid.

[0049] Negative and positive quality controls are used to determine the effectiveness of the reagent kit. The criteria for effectiveness are as follows: (1) Negative control samples: No amplification curves were observed in the FAM, Texas Red, and Cy5 channels, while the VIC channel showed a clear amplification curve with a Ct value ≤ 27; (2) Positive control samples: Place pseudoviruses containing E6 / E7 mRNA fragments of HPV18, HPV45, and HPV68 in reaction tube 1; place pseudoviruses containing E6 / E7 mRNA fragments of HPV16, HPV33, and HPV58 in reaction tube 2; place pseudoviruses containing E6 / E7 mRNA fragments of HPV31, HPV35, and HPV39 in reaction tube 3; place pseudoviruses containing E6 / E7 mRNA fragments of HPV51, HPV52, and HPV59 in reaction tube 4; and place pseudoviruses containing E6 / E7 mRNA fragments of HPV56 and HPV66 in reaction tube 5. In reaction tubes 1 / 2 / 3 / 4, FAM and Texas... The Red and Cy5 channels showed obvious amplification curves with Ct values ​​≤ 25, and the VIC channel showed an amplification curve with a Ct value ≤ 27. In reaction tube 5, the FAM and Cy5 channels showed obvious amplification curves with Ct values ​​≤ 25, and the VIC channel showed an amplification curve with a Ct value ≤ 27.

[0050] It should be noted that the kit's detection experiment is valid only if all of the above conditions are met simultaneously; otherwise, all experiments should be repeated.

[0051] In this embodiment, the kit also includes an internal standard solution, the components of which include pseudovirus particles containing exogenous internal standard fragments.

[0052] The reagent kit of this application embodiment has the following components, packaging and quantity (24 reactions / kit) as shown in Table 1.

[0053] Table 1. Components, Rules, and Quantities of the Reagent Kit

[0054] Based on the above kit, this application also provides a method for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA, referencing... Figure 1 The method includes the following steps: Step S10, Sample to be tested: Extract nucleic acid from the sample to be tested; Step S20: Use a DNA digestion reagent to digest the nucleic acid in the sample to be tested. Step S30: Prepare the PCR amplification reaction system. Place the nucleic acid of the DNA-digested sample into the PCR amplification reaction system for amplification reaction and release a fluorescent signal. Step S40: Generate an amplification curve based on the fluorescence signal, judge the results based on the amplification curve, and determine the specific HPV type in the sample to be tested.

[0055] It should be understood that the method for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA in the embodiments of this application is for non-diagnostic purposes.

[0056] The following section provides a further explanation of the method for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA through specific implementation details.

[0057] 1. Preparation of PCR amplification reaction system Take reaction solutions A1, A2, A3, A4, A5, B, and internal standard solution from the kit, thaw them at room temperature, vortex to mix, and centrifuge at 3,000 rpm for a few seconds before use.

[0058] Take N reaction tubes (N = number of samples to be tested + negative control + positive control), and prepare the single-person PCR amplification reaction system as shown in Table 2.

[0059] Table 2 PCR amplification reaction system

[0060] Mix all components thoroughly, centrifuge at 3,000 rpm for a few seconds to remove all liquid from the tube walls to the bottom, and then aliquot the 20 μL PCR amplification reaction mixture into PCR tubes. If the aliquoted PCR reaction solution is not used immediately, it should be stored at 2–8°C for no more than 4 hours, or at room temperature for no more than 1 hour.

[0061] 2. Nucleic acid extraction The sampling site was cleaned with sterile saline, and then cervical exfoliated cells were collected with a cervical brush. The cervical brush with the sample was placed into a sterile preservation tube, sealed, and used for the extraction of nucleic acid from the sample to be tested.

[0062] 3. DNA digestion Mix the DNA digestion reagent according to the following ratio for each person, based on the sample to be tested, negative control, and positive control.

[0063] Table 3 DNA Digestion Reagents

[0064] After mixing, incubate at 27°C for 35 minutes.

[0065] After DNA digestion, DNA digestion enzymes are inactivated: the digested DNA product is incubated at 65°C for 10 minutes to inactivate DNA enzyme I.

[0066] 4. Adding samples Add 5 µL each of the test sample nucleic acid treated with DNase I, negative control, and positive control to PCR reaction tubes containing 20 µL of PCR amplification reaction system, making the total reaction volume 25 µL. Tightly cap the tubes, vortex to mix, and centrifuge briefly at 1500 rpm before transferring to the amplification detection area. Refer to the table below for sample loading layout: Table 4 Sampling Layout

[0067] 5. PCR amplification reaction Place the PCR reaction tube into the sample slot of the instrument.

[0068] ABI 7500 Instrument Setup: First, turn on the computer, then turn on the power to the quantitative PCR instrument, and finally launch the ABI 7500 software. Click File → New Experiment in the menu, select Advanced Stetup, open a blank file, and edit the experiment name in "Experiment Name". Open the "Plate Stetup" window, click the Add New Taget button to create a new probe, and set the probe detection modes as follows: the four "Reporter Dye1" modes are FAM, VIC, Texas Red, and Cy5, respectively, and the four "Quencher Dye1" modes are all set to none. Click the "Assign Target Samples" button, set the negative control (NTC), positive control, and unknown sample (Unknown) in the corresponding sample order, and set the sample name in the "Sample Name" field. Passive Reference: none. Open the Run Method window, set the reaction volume to 25 μL, and set the cycling conditions as follows: Table 5 Loop Conditions

[0069] After setting it up, save the file and run the program.

[0070] 6. Results Analysis After the run is complete, the results are automatically saved. Adjust the Start, End, and Threshold values ​​of the Baseline based on the analyzed images (users can adjust these values ​​according to their actual situation; the Start value can be set between 3 and 15, and the End value between 5 and 20. Set the Threshold Value in the Log graph window so that the threshold line is located in the exponential phase of the amplification curve, and the amplification curve of the negative control is flat or below the threshold line). Click Analysis to automatically obtain the analysis results. View the results in the Report interface and record the Ct value of the unknown sample.

[0071] 7. Quality Control (1) Negative control samples: No amplification curves were observed in the FAM, Texas Red, and Cy5 channels, while the VIC channel showed a clear amplification curve with a Ct value ≤ 27; (2) Positive control samples: In reaction tubes 1 / 2 / 3 / 4, the FAM, Texas Red, and Cy5 channels have obvious amplification curves with Ct values ​​≤25, and the VIC channel has an amplification curve with Ct values ​​≤27; In reaction tube 5, the FAM and Cy5 channels have obvious amplification curves with Ct values ​​≤25, and the VIC channel has an amplification curve with Ct values ​​≤27.

[0072] If all of the above conditions are met simultaneously, the test is valid; otherwise, all tests should be repeated.

[0073] 8. Result Judgment Based on the test results of the samples, the positive cutoff value for the FAM, Texas Red, and Cy5 channels of this kit is determined to be Ct value equal to 32, and the positive cutoff value for the VIC channel is determined to be Ct value equal to 30.

[0074] 9. Interpretation of Results (1) Negative and positive control samples must be tested before each experiment. The test results can only be judged if the results of the control samples meet the quality control requirements. Otherwise, the experiment is invalid and it is recommended to repeat the test.

[0075] (2) The criteria for judging the results of human papillomavirus (HPV) genotyping are detailed in the table below: Table 6. Criteria for Judging Results

[0076] This application embodiment also performs sensitivity testing on the above-mentioned reagent kit, and the specific process is as follows: The sensitivity sample consisted of pseudoviruses containing mRNA fragments of 14 high-risk HPV types E6 / E7, diluted to 2.0 × 10⁻⁶ mRNA. 2 The copies / mL value is used as a sensitivity reference and is labeled M1; the positive control is an extract of pseudoviruses containing 14 high-risk HPV E6 / E7 mRNA fragments, and the negative control is DEPC aqueous extract.

[0077] The extracted positive control, negative control, and sensitivity reference nucleic acids were digested using DNase I. The deionized nucleic acids were then added to eight-tube PCR reaction mixtures, making the total volume of each tube 25 μL. The tubes were then tightly capped. The mixture was thoroughly mixed and centrifuged at high speed for 10 seconds for PCR amplification.

[0078] PCR amplification conditions: 50℃ for 15 minutes, 1 cycle; 95℃ for 2 minutes, 1 cycle; 95℃ for 10 seconds, 57℃ for 30 seconds, 10 cycles; 95℃ for 15 seconds → 55℃ for 35 seconds, 35 cycles; The reaction tubes after the PCR reaction were placed on an ABI 7500 instrument to test the limit of detection of this application. The results are shown in Table 7.

[0079] Table 7 Sensitivity Detection Results

[0080] The reference sample M1, which represents the limit of detection (LOD) of the kit, was tested three times, and all results were positive. Therefore, the LOD of this application is 2.0 × 10⁻⁶. 2 copies / mL.

[0081] This application also provides a kit-specific detection method, as detailed below: Specific testing samples include pseudoviruses containing target fragments of HPV 6, 11, 26, 40, 42, 43, 44, 53, 54, 61, 67, 69, 70, 71, 72, 73, 81, 82, and 83 E6 / E7 mRNA, as well as other pathogens of similar species or causing similar symptoms (such as Chlamydia trachomatis, Ureaplasma urealyticum, Herpes simplex virus type 2, and Cytomegalovirus). Positive control samples are extracts of pseudoviruses containing E6 / E7 mRNA fragments of 14 high-risk HPV types, and negative control samples are DEPC aqueous extracts.

[0082] The extracted positive control, negative control, and specific sample nucleic acids were digested using DNase I. The deionized nucleic acids were then added to eight-tube PCR reaction mixtures, making the total volume of each tube 25 μL. The tubes were then tightly capped. After thorough mixing, the tubes were centrifuged at high speed for 10 seconds for PCR amplification.

[0083] PCR amplification conditions: 50℃ for 15 minutes, 1 cycle; 95℃ for 2 minutes, 1 cycle; 95℃ for 10 seconds, 57℃ for 30 seconds, 10 cycles; 95℃ for 15 seconds → 55℃ for 35 seconds, 35 cycles; The PCR reaction tubes were placed on an ABI 7500 instrument to test specificity, and the results are shown in Table 8.

[0084] Table 8 Specific Detection Results

[0085] Obviously, the embodiments described above are only some embodiments of this application, not all embodiments. The accompanying drawings show preferred embodiments of this application, but do not limit the patent scope of this application. This application can be implemented in many different forms; rather, the purpose of providing these embodiments is to provide a more thorough and comprehensive understanding of the disclosure of this application. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or make equivalent substitutions for some of the technical features. Any equivalent structures made using the content of this application's specification and drawings, directly or indirectly applied to other related technical fields, are similarly within the scope of patent protection of this application. sequence list <110> Guangzhou Da An Gene Co., Ltd. <120> Primers, probes, kits, and applications for quantitative real-time detection of human papillomavirus E6 / E7 mRNA. <140> 202210551144.0 <141> 2022-05-18 <160> 45 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 1 Ala Ala Ala Cys Cys Gly Thr Thr Gly Thr Gly Thr Gly Ala Thr Thr 1 5 10 15 Thr Gly Thr Thr Ala 20 <210> 2 <211> twenty one <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 2 Cys Cys Gly Ala Cys Cys Cys Cys Thr Thr Ala Thr Ala Thr Thr Ala 1 5 10 15 Thr Gly Gly Ala Ala 20 <210> 3 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 3 Cys Thr Gly Thr Cys Ala Ala Ala Ala Gly Cys Cys Ala Cys Thr Gly 1 5 10 15 Thr Gly Thr Cys Cys 20 <210> 4 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 4 Cys Gly Ala Cys Gly Cys Ala Gly Ala Gly Ala Ala Ala Cys Ala Cys 1 5 10 15 Ala Ala <210> 5 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 5 Thr Cys Thr Gly Ala Gly Thr Cys Gly Cys Thr Thr Ala Ala Thr Thr 1 5 10 15 Gly Cys Thr <210> 6 <211> 20 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 6 Ala Thr Gly Cys Ala Thr Gly Gly Ala Cys Cys Thr Ala Ala Gly Gly 1 5 10 15 Cys Ala Ala Cys 20 <210> 7 <211> 23 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 7 Thr Thr Gly Thr Thr Ala Ala Thr Thr Ala Gly Gly Thr Gly Thr Ala 1 5 10 15 Thr Ala Ala Cys Gly Thr Gly 20 <210> 8 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 8 Thr Ala Thr Gly Cys Ala Ala Cys Gly Thr Cys Cys Thr Gly Thr Cys 1 5 10 15 Cys Ala <210> 9 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 9 Ala Ala Gly Ala Cys Cys Gly Thr Thr Gly Thr Gly Thr Cys Cys Ala 1 5 10 15 Gly Ala <210> 10 <211> 23 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 10 Ala Thr Thr Thr Cys Ala Thr Ala Ala Thr Ala Thr Thr Thr Cys Gly 1 5 10 15 Gly Gly Thr Cys Gly Thr Thr 20 <210> 11 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 11 Thr Thr Thr Ala Cys Ala Cys Gly Thr Cys Ala Cys Ala Gly Thr Gly 1 5 10 15 Cys Ala Gly <210> 12 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 12 Cys Thr Ala Cys Gly Thr Cys Gly Gly Gly Ala Cys Cys Thr Cys Cys 1 5 10 15 Ala Ala Cys <210> 13 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 13 Thr Thr Cys Cys Ala Thr Ala Ala Cys Ala Thr Cys Gly Gly Thr Gly 1 5 10 15 Gly Ala Cys <210> 14 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 14 Ala Thr Gly Ala Thr Thr Ala Cys Ala Cys Cys Thr Cys Gly Gly Thr 1 5 10 15 Thr Thr <210> 15 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 15 Ala Ala Cys Ala Gly Gly Ala Cys Ala Thr Ala Cys Ala Cys Cys Gly 1 5 10 15 Ala Cys Cys <210> 16 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 16 Gly Gly Ala Cys Ala Thr Thr Ala Cys Ala Ala Thr Ala Gly Cys Cys 1 5 10 15 Thr Gly <210> 17 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 17 Ala Ala Thr Thr Cys Ala Thr Ala Thr Ala Cys Cys Thr Cys Gly Gly 1 5 10 15 Thr Thr Thr <210> 18 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 18 Thr Cys Thr Ala Thr Thr Gly Cys Ala Gly Ala Cys Gly Ala Cys Cys 1 5 10 15 Ala Cys Thr <210> 19 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 19 Thr Thr Ala Gly Thr Cys Ala Thr Gly Cys Ala Cys Ala Ala Cys Thr 1 5 10 15 Ala Cys Cys Ala Gly 20 <210> 20 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 20 Gly Cys Thr Cys Ala Ala Thr Thr Cys Thr Gly Cys Cys Gly Thr Cys 1 5 10 15 Ala Cys Ala <210> 21 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 21 Cys Cys Gly Ala Cys Gly Ala Gly Cys Cys Gly Ala Ala Cys Cys Ala 1 5 10 15 Cys Ala <210> 22 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 22 Thr Thr Gly Gly Gly Cys Cys Thr Gly Ala Ala Gly Ala Ala Ala Ala 1 5 10 15 Gly Cys Ala Ala Ala 20 <210> 23 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 23 Gly Cys Thr Thr Thr Ala Thr Thr Ala Cys Ala Cys Thr Thr Gly Gly 1 5 10 15 Gly Thr Thr Thr Cys 20 <210> 24 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 24 Ala Thr Thr Ala Gly Cys Gly Cys Ala Thr Thr Gly Cys Cys Cys Cys 1 5 10 15 Gly Thr Cys <210> 25 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 25 Thr Thr Gly Ala Gly Gly Ala Thr Cys Cys Ala Gly Cys Ala Ala Cys 1 5 10 15 Ala Cys <210> 26 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 26 Cys Cys Thr Thr Ala Thr Thr Thr Cys Ala Thr Gly Cys Ala Cys Cys 1 5 10 15 Gly Ala Thr <210> 27 <211> 20 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 27 Cys Ala Gly Cys Ala Cys Cys Thr Cys Ala Cys Ala Cys Ala Ala Thr 1 5 10 15 Thr Cys Gly Thr 20 <210> 28 <211> 23 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 28 Thr Ala Ala Thr Ala Cys Ala Cys Gly Thr Ala Cys Cys Thr Thr Gly 1 5 10 15 Thr Thr Gly Thr Gly Ala Gly 20 <210> 29 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 29 Thr Ala Ala Cys Gly Cys Ala Cys Cys Cys Ala Thr Ala Ala Gly Cys 1 5 10 15 Ala Gly <210> 30 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 30 Ala Cys Ala Cys Gly Cys Ala Gly Gly Thr Cys Cys Thr Cys Thr Thr 1 5 10 15 Thr Gly Gly Thr Ala 20 <210> 31 <211> 24 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 31 Gly Thr Thr Thr Cys Ala Thr Ala Ala Thr Ala Thr Thr Thr Cys Gly 1 5 10 15 Gly Gly Thr Cys Gly Thr Thr Gly 20 <210> 32 <211> 22 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 32 Thr Ala Thr Ala Thr Thr Cys Thr Cys Thr Thr Ala Gly Cys Gly Thr 1 5 10 15 Thr Gly Gly Gly Thr Thr 20 <210> 33 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 33 Cys Thr Cys Thr Cys Ala Thr Gly Gly Cys Gly Thr Thr Gly Thr Thr 1 5 10 15 Ala Cys Ala Gly Gly 20 <210> 34 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 34 Ala Thr Thr Ala Gly Ala Gly Gly Cys Thr Gly Ala Ala Ala Cys Cys 1 5 10 15 Ala Ala Gly <210> 35 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 35 Ala Cys Ala Thr Ala Gly Ala Gly Gly Thr Thr Thr Thr Ala Gly Gly 1 5 10 15 Cys Ala Thr <210> 36 <211> 21 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 36 Ala Thr Ala Ala Cys Ala Gly Cys Gly Thr Ala Thr Cys Ala Gly Cys 1 5 10 15 Ala Gly Cys Thr Cys 20 <210> 37 <211> 24 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 37 Thr Ala Ala Gly Thr Gly Thr Thr Ala Cys Cys Thr Ala Ala Thr Thr 1 5 10 15 Cys Ala Cys Gly Thr Ala Cys Cys 20 <210> 38 <211> 17 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 38 Thr Thr Gly Thr Ala Cys Cys Ala Cys Ala Cys Gly Thr Ala Gly Cys 1 5 10 15 Thr <210> 39 <211> 22 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 39 Thr Cys Thr Gly Ala Ala Thr Gly Thr Cys Cys Ala Ala Cys Thr Gly 1 5 10 15 Cys Ala Cys Cys Ala Cys 20 <210> 40 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 40 Thr Gly Ala Gly Thr Thr Gly Cys Cys Thr Gly Ala Ala Ala Cys Cys 1 5 10 15 Ala Thr <210> 41 <211> 20 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 41 Thr Cys Cys Thr Gly Thr Ala Ala Ala Gly Thr Thr Thr Cys Cys Thr 1 5 10 15 Gly Cys Thr Ala 20 <210> 42 <211> 22 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 42 Ala Ala Gly Gly Cys Ala Cys Cys Thr Ala Ala Cys Ala Ala Cys Ala 1 5 10 15 Ala Ala Ala Cys Gly Ala 20 <210> 43 <211> 19 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 43 Thr Gly Cys Ala Cys Thr Thr Gly Ala Ala Thr Ala Thr Gly Thr Gly 1 5 10 15 Gly Cys Thr <210> 44 <211> 18 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 44 Gly Thr Thr Thr Thr Cys Ala Cys Ala Ala Thr Cys Gly Gly Ala Cys 1 5 10 15 Cys Thr <210> 45 <211> 24 <212> PRT <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 45 Ala Thr Thr Cys Ala Cys Thr Thr Gly Ala Gly Ala Thr Cys Ala Ala 1 5 10 15 Ala Gly Thr Ala Cys Cys Cys Ala 20

Claims

1. Primers and probes for quantitative real-time detection of human papillomavirus E6 / E7 mRNA, characterized in that, The primers include a high-risk HPV detection primer set and an exogenous internal standard primer pair; the probes include a high-risk HPV detection probe and an exogenous internal standard probe; The high-risk HPV detection primer set includes HPV16 primer pair, HPV18 primer pair, HPV31 primer pair, HPV33 primer pair, HPV35 primer pair, HPV39 primer pair, HPV45 primer pair, HPV51 primer pair, HPV52 primer pair, HPV56 primer pair, HPV58 primer pair, HPV59 primer pair, HPV66 primer pair, and HPV68 primer pair; and the high-risk HPV detection probe includes HPV16 probe, HPV18 probe, HPV31 probe, HPV33 probe, HPV35 probe, HPV39 probe, HPV45 probe, HPV51 probe, HPV52 probe, HPV56 probe, HPV58 probe, HPV59 probe, HPV66 probe, and HPV68 probe; The HPV16 primer pair includes an HPV16 upstream primer and an HPV16 downstream primer, wherein the sequence number of the HPV16 upstream primer is SEQ ID NO:1, the sequence number of the HPV16 downstream primer is SEQ ID NO:2, and the sequence number of the HPV16 probe is SEQ ID NO:

3. The HPV18 primer pair includes an HPV18 upstream primer and an HPV18 downstream primer, wherein: the sequence number of the HPV18 upstream primer is SEQ ID NO:4, the sequence number of the HPV18 downstream primer is SEQ ID NO:5, and the sequence number of the HPV18 probe is SEQ ID NO:6; The HPV31 primer pair includes an HPV31 upstream primer and an HPV31 downstream primer, wherein the sequence number of the HPV31 upstream primer is SEQ ID NO:7, the sequence number of the HPV31 downstream primer is SEQ ID NO:8, and the sequence number of the HPV31 probe is SEQ ID NO:

9. The HPV33 primer pair includes an HPV33 upstream primer and an HPV33 downstream primer, wherein the sequence number of the HPV33 upstream primer is SEQ ID NO:10, the sequence number of the HPV33 downstream primer is SEQ ID NO:11, and the sequence number of the HPV33 probe is SEQ ID NO:

12. The HPV35 primer pair includes an HPV35 upstream primer and an HPV35 downstream primer, wherein the sequence number of the HPV35 upstream primer is SEQ ID NO:13, the sequence number of the HPV35 downstream primer is SEQ ID NO:14, and the sequence number of the HPV35 probe is SEQ ID NO:

15. The HPV39 primer pair includes an HPV39 upstream primer and an HPV39 downstream primer, wherein the sequence number of the HPV39 upstream primer is SEQ ID NO:16, the sequence number of the HPV39 downstream primer is SEQ ID NO:17, and the sequence number of the HPV39 probe is SEQ ID NO:

18. The HPV45 primer pair includes an HPV45 upstream primer and an HPV45 downstream primer, wherein the sequence number of the HPV45 upstream primer is SEQ ID NO:19, the sequence number of the HPV45 downstream primer is SEQ ID NO:20, and the sequence number of the HPV45 probe is SEQ ID NO:

21. The HPV51 primer pair includes an HPV51 upstream primer and an HPV51 downstream primer, wherein the sequence number of the HPV51 upstream primer is SEQ ID NO:22, the sequence number of the HPV51 downstream primer is SEQ ID NO:23, and the sequence number of the HPV51 probe is SEQ ID NO:

24. The HPV52 primer pair includes an HPV52 upstream primer and an HPV52 downstream primer, wherein the sequence number of the HPV52 upstream primer is SEQ ID NO:25, the sequence number of the HPV52 downstream primer is SEQ ID NO:26, and the sequence number of the HPV52 probe is SEQ ID NO:

27. The HPV56 primer pair includes an HPV56 upstream primer and an HPV56 downstream primer, wherein the sequence number of the HPV56 upstream primer is SEQ ID NO:28, the sequence number of the HPV56 downstream primer is SEQ ID NO:29, and the sequence number of the HPV56 probe is SEQ ID NO:

30. The HPV58 primer pair includes an HPV58 upstream primer and an HPV58 downstream primer, wherein the sequence number of the HPV58 upstream primer is SEQ ID NO:31, the sequence number of the HPV58 downstream primer is SEQ ID NO:32, and the sequence number of the HPV58 probe is SEQ ID NO:

33. The HPV59 primer pair includes an HPV59 upstream primer and an HPV59 downstream primer, wherein the sequence number of the HPV59 upstream primer is SEQ ID NO:34, the sequence number of the HPV59 downstream primer is SEQ ID NO:35, and the sequence number of the HPV59 probe is SEQ ID NO:

36. The HPV66 primer pair includes an HPV66 upstream primer and an HPV66 downstream primer, wherein the sequence number of the HPV66 upstream primer is SEQ ID NO:37, the sequence number of the HPV66 downstream primer is SEQ ID NO:38, and the sequence number of the HPV66 probe is SEQ ID NO:

39. The HPV68 primer pair includes an HPV68 upstream primer and an HPV68 downstream primer, wherein the sequence number of the HPV68 upstream primer is SEQ ID NO:40, the sequence number of the HPV68 downstream primer is SEQ ID NO:41, and the sequence number of the HPV68 probe is SEQ ID NO:

42. The exogenous internal standard primer pair includes an upstream internal standard primer and a downstream internal standard primer, wherein the sequence number of the upstream internal standard primer is SEQ ID NO:43, the sequence number of the downstream internal standard primer is SEQ ID NO:44, and the sequence number of the exogenous internal standard probe is SEQ ID NO:

45.

2. A kit for quantitative real-time detection of human papillomavirus E6 / E7 mRNA, characterized in that, It includes the primers and probes as described in claim 1 and a PCR buffer, wherein the components of the PCR buffer include (NH4)2SO4, KCl, Tris-HCl, and MgCl2.

3. The kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA according to claim 2, characterized in that, The kit also includes one or more of dUTPs, Taq enzyme, reverse transcriptase, UDG enzyme, and RNase inhibitors.

4. The kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA according to claim 3, characterized in that, The kit also includes a negative control and a positive control. The negative control is DEPC water, and the positive control contains a pseudovirus containing a high-risk HPVE6 / E7 mRNA fragment.

5. The kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA according to claim 2, characterized in that, The kit also includes an internal standard solution, the components of which include a pseudovirus containing an exogenous internal standard fragment.

6. The kit for quantitative fluorescence detection of human papillomavirus E6 / E7 mRNA according to claim 2, characterized in that, The kit also includes a DNA digestion reagent, which includes DNase I and DNase I buffer.

7. The use of the kit according to any one of claims 2 to 6 in the detection of high-risk human papillomavirus E6 / E7 mRNA for non-diagnostic purposes, wherein the high-risk human papillomavirus is HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

Citation Information

Patent Citations

  • Primer, probe and kit for fluorescence quantitative detection of human papilloma virus E6 / E7 mRNA and application

    CN117126963A

  • Composition for detecting and typing high-risk HPV, kit and method

    CN110317901A