Novel anti-hepatitis b compounds

Abstract

Provided are compounds, isomers thereof, or pharmaceutically acceptable salts thereof, for treating and preventing hepatitis B virus infection, pharmaceutical compositions containing the compounds, methods for preparing the compounds, and methods for treating and preventing hepatitis B using the compounds. Specifically, provided are compounds represented by Formula (I), isomers thereof, or pharmaceutically acceptable salts thereof.

Description

[0001] This application claims priority to Chinese Patent Application No. CN202110703116.1, filed on June 24, 2021, entitled "Novel Anti-Hepatitis B Compound"; Chinese Patent Application No. CN202111089629.4, filed on September 17, 2021, entitled "Novel Anti-Hepatitis B Compound"; and Chinese Patent Application No. CN202210645720.8, filed on June 9, 2022, entitled "Novel Anti-Hepatitis B Compound", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to a class of compounds for the treatment and prevention of hepatitis B virus infection. Specifically, it relates to compounds of formula (I) or pharmaceutically acceptable salts thereof, pharmaceutical compositions containing said compounds, methods of preparation, and methods of using said compounds to treat and prevent hepatitis B. Background Technology

[0003] Hepatitis B virus (HBV) belongs to the Hepatoviridae family and can cause acute, persistent, or progressively chronic diseases. It can also cause many other pathological and clinical manifestations, especially chronic liver inflammation, cirrhosis, and hepatocellular carcinoma. Co-infection with hepatitis D can have adverse effects on the development of the disease. HBV is a spherical DNA virus with a diameter of approximately 42 nm, forming a dual structure: the outer layer consists of HBs antigen (HBsAg), and the inner layer consists of HBc antigen (HBcAg) and genetic DNA (Tanaka et al., Modern Media Vol.54, No.12, pp.347–352).

[0004] HBsAg is a glycosylated envelope protein on the surface of mature HBV, encoded and synthesized by HBV outer membrane genes. These viral antigens (mainly surface antigens and subviral particles) secreted into the bloodstream suppress the human immune system's immunity against HBV, playing a crucial role in HBV "immune tolerance" and the development of chronic hepatitis B. HBsAg quantification is a significant biomarker for prognosis and treatment response in chronic hepatitis B. Although HBsAg loss and seroconversion are rarely observed in chronically infected patients, they remain the ultimate goal of treatment.

[0005] Current therapies, such as those using nucleoside analogs to inhibit HBV DNA synthesis, do not lower HBsAg levels, thus their effectiveness in treating hepatitis B is insufficient. In 2017-2018, a class of compounds that can inhibit HBsAg were reported; however, these drugs only achieve HBsAg seroconversion in a very small number of patients, reaching the desired endpoint, while HBsAg persists in the body, causing systemic immunosuppression. For example, small molecule drugs can reduce HBsAg levels by inducing HBV RNA degradation. Oligonucleotide drugs can prevent HBsAg release and reduce intracellular HBsAg levels by blocking the assembly of HBV subviral particles.

[0006] Therefore, clearing HBsAg and restoring the body's normal immune function is an important pathway to achieving a cure and functional cure for chronic hepatitis B. Furthermore, clinically, it is hoped that HBsAg inhibitors can be used in combination with antiviral drugs (such as nucleotides or interferons) to achieve a curative effect against hepatitis B. Currently, there are few domestic developers targeting this target; only Fujian Guang Sheng Tang has applied for clinical trials of a small-molecule HBsAg inhibitor. This invention aims to develop a novel compound with inhibitory activity against HBsAg and a lower risk of neurotoxicity. Summary of the Invention

[0007] The present invention aims to provide a compound having anti-HBV activity and inhibitory activity against HBsAg, its isomer or a pharmaceutically acceptable salt thereof, a pharmaceutical composition containing said compound, a method for preparing said compound, and its use in treating hepatitis B.

[0008] Specifically, the present invention provides the compound of formula (I), its isomers or pharmaceutically acceptable salts thereof.

[0009]

[0010] in,

[0011] R2 is selected from 5-6 aryl or 5-6 heteroaryl groups; wherein the 5-6 aryl or 5-6 heteroaryl group is optionally surrounded by m R groups. x The group replaced, wherein the R x Selected from R xa Or R xb R xa Selected from hydrogen, halogen, cyano, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Alkoxy-C 1-4 Alkoxy, C 1-4 Haloalkyl, di(C) 1-4 alkyl)-amino, 5-6 membered heteroaryl, C 1-4 Alkyl group, Rxb Selected from 4-7-membered heterocyclic alkyl groups, 5-6-membered heteroaryl groups, C 4-6 Cycloalkyl, 5-6 membered heterocycloalkyl and 5-6 membered heterocycloalkyl, 5-6 membered heterocycloalkyl and 3-5 membered cycloalkyl, wherein R xb Randomly select r R xc Group substitution, R xc Selected from hydrogen, halogens, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Haloalkyl, where m represents an integer of 0, 1, 2, or 3, and r represents an integer of 0, 1, or 2;

[0012] R3 is selected from H and C. 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Haloalkyl, C 1-4 Halogenated alkoxy groups;

[0013] R4 is selected from C 4-6 Cycloalkyl, amino, 4-7 membered heterocyclic alkyl, 5-6 membered aryl, 5-6 membered aryl and 5-6 membered heterocyclic alkyl, 5-6 membered heterocyclic alkyl and 5-6 membered heterocyclic alkyl, 5-6 membered heterocyclic alkyl and 3-5 membered cycloalkyl, 7-10 membered spirocyclic alkyl, wherein the above groups are optionally surrounded by 1, 2 or 3 R y replace;

[0014] Where R y Selected from hydroxyl C 1-4 Alkyl, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Haloalkyl, di(C) 1-4 Alkyl)-amino, hydroxyl, 4-7 membered heterocyclic alkyl, 5-6 membered heteroaryl, C 4-6 cycloalkyl, halogen, cyano, wherein the C 1-4 Alkyl, C 1-4 Alkoxy, 4-7 membered heterocyclic alkyl, 5-6 membered heteroaryl, optionally C-shaped. 1-4 Alkyl, C 1-4 Alkyl-substituted.

[0015] In some embodiments of the present invention, the above-mentioned R xa Selected from H, F, Cl, Br, CN, -CH3, -CF3, -OCH3, -N(CH3)2, CH3OCH2CH2CH2O-, -C(O)CH3.

[0016] In some embodiments of the present invention, the above-mentioned R xa Selected from -CF3, CN.

[0017] In some embodiments of the present invention, the above-mentioned R xc Selected from -OCH3, F, -CH3.

[0018] In some embodiments of the present invention, the above-mentioned R xb Selected from Where R xc r is as defined above.

[0019] In some embodiments of the present invention, the above-mentioned R xb Selected from Where R xc r is as defined above.

[0020] In some embodiments of the present invention, the above-mentioned R y Selected from -CH3, -OCH3, -N(CH3)2, CH3OCH2CH2-, CH3OCH2-, -OH, -CH2OH, -CH2CH2OH, -CH2C(CH3)2OH.

[0021] In some embodiments of the present invention, R2 is selected from... Where T1 is selected from CH or N; R x m is as defined above.

[0022] In some embodiments of the present invention, R2 is selected from... Where R x Selected from R xb And the R xb Selected from pyrroloalkyl groups, m as defined above.

[0023] In some embodiments of the present invention, R2 is selected from... Where R xa R xb As defined above, p is an integer selected from 0, 1, or 2.

[0024] In some embodiments of the present invention, R2 is selected from... Where R xa p, R xc r is as defined above.

[0025] In some embodiments of the present invention, R2 is selected from the following groups:

[0026] In the structural formula, "*" represents a chiral carbon atom.

[0027] In some embodiments of the present invention, R4 is selected from the following groups:

[0028] In the structural formula, "*" represents a chiral carbon atom.

[0029] In some embodiments of the present invention, R4 is selected from the following groups:

[0030]

[0031] In some embodiments of the present invention, the compound represented by formula (I), its isomers, or pharmaceutically acceptable salts thereof, having a structure of formula (II) is used.

[0032]

[0033] Among them, R x R3, R4, T1 and m are as defined above.

[0034] In some embodiments of the invention, the compound represented by formula (II), its isomers, or pharmaceutically acceptable salts thereof, having structures of formulas (IIa) and (IIb) are used.

[0035]

[0036] Among them, R3, R4, R x m, R xa R xb p is as defined above.

[0037] In some embodiments of the present invention, the compound represented by formula (II), its isomers, or pharmaceutically acceptable salts thereof, having a structure of formula (IIc) is used.

[0038]

[0039] Among them, R xa R4, p, R xc And r as defined above.

[0040] The present invention also includes some solutions derived from arbitrary combinations of the above variables.

[0041] The present invention also provides the following compounds, their isomers, or pharmaceutically acceptable salts thereof.

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048] In some embodiments of the present invention, the compounds of the present invention, their isomers, or pharmaceutically acceptable salts thereof are used to treat or prevent hepatitis B virus infection.

[0049] In some embodiments of the invention, the compounds of the invention, their isomers, or pharmaceutically acceptable salts thereof are used as inhibitors of hepatitis B virus DNA production.

[0050] In some embodiments of the invention, the compounds of the invention, their isomers, or pharmaceutically acceptable salts thereof are used as HBsAg inhibitors.

[0051] The present invention also provides a pharmaceutical composition comprising the compound described herein, its isomers, or pharmaceutically acceptable salts thereof as an active ingredient and a pharmaceutically acceptable carrier.

[0052] The present invention also provides an inhibitor of hepatitis B virus DNA production, comprising the compound described herein, its isomers, or pharmaceutically acceptable salts thereof.

[0053] The present invention also provides an HBsAg inhibitor comprising the compound described herein, its isomers, or a pharmaceutically acceptable salt thereof.

[0054] In some embodiments of the invention, the use of the compounds of the invention, their isomers or pharmaceutically acceptable salts thereof, or the pharmaceutical compositions of the invention in the preparation of medicaments for the treatment or prevention of hepatitis B virus infection.

[0055] In some embodiments of the invention, the use of the compounds of the invention, their isomers or pharmaceutically acceptable salts thereof, or the pharmaceutical compositions of the invention in the preparation of a medicament for inhibiting the production or secretion of HBsAg.

[0056] The present invention also provides a method for treating or preventing hepatitis B virus infection, comprising administering to a patient a therapeutically effective amount of the compound of the present invention, its isomers or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the compound of the present invention, its isomers or pharmaceutically acceptable salts thereof.

[0057] Technical effect

[0058] The compounds of this invention exhibit good anti-HBV activity and good inhibitory effect on HBsAg, and have a higher liver / plasma distribution ratio and lower brain / cerebrospinal fluid exposure, further reducing the risk of neurotoxicity.

[0059] Definitions and Explanations

[0060] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its ordinary sense. When a trade name appears herein, it is intended to refer to the corresponding product or its active ingredient.

[0061] The term “pharmaceutically acceptable” as used herein refers to compounds, materials, compositions, and / or dosage forms that, within the bounds of reliable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0062] The term "pharmaceutically acceptable salt" refers to the salt of the compounds of this invention, prepared by reacting a compound with a relatively non-toxic acid or base, as discovered in this invention, with a specific substituent. When the compounds of this invention contain relatively acidic functional groups, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of base in a pure solution or a suitable inert solvent. When the compounds of this invention contain relatively basic functional groups, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of acid in a pure solution or a suitable inert solvent.

[0063] The pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing acid radicals or bases by conventional chemical methods. Generally, such salts are prepared by reacting these compounds in free acid or base form with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture thereof.

[0064] The compounds of this invention can exist in specific geometric or stereoisomeric forms. This invention contemplates all such compounds, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, and racemic mixtures thereof, as well as other mixtures, such as mixtures enriched with enantiomers or diastereomers, all of which are within the scope of this invention. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are included within the scope of this invention.

[0065] Unless otherwise stated, the terms "enantiomer" or "optical isomer" refer to stereoisomers that are mirror images of each other.

[0066] Unless otherwise stated, the terms "cis-trans isomers" or "geometric isomers" arise because the single bonds of double bonds or cyclic carbon atoms cannot rotate freely.

[0067] Unless otherwise stated, the term "diastereomer" refers to a stereoisomer of a molecule having two or more chiral centers and being in a non-mirror relationship with each other.

[0068] Unless otherwise stated, "(D)" or "(+)" indicates right-handed rotation, "(L)" or "(-)" indicates left-handed rotation, and "(DL)" or "(±)" indicates racemic rotation.

[0069] Unless otherwise specified, use wedge-shaped solid line keys. and wedge-shaped dashed key The absolute configuration of the center of a solid is represented by a straight solid line key. and straight dashed key The relative configuration of the center of a solid is indicated by a wavy line. Indicates wedge-shaped solid line key or wedge-shaped dashed key Or use wavy lines Indicates a straight solid line key and straight dashed key

[0070] The compounds of this invention can exist in specific forms. Unless otherwise stated, the terms "tautomer" or "tautomer form" refer to isomers of different functional groups in dynamic equilibrium at room temperature, capable of rapidly interconverting into each other. If tautomerization is possible (e.g., in solution), chemical equilibrium of the tautomer can be achieved. For example, proton tautomers (also called prototropic tautomers) include interconversions via proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers include interconversions involving the rearrangement of some bonding electrons. A specific example of keto-enol tautomerization is the interconversion between the two tautomers, pentane-2,4-dione and 4-hydroxypent-3-en-2-one.

[0071] Unless otherwise stated, the terms "rich in one isomer," "isomer enrichment," "rich in one enantiomer," or "enantiomer enrichment" mean that the content of one isomer or enantiomer is less than 100%, and the content of the isomer or enantiomer is greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 80%, or greater than or equal to 90%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than or equal to 98%, or greater than or equal to 99%, or greater than or equal to 99.5%, or greater than or equal to 99.6%, or greater than or equal to 99.7%, or greater than or equal to 99.8%, or greater than or equal to 99.9%.

[0072] Unless otherwise stated, the terms "isomer excess" or "enantiomer excess" refer to the difference between the relative percentages of two isomers or two enantiomers. For example, if one isomer or enantiomer is 90% and the other isomer or enantiomer is 10%, then the isomer or enantiomer excess (ee value) is 80%.

[0073] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound of the present invention, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated, and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase, optionally combined with chemical derivatization (e.g., from amines to carbamates).

[0074] The compounds of this invention may contain atomic isotopes in non-natural proportions on one or more atoms constituting the compound. For example, the compounds may be labeled with radioactive isotopes, such as tritium. 3 H), Iodine-125 125 I) or C-14 14 C). For example, deuterium can be used to replace hydrogen to form deuterated drugs. The bond between deuterium and carbon is stronger than that between ordinary hydrogen and carbon. Compared with undeuterated drugs, deuterated drugs have advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged drug biological half-life. All isotopic variations of the compounds of this invention, regardless of radioactivity, are included within the scope of this invention.

[0075] "Pharmaceutically acceptable carriers" refer to media generally acceptable in the art for delivering bioactive pharmaceutical agents to animals, particularly mammals. Depending on the route of administration and dosage form, these include, for example, adjuvants, excipients, or excipients such as diluents, preservatives, fillers, flow modifiers, disintegrants, wetting agents, emulsifiers, suspending agents, sweeteners, flavoring agents, aromatizers, antibacterial agents, antifungal agents, lubricants, and dispersants. Pharmaceutically acceptable carriers are formulated based on a multitude of factors, within the scope of those skilled in the art. These include, but are not limited to, the type and nature of the formulated active pharmaceutical agent, the target population to which the composition containing the pharmaceutical agent is to be administered, the intended route of administration of the composition, and the target therapeutic indication. Pharmaceutically acceptable carriers include both aqueous and non-aqueous media, as well as various solid and semi-solid dosage forms. In addition to the active pharmaceutical agent, such carriers include many different components and additives, and the inclusion of such additional components in the formulation for various reasons (e.g., stabilizing active pharmaceutical agents, binders, etc.) is well known to those skilled in the art.

[0076] The term "excipient" generally refers to the carrier, diluent, and / or medium required to formulate an effective pharmaceutical composition.

[0077] The term "effective preventive or therapeutic dose" refers to a compound of the present invention or a pharmaceutically acceptable salt thereof in a sufficient amount to treat a disorder with a reasonable benefit / risk ratio suitable for any medical treatment and / or prevention.

[0078] "Optional substitution" or "optionally substituted" means that something may or may not be substituted, unless otherwise specified. The type and number of substituents can be arbitrary on the basis of chemical feasibility. For example, the term "optionally substituted by one or more R groups" is used in other contexts. a "Replacement" means that it can be replaced by one or more Rs a Replacement, or not by R a replace.

[0079] When the number of a linking group is 0, for example, -O(CH2) n CH3, n=0 indicates that the linking group is a single bond, i.e., -OCH3.

[0080] When a substituent's bond can be cross-linked to two atoms on a ring, this substituent can bond to any atom on that ring. For example, structural units. Indicates substituent R 12 Substitution can occur at any position on the benzene ring.

[0081] When the listed substituents do not specify which atom they are attached to in a compound included but not specifically mentioned in the general chemical formula, such substituents can be bonded to any of their atoms. For example, pyrazole as a substituent means that any carbon atom on the pyrazole ring is attached to the substituted group; when the structure contains... Or, when it is -----, it indicates that the atom is a bonding atom, for example... and Both indicate that the N atom on the morpholine ring is a bonding atom.

[0082] When the listed substituents do not specify which atom they are attached to in a compound included but not specifically mentioned in the general chemical formula, such substituents can be bonded to any of their atoms. For example, pyrazole as a substituent means that any carbon atom on the pyrazole ring is attached to the substituted group; when the structure contains... Or, when it is -----, it indicates that the atom is a bonding atom, for example... and Both indicate that the N atom on the morpholine ring is a bonding atom.

[0083] The term "substituted" means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, which can include deuterium and hydrogen variants, provided that the valence state of the particular atom is normal and the substituted compound is stable. When the substituent is oxygen (i.e., =O), it means that two hydrogen atoms are replaced. Oxygen substitution does not occur on aromatic groups. The term "optionally substituted" means that it may or may not be substituted, unless otherwise specified, and the type and number of substituents can be arbitrary on a chemically feasible basis.

[0084] When any variable (e.g., R) appears more than once in the composition or structure of a compound, its definition is independent in each case. Thus, for example, if a group is substituted by 0-2 Rs, the group can optionally be substituted by at most two Rs, and the Rs in each case have independent options. Furthermore, combinations of substituents and / or their variants are only permitted if such combinations produce a stable compound.

[0085] When the number of a linking group is 0, such as -(CRR)0-, it indicates that the linking group is a single bond.

[0086] When one of the variables is selected as a single bond, it means that the two groups it connects to are directly connected. For example, when L in ALZ represents a single bond, it means that the structure is actually AZ.

[0087] When a substituent is vacant, it means that the substituent does not exist. For example, if X is vacant in AX, the structure is actually A. When the listed substituents do not specify which atom they are attached to the substituted group through, such substituents can be bonded to any of their atoms. For example, a pyridinium group as a substituent can be attached to the substituted group through any carbon atom on the pyridine ring.

[0088] When the listed linking groups do not specify their linking direction, the linking direction is arbitrary, for example, The linker group L is -MW-. In this case, -MW- can connect ring A and ring B in the same direction as the reading order from left to right to form a ring. Alternatively, rings A and B can be connected in the opposite direction to the left-to-right reading order to form a ring. The combination of linking groups, substituents, and / or their variants is permitted only if such a combination produces a stable compound.

[0089] Unless otherwise specified, "ring" refers to a saturated, partially saturated, or unsaturated monocyclic or polycyclic ring, including fused, spirocyclic, fused, or bridged rings. Representative "rings" include substituted or unsubstituted cycloalkyl, heterocyclic alkyl, cycloalkenyl, heterocyclic alkenyl, cycloalkynyl, heterocyclic alkynyl, aryl, or heteroaryl groups. The term "hetero" refers to the substituted or unsubstituted heteroatom and its oxidation form, which is generally selected from N, O, and S, and the oxidation form generally includes NO, SO, and S(O)2. The nitrogen atom may be substituted, i.e., NR (R is H or other substituents defined herein). The number of atoms on the ring is usually defined as the ring number; for example, "3-14 membered heterocyclic alkyl" refers to a monocyclic, fused, spirocyclic, fused, or bridged heterocyclic ring composed of 3-14 atoms arranged in a ring, each ring optionally containing 1 to 3 heteroatoms, i.e., N, O, S, NO, SO, S(O)2, or NR.

[0090] Unless otherwise specified, "cycloalkyl" refers to a saturated monocyclic or polycyclic hydrocarbon group. Polycyclic hydrocarbon groups include spirocyclic, fused, or bridged groups. When the number of bridging atoms in a bridged group is zero, the bridged group is equivalent to a fused group. C is preferred. 3-8 Monocycloalkyl, more preferably C 4-6Monocyclic alkyl groups, including but not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl; "spirocyclic" refers to a polycyclic hydrocarbon group in which monocyclic rings share a single carbon atom. Spirocyclic groups are preferably 5-13 spirocyclic groups, 6-12 spirocyclic groups, or 7-11 spirocyclic groups. The 6-12 spirocyclic group refers to a hydrocarbon group whose spirocyclic skeleton structure consists of 6-12 atoms. Examples of spirocyclic groups include, but are not limited to, spiro[2.2]pentyl, spiro[2.3]hexyl, spiro[2.4]heptyl, spiro[2.5]octyl, spiro[2.6]nonyl, spiro[3.3]heptyl, spiro[3.4]octyl, spiro[3.5]nonyl, spiro[3.6]decyl, spiro[4.4]nonyl, spiro[4.5]decyl, spiro[4.6]undecyl, spiro[5.5]undecyl, spiro[5.6]dodecyl, spiro[6.6]tridecyl, and spiro[6.7]tetradecyl. "Bridged cyclic group" refers to a polycyclic hydrocarbon group that shares two or more carbon atoms. The preferred bridged ring groups are 4-13 ternary bridged ring groups, 5-12 ternary bridged ring groups, 6-12 ternary bridged ring groups, 6-11 ternary bridged ring groups, and 7-11 ternary bridged ring groups. Examples of bridged ring groups include, but are not limited to, dicyclo[3.1.0]hexyl, dicyclo[3.2.0]heptyl, dicyclo[3.3.0]octyl, dicyclo[4.1.0]heptyl, dicyclo[4.2.0]octyl, dicyclo[4.3.0]nonyl, dicyclo[4.4.0]decyl, and dicyclo[3.2.1]octyl.

[0091] Unless otherwise specified, "C 4-6 "Cycloalkyl" refers to a saturated cyclic hydrocarbon group consisting of 4 to 6 carbon atoms, which can be monocyclic or bicyclic systems. Bicyclic systems include spirocyclic, fused, and bridged rings. 4-6 Cycloalkyl groups include C 4-5 and C 5-6 Cycloalkyl groups, etc.; they can be monovalent, divalent, or polyvalent. C 4-6 Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.

[0092] Unless otherwise specified, "heterocyclic alkyl" refers to mono- and poly-heterocyclic alkyl groups containing a certain number of heteroatoms in the ring, generally selected from N, O, S, NO, SO, S(O)₂, and NR. Poly-heterocyclic alkyl groups include spirocyclic, fused-heterocyclic, or bridged-heterocyclic groups. When the bridging atom in a bridged-heterocyclic group is zero, the bridged-heterocyclic group is equivalent to a fused-heterocyclic group. Preferably, 5-10-membered heterocyclic alkyl groups are used, more preferably 5-8-membered heterocyclic alkyl groups, and even more preferably 4-7-membered heterocyclic alkyl groups. Examples of these heterocyclic alkyl groups include, but are not limited to, ethylene oxide, tetrahydropyrrolyl, piperidinyl, piperazine, morpholinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, 1,3-dioxolane, 1,4-dioxane, etc. "Spirocyclic" refers to a spirocyclic group in which one or more carbon atoms in the spirocyclic skeleton are replaced by heteroatoms selected from N, O, and S. The spiroheterocyclic group is preferably a 5-13 spiroheterocyclic group, a 6-12 spiroheterocyclic group, or a 7-11 spiroheterocyclic group, more preferably a 7-10 spiroheterocyclic group, and even more preferably a 9 spiroheterocyclic group. Examples of spirocyclic compounds include, but are not limited to, 7-oxa-2-azaspiro[3.5]nonane-2-yl, 2-oxa-7-azaspiro[5.3]nonane-7-yl, 2-oxa-7-azaspiro[4.4]nonane-7-yl, 2-oxa-6-azaspiro[3.3]heptane-6-yl, 2-oxa-8-azaspiro[4.5]decane-8-yl, 1,4,9-triazaspiro[5.5]undecane-9-yl, 3-oxa-9-azaspiro[5.5]undecane-9-yl, 2,6-diazaspiro[3.3]heptane-2-yl, 2,7-diazaspiro[5.3]nonane-7-yl, 2,7-dioxaspiro[5.3]nonyl, 3,9-diazaspiro[5.5]undecane-3-yl, 1-oxa ...spiro[5.5]nonane-2-yl, 2,7-diazaspiro[5.3]nonyl, 2,7-dioxaspiro[5.3]nonyl, 2,7-diazaspiro[5.5]undecane-3-yl, 2,7-dioxaspiro[5.3]nonyl, 2,7-diazaspiro[5.5]undecane-3-yl, 2,7-dioxaspiro[5.3]nonyl, 2,7-diazaspiro[5.5]undecane-3-yl, 2,7-dioxaspiro[5.3]nonyl, 2,7 The following compounds are used: 4,9-diazaspiro[5.5]undecane-9-yl, 1-oxa-4,8-diazaspiro[5.4]decane-8-yl, 3-azaspiro[5.5]undecane-3-yl, 7-azaspiro[3.5]decane-7-yl, 1-oxa-4,9-diazaspiro[5.5]undecane-4-yl, 6-oxa-2,9-diazaspiro[4.5]decane-9-yl, 9-oxa-2,6-diazaspiro[4.5]decane-6-yl, 3-azaspiro[5.5]undecane-3-yl, 4-oxa-1,9-diazaspiro[5.5]undecane-9-yl; "Bridged heterocyclic group" refers to a bridged ring group in which one or more carbon atoms constituting the bridged ring skeleton are replaced by heteroatoms selected from N, O, and S. Preferably, the bridging heterocyclic group is selected from the following bridging ring groups in which the carbon atom of the bridging ring skeleton is replaced by 1-3 heteroatoms selected from N, O, and S: bicyclo[3.1.0]hexyl, bicyclo[3.2.0]heptyl, bicyclo[3.3.0]octyl, bicyclo[4.1.0]heptyl, bicyclo[4.2.0]octyl, bicyclo[4.3.0]nonyl, bicyclo[4.4.0]decyl, and bicyclo[3.2.1]octyl.Examples of bridged heterocyclic groups include, but are limited to, 1,4-diazabicyclo[4.4.0]decane-4-yl, 1,4-diazabicyclo[4.3.0]nonane-4-yl, 8-oxa-1,4-diazabicyclo[4.4.0]decane-4-yl, 1,4-diazabicyclo[4.4.0]decane-4-yl, 4,7-diazabicyclo[4.3.0]nonane-4-yl, 2-oxa-5-azabicyclo[2.2.1]heptane-5-yl, and 3,7-diazabicyclo[4.3]. .0] Nonane-3-yl, 3,7-diazabicyclo[3.3.0] Octane-3-yl, 3,7-diazabicyclo[4.4.0] Decane-3-yl, 3,6-diazabicyclo[4.3.0] Nonane-3-yl, 3,6-diazabicyclo[4.4.0] Decane-3-yl, 3,6,9-triazabicyclo[4.4.0] Decane-3-yl, 3,7-diazabicyclo[4.2.0] Octane-3-yl, 3,7-diazabicyclo[3.3.0] Octane-3-yl.

[0093] Unless otherwise specified, the term "5-10 membered heterocyclic alkyl" on its own or in combination with other terms respectively refers to a saturated cyclic group consisting of 5 to 10 ring atoms, wherein 1, 2, 3 or 4 of the ring atoms are heteroatoms independently selected from O, S and N, and the remainder are carbon atoms, wherein the nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e. NO and S(O)). p (where p is 1 or 2). It includes monocyclic, bicyclic, and tricyclic systems, with bicyclic and tricyclic systems including spirocyclic, fused, and bridged rings. Furthermore, regarding the "5-10 membered heterocyclic alkyl," the heteroatom can occupy the connection position between the heterocyclic alkyl group and the rest of the molecule. The 5-10 membered heterocyclic alkyl groups include 5-8, 5-6, 5-7, 5-9, 4, 5, and 6 membered heterocyclic alkyl groups, etc. Examples of 5-10 membered heterocyclic alkyl groups include, but are not limited to, pyrrolidinyl, pyrazolyl, imidazoalkyl, tetrahydrothiophenyl (including tetrahydrothiophen-2-yl and tetrahydrothiophen-3-yl, etc.), tetrahydrofuranyl (including tetrahydrofuran-2-yl, etc.), tetrahydropyranyl, piperidinyl (including 1-piperidinyl, 2-piperidinyl and 3-piperidinyl, etc.), piperazinyl (including 1-piperidinyl and 2-piperidinyl, etc.), morpholinyl (including 3-morpholinyl and 4-morpholinyl, etc.), dioxyl, dithiaalkyl, isoxazolyl, isothiazolyl, 1,2-oxazinyl, 1,2-thiaazinyl, hexahydropyridazinyl, homopiperidinyl, homopiperidinyl or dioxazine-heptyl, etc.

[0094] Unless otherwise specified, the term "5-8 membered heterocyclic alkyl" on its own or in combination with other terms refers to a saturated cyclic group consisting of 5 to 8 ring atoms, wherein 1, 2, 3, or 4 of the ring atoms are heteroatoms independently selected from O, S, and N, and the remainder are carbon atoms, wherein the nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e., NO and S(O)).p (where p is 1 or 2). It includes monocyclic and bicyclic systems, with bicyclic systems including spirocyclic, fused, and bridged rings. Furthermore, regarding the "5-8 membered heterocyclic alkyl," the heteroatom can occupy the connection position between the heterocyclic alkyl and the rest of the molecule. The 5-8 membered heterocyclic alkyl includes 5-6, 5-6, 5-7, 8, 5, and 6 membered heterocyclic alkyls, etc. Examples of 5-8 membered heterocyclic alkyl groups include, but are not limited to, pyrrolidinyl, pyrazolyl, imidazoalkyl, tetrahydrothiophenyl (including tetrahydrothiophen-2-yl and tetrahydrothiophen-3-yl, etc.), tetrahydrofuranyl (including tetrahydrofuran-2-yl, etc.), tetrahydropyranyl, piperidinyl (including 1-piperidinyl, 2-piperidinyl and 3-piperidinyl, etc.), piperazinyl (including 1-piperidinyl and 2-piperidinyl, etc.), morpholinyl (including 3-morpholinyl and 4-morpholinyl, etc.), dioxyl, dithiaalkyl, isoxazolyl, isothiazolyl, 1,2-oxazinyl, 1,2-thiaazinyl, hexahydropyridazinyl, homopiperidinyl, homopiperidinyl or dioxazine-heptyl, etc.

[0095] Unless otherwise specified, the term "4-7 membered heterocyclic alkyl" on its own or in combination with other terms respectively refers to a saturated cyclic group consisting of 4 to 7 ring atoms, wherein 1, 2, 3 or 4 ring atoms are heteroatoms independently selected from O, S and N, and the remainder are carbon atoms, wherein the nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e. NO and S(O)). p (where p is 1 or 2). It includes monocyclic and bicyclic systems, with bicyclic systems including spirocyclic, fused, and bridged rings. Furthermore, regarding the "4-7 membered heterocyclic alkyl," the heteroatom can occupy the connection position between the heterocyclic alkyl and the rest of the molecule. The 4-7 membered heterocyclic alkyl includes 4-5, 4-6, 5-6, 5-7, 4, 5, and 6 membered heterocyclic alkyl groups, etc. Examples of 4-7 membered heterocyclic alkyl groups include, but are not limited to, azirrobutyl, oxacyclobutyl, thiocyclobutyl, pyrrolidinyl, pyrazolyl, imidazoalkyl, tetrahydrothiopheneyl (including tetrahydrothiophene-2-yl and tetrahydrothiophene-3-yl, etc.), tetrahydrofuranyl (including tetrahydrofuran-2-yl, etc.), tetrahydropyranyl, piperidinyl (including 1-piperidinyl, 2-piperidinyl and 3-piperidinyl, etc.), piperazinyl (including 1-piperidinyl and 2-piperidinyl, etc.), morpholinyl (including 3-morpholinyl and 4-morpholinyl, etc.), dioxane, dithiaalkyl, isoxazolyl, isothiazolyl, 1,2-oxazinyl, 1,2-thiaazinyl, hexahydropyridazinyl, homopiperidinyl, homopiperidinyl, or dioxaneheptyl, etc.

[0096] Cycloalkyl, heterocycloalkyl, aryl, and heteroaryl groups can all fused with benzene rings to form corresponding polycyclic structures. For example, the structure... In the middle, "R7 and R8 can be cyclically formed into C". 4-6 "Cycloalkyl" means that the structure can be Examples of "R7 and R8 can be cyclized into 4-6 membered heterocyclic alkyl groups" include, but are not limited to, examples of such cyclization. R7 and R8 can be cyclically formed into C. 5-6 "Aryl" means that the structure can be Examples of "R7 and R8 can cyclize into 5-7 member heteroaryl groups" include, but are not limited to, examples of such cyclization.

[0097] Unless otherwise specified, the term "aryl" refers to an unsaturated, usually aromatic, hydrocarbon group, which may be a monocyclic or fused rings. Examples of aryl groups include, but are not limited to, phenyl and naphthyl. Preferably, 5-10 aryl groups are used, more preferably 5-6 aryl groups.

[0098] Unless otherwise specified, the term "heteroaryl" refers to a stable monocyclic or polycyclic aromatic hydrocarbon containing at least one heteroatom (N, O, S, NO, SO, S(O)₂, or NR). Preferably, it is a 5-10 membered heteroaryl, more preferably a 5-6 membered heteroaryl, including 5, 6, or 7 membered monocyclic or bicyclic heteroaryls, or 7, 8, 9, or 10 membered bicyclic heteroaryls; preferably containing a carbon atom and 1, 2, 3, or 4 cyclic heteroatoms independently selected from N, O, and S. Examples of heteroaryl groups include, but are not limited to, pyrroleyl, pyrazolyl, imidazolyl, pyrazinyl, oxazolyl, benzoxazolyl, isoxazolyl, thiazolyl, furanyl, thiophenyl, pyridyl, pyrimidinyl, benzothiazolyl, purineyl, benzimidazolyl, indolyl, isoquinolinyl, quinoxalinyl, and quinolinyl.

[0099] Unless otherwise specified, the term "5-6 membered heteroaryl" refers to a monocyclic group consisting of 5 to 6 ring atoms with a conjugated π-electron system, wherein 1, 2, 3, or 4 of the ring atoms are heteroatoms independently selected from O, S, and N, and the remainder are carbon atoms. The nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e., NO and S(O)). p(where p is 1 or 2). The 5-6 membered heteroaryl group can be attached to the rest of the molecule via a heteroatom or a carbon atom. The 5-6 membered heteroaryl group includes both 5-membered and 6-membered heteroaryl groups. Examples of the 5-6 membered heteroaryl group include, but are not limited to, pyrrole (including N-pyrrole, 2-pyrrole, and 3-pyrrole), pyrazolyl (including 2-pyrazolyl and 3-pyrazolyl), imidazole (including N-imidazolyl, 2-imidazolyl, 4-imidazolyl, and 5-imidazolyl), oxazolyl (including 2-oxazolyl, 4-oxazolyl, and 5-oxazolyl), and triazolyl (1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl, 1H-1,2,4-triazolyl). (and 4H-1,2,4-triazolyl, etc.), tetrazolyl, isoxazolyl (3-isooxazolyl, 4-isooxazolyl and 5-isooxazolyl, etc.), thiazolyl (including 2-thiazolyl, 4-thiazolyl and 5-thiazolyl, etc.), furanyl (including 2-furanyl and 3-furanyl, etc.), thienyl (including 2-thienyl and 3-thienyl, etc.), pyridyl (including 2-pyridyl, 3-pyridyl and 4-pyridyl, etc.), pyrazinyl or pyrimidinyl (including 2-pyrimidinyl and 4-pyrimidinyl, etc.).

[0100] Unless otherwise specified, the term "alkyl" is used to denote a straight-chain or branched saturated hydrocarbon group. C is preferred. 1-10 Alkyl groups, more preferably C 1-6 Alkyl groups, more preferably C 1-4 Alkyl groups. Examples include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, butyl, isobutyl, pentyl, isopentyl, neopentyl, n-hexyl, etc.

[0101] Unless otherwise specified, the term "C" 1-10 "alkyl" is used to denote a straight-chain or branched saturated hydrocarbon group consisting of 1 to 10 carbon atoms. The C 1-10 Alkyl groups include C 1-6 C 1-5 C 1-4 C 1-3 C 1-2 C 2-6 C 2-5 C 2-4 C 2-3 C1-10 alkyl groups include, but are not limited to, methyl (e.g., methyl), divalent (e.g., methylene), or polyvalent (e.g., methine). Examples of C1-10 alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (including n-propyl and isopropyl), butyl (including n-butyl, isobutyl, s-butyl, and t-butyl), pentyl (including n-pentyl, isopentyl, and neopentyl), hexyl, heptyl, octyl, etc.

[0102] Unless otherwise specified, the term "C" 1-6"alkyl" is used to denote a straight-chain or branched saturated hydrocarbon group consisting of 1 to 6 carbon atoms. The C 1-6 Alkyl groups include C 1-5 C 1-4 C 1-3 C 1-2 C 2-6 C 2-5 C 2-4 C6 and C5 alkyl groups, etc.; they can be monovalent (e.g., methyl), divalent (e.g., methylene), or polyvalent (e.g., methine). 1-6 Examples of alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (including n-propyl and isopropyl), butyl (including n-butyl, isobutyl, s-butyl and t-butyl), pentyl (including n-pentyl, isopentyl and neopentyl), hexyl, etc.

[0103] Unless otherwise specified, the term "C" 1-4 "alkyl" is used to denote a straight-chain or branched saturated hydrocarbon group consisting of 1 to 4 carbon atoms. The C 1-4 Alkyl groups include C 1-3 C 1-2 C 2-3 C4, C3, C2 alkyl groups, etc.; they can be monovalent (e.g., methyl), divalent (e.g., methylene), or polyvalent (e.g., methine). 1-4 Examples of alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (including n-propyl and isopropyl), etc.

[0104] Unless otherwise specified, the term "halogen" refers to a fluorine, chlorine, bromine, or iodine atom.

[0105] Unless otherwise specified, the term "haloalkyl" refers to an alkyl group in which one or more hydrogen atoms are replaced by halogen atoms. C is preferred. 1-6 Haloalkyl groups, examples of which include, but are not limited to, monofluoromethyl, difluoromethyl, trifluoromethyl, trichloromethyl, tribromomethyl, 2,2,2-trifluoroethyl, 2,2,2-trichloroethyl, etc.

[0106] Unless otherwise specified, the term "alkoxy" refers to an alkyl group connected by an oxygen bridge, that is, a group obtained by substituting a hydrogen atom in a hydroxyl group with an alkyl group. Preferably C 1-10 Alkoxy and C 1-16 Alkoxy, more preferably C 1-4 Alkoxy groups. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, and n-hexyloxy.

[0107] Unless otherwise specified, the term "C" 1-10"Alkoxy" refers to alkyl groups containing 1 to 10 carbon atoms that are attached to the rest of the molecule by an oxygen atom. The C 1-10 Alkoxy groups include C 1-9 C 1-8 C 1-7 C 1-6 C 1-5 C 1-4 C 1-3 C 1-2 C 2-6 C 2-4 C6, C5, C4, and C3 alkoxy groups, etc. 1-10 Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), butoxy (including n-butoxy, isobutoxy, s-butoxy and t-butoxy), pentoxy (including n-pentoxy, isopentoxy and neopentoxy), hexoxy, etc.

[0108] Unless otherwise specified, the term "C" 1-6 "Alkoxy" refers to alkyl groups containing 1 to 6 carbon atoms that are attached to the rest of the molecule by an oxygen atom. The C 1-6 Alkoxy groups include C 1-4 C 1-3 C 1-2 C 2-6 C 2-4 C6, C5, C4, and C3 alkoxy groups, etc. 1-6 Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), butoxy (including n-butoxy, isobutoxy, s-butoxy and t-butoxy), pentoxy (including n-pentoxy, isopentoxy and neopentoxy), hexoxy, etc.

[0109] Unless otherwise specified, the term "C" 1-4 "Alkoxy" refers to alkyl groups containing 1 to 4 carbon atoms that are attached to the rest of the molecule by an oxygen atom. The C 1-4 Alkoxy groups include C 1-2 C 1-3 C 2-3 C 2-4 C4, C3, and C2 alkoxy groups, etc. C 1-4 Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), etc.

[0110] Unless otherwise specified, the terms "cycloalkyloxy" or "cycloalkoxy" refer to a cycloalkyl group connected by an oxygen bridge, that is, a group obtained by substituting a hydrogen atom in a cycloalkyl group with a hydrogen atom. Cycloalkyloxy groups are preferably 3-7, 4-7, or 5-7 membered cycloalkoxy groups. Examples of cycloalkyloxy groups include, but are not limited to, cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, and cyclohexyloxy.

[0111] Unless otherwise specified, the term "haloalkoxy" refers to an alkoxy group in which one or more hydrogen atoms are replaced by halogen atoms. Examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, trichloromethoxy, 2,2,2-trifluoroethoxy, and 2,2,2-trichloroethoxy.

[0112] Unless otherwise specified, the term "cycloalkenyl" refers to a stable monocyclic or polycyclic hydrocarbon group containing one or more unsaturated carbon-carbon double bonds in a ring. Examples of such cycloalkenyl groups include, but are not limited to, cyclopropene, cyclobutene, cyclopentenyl, cyclohexenyl, 1,3-cyclohexadienyl, 1,4-cyclohexadienyl, etc.

[0113] Unless otherwise specified, the term "heterocyclic alkenyl" refers to a cycloalkenyl containing 1-3 heteroatoms in the ring, preferably a 4-7 member heterocyclic alkenyl.

[0114] Unless otherwise specified, the term "4-7 membered heterocyclic alkenyl" on its own or in combination with other terms respectively refers to a partially unsaturated cyclic group consisting of 4 to 7 ring atoms comprising at least one carbon-carbon double bond, wherein 1, 2, 3, or 4 of the ring atoms are heteroatoms independently selected from O, S, and N, and the remainder are carbon atoms, wherein the nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e., NO and S(O)). p (where p is 1 or 2). It includes monocyclic, bicyclic, and tricyclic systems, wherein bicyclic and tricyclic systems include spirocyclic, fused, and bridged rings, and any ring in this system is non-aromatic. Furthermore, regarding the "4-7 membered heterocyclic alkenyl," the heteroatom can occupy the connection position between the heterocyclic alkenyl and the rest of the molecule. The 4-7 membered heterocyclic alkenyl includes 5-6 membered, 4-5 membered, 4 membered, 5 membered, and 6 membered heterocyclic alkenyls, etc. Examples of 4-7 membered heterocyclic alkenyls include, but are not limited to, those mentioned above.

[0115] Unless otherwise specified, C n-n+m Or C n -C n+m This includes any specific case with n to n+m carbons, such as C 1-12 Including C1, C2, C3, C4, C5, C6, C7, C8, C9, C 10 C 11 and C 12 It also includes any range from n to n+m, such as C 1-12 Including C1-3 C 1-6 C 1-9 C 3-6 C 3-9 C 3-12 C 6-9 C 6-12 and C 9-12 Similarly, n-membered to n+m-membered rings represent the number of atoms in the ring from n to n+m. For example, 3-12-membered rings include 3-membered, 4-membered, 5-membered, 6-membered, 7-membered, 8-membered, 9-membered, 10-membered, 11-membered, and 12-membered rings, and also any range from n to n+m. For example, 3-12-membered rings include 3-6-membered, 3-9-membered, 5-6-membered, 5-7-membered, 6-7-membered, 6-8-membered, and 6-10-membered rings, etc.

[0116] The term "leaving group" refers to a functional group or atom that can be replaced by another functional group or atom through a substitution reaction (such as affinity substitution). For example, representative leaving groups include trifluoromethanesulfonates; chlorine, bromine, and iodine; sulfonate groups, such as methanesulfonates, toluenesulfonates, p-bromobenzenesulfonates, p-toluenesulfonates, etc.; acyloxy groups, such as acetoxy groups, trifluoroacetoxy groups, etc.

[0117] The term "protecting group" includes, but is not limited to, "amino protecting group," "hydroxy protecting group," or "thiol protecting group." The term "amino protecting group" refers to a protecting group suitable for preventing side reactions at the nitrogen position of an amino group. Representative amino protecting groups include, but are not limited to: formyl; acyl, such as alkanoyl (e.g., acetyl, trichloroacetyl, or trifluoroacetyl); alkoxycarbonyl, such as tert-butoxycarbonyl (Boc); arylmethoxycarbonyl, such as benzyloxycarbonyl (Cbz) and 9-fluorenemethoxycarbonyl (Fmoc); arylmethyl, such as benzyl (Bn), triphenylmethyl (Tr), 1,1-di-(4'-methoxyphenyl)methyl; silyl, such as trimethylsilyl (TMS) and tert-butyldimethylsilyl (TBS), etc. The term "hydroxyl protecting group" refers to a protecting group suitable for preventing hydroxyl side reactions. Representative hydroxyl protecting groups include, but are not limited to: alkyl groups, such as methyl, ethyl, and tert-butyl; acyl groups, such as alkanolyl groups (e.g., acetyl); arylmethyl groups, such as benzyl (Bn), p-methoxybenzyl (PMB), 9-fluorenylmethyl (Fm), and diphenylmethyl (diphenylmethyl, DPM); silyl groups, such as trimethylsilyl (TMS) and tert-butyldimethylsilyl (TBS), etc.

[0118] Summary of experimental instruments

[0119] The structures of the compounds of this invention were determined by nuclear magnetic resonance (NMR) and / or liquid chromatography-mass spectrometry (LC-MS), or ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS). NMR chemical shifts (δ) are given in parts per million (ppm). NMR measurements were performed using a Bruker Neo400M or Bruker Ascend 400 NMR spectrometer, with solvents including deuterated dimethyl sulfoxide (DMSO-d6), deuterated methanol (CD3OD), and deuterated chloroform (CDCl3), heavy water (D2O), and tetramethylsilane (TMS) as the internal standard.

[0120] The determination was performed using liquid chromatography-mass spectrometry (LC-MS) with an Agilent 1260-6125B single quadrupole mass spectrometer with a Welch Biomate column (C18, 2.7 μm, 4.6 x 50 mm) or a Waters H-Class SQD2 column with a Welch Ultimate column (XB-C18, 1.8 μm, 2.1 x 50 mm). The ion source for the mass spectrometer was electrospray ionization.

[0121] The determination was performed using ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS) with a Waters UPLC H-class SQD mass spectrometer (ion source: electrospray ionization).

[0122] HPLC determinations were performed using a Waters e2695-2998 or Waters ARC and an Agilent 1260 or Agilent Poroshell HPH high-performance liquid chromatograph.

[0123] Preparative HPLC was performed using a Waters 2555-2489 (10 μm, ODS 250 cm × 5 cm) or a GILSON Trilution LC, with a Welch XB-C18 column (5 μm, 21.2 × 150 mm).

[0124] Chiral HPLC determination was performed using a Waters Acquity UPC2 column; the columns used were Daicel chiralpak AD-H (5μm, 4.6*250mm), Daicel chiralpak OD-H (5μm, 4.6*250mm), Daicel chiralpak IG-3 (3μm, 4.6*150mm), Chiral Technologies Europe AD-3 (3μm, 3.0*150mm) and Trefoil™ Technology Trefoil™ AMY1 (2.5μm, 3.0*150mm).

[0125] Supercritical fluid chromatography (SFC) was performed using a Waters SFC 80Q column with either a Daicel Chiralcel OD / OJ / OZ (20 x 250 mm, 10 μm) or a Daicel Chiralpak IC / IG / IH / AD / AS (20 x 250 mm, 10 μm).

[0126] Thin-layer chromatography (TLC) uses GF254 silica gel plates from Yantai Jiangyou Silica Gel Development Co., Ltd. or GF254 silica gel plates from Rushan Shangbang New Materials Co., Ltd. The TLC standard is 0.15mm to 0.20mm, with a preparative type of 20 x 20cm. Column chromatography generally uses 200-300 mesh silica gel from chemical industry as the carrier. Detailed Implementation

[0127] The present invention will be described in detail below through embodiments, but this does not imply any adverse limitations on the invention. The starting materials used in the embodiments of the present invention are known and commercially available, or can be synthesized using methods known in the art.

[0128] The compounds of this invention can be prepared by various synthetic methods well known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthetic methods, and equivalent substitutions well known to those skilled in the art. Preferred embodiments include, but are not limited to, the examples of this invention. Unless otherwise specified, all reactions of this invention are carried out under continuous magnetic stirring, in a dry nitrogen or argon atmosphere, using a dry solvent, and at temperatures in degrees Celsius. Various changes and modifications to the specific embodiments of this invention will be apparent to those skilled in the art without departing from the spirit and scope of this invention.

[0129] Example 1

[0130] (R)-1-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0131]

[0132]

[0133] Step 1: Dissolve 10.0 g (64.9 mmol) of 2-amino-5-nitrophenol in anhydrous ethanol (150 mL), then add potassium hydroxide (4.4 g, 77.9 mmol) and carbon disulfide (100 mL). Heat the reaction mixture to 50°C and reflux overnight with stirring. Cool to room temperature and concentrate the reaction mixture under reduced pressure. Acidify the residue to pH 4-5 with 2N dilute hydrochloric acid (50 mL). Dilute with water (50 mL), extract with ethyl acetate (100 mL × 2 times), combine the organic phases, wash with saturated brine (50 mL × 1 time), dry with anhydrous sodium sulfate, filter, and finally concentrate under reduced pressure to obtain 11.8 g of 6-nitrobenzo[d]oxazol-2-thione (1-2, yield 92.7%).

[0134] MS(ESI)M / Z:194.9[MH] - .

[0135] Step 2: At room temperature, 4.9 g (25.0 mmol) of 6-nitrobenzo[d]oxazole-2-thione was suspended in thionyl chloride (50 mL). Then, a catalytic amount of N,N-dimethylformamide was added to the solution at room temperature. The reaction mixture was refluxed and stirred for 2 hours. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The concentrate was pulped with ethyl acetate (100 mL), filtered, and the solid was washed with ethyl acetate (20 mL) and dried to give 3.1 g of 2-chloro-6-nitrobenzo[d]oxazole (1-3, yield 62.6%).

[0136] 1 H NMR (400MHz, CDCl3) δ8.45 (d, J = 2.1Hz, 1H), 8.36 (dd, J = 8.8, 2.1Hz, 1H), 7.82 (d, J = 8.8Hz, 1H).

[0137] Step 3: Dissolve 2-chloro-6-nitrobenzo[d]oxazole (500 mg, 2.5 mmol) and (R)-2-(methoxymethyl)pyrrolidine (290 mg, 2.5 mmol) in N,N-dimethylformamide (5 mL), then add potassium carbonate (1.0 g, 7.6 mmol). Microwave the reaction mixture at 125°C for 40 minutes. Dilute the reaction mixture with water, extract with ethyl acetate (50 mL × 3 times), combine the organic phases, wash with saturated brine (50 mL × 1 time), dry with anhydrous sodium sulfate, filter, and concentrate under reduced pressure. The crude product is used directly in the next step (1-4).

[0138] MS(ESI)M / Z:278.0[M+H] + .

[0139] Step 4: Compounds 1-4 were dissolved in anhydrous ethanol (10 mL), and iron powder (0.7 g, 12.7 mmol), ammonium chloride (1.3 g, 25.3 mmol), and water (10 mL) were added. The reaction mixture was heated under reflux for 2 hours. After filtration, the residue was washed with hot ethanol (50 mL), and the filtrate was concentrated under reduced pressure to remove the ethanol. The aqueous phase was extracted with ethyl acetate (50 mL × 3 times). The organic phases were combined, washed with saturated brine (50 mL × 2 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 330 mg of (R)-2-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-amine (1-5, two-step yield 52.8%).

[0140] MS(ESI)M / Z:247.8[M+H] + .

[0141] 1 H NMR (400MHz, CDCl3) δ7.14(d,J=8.2Hz,1H),6.68(s,1H),6.53(d,J=8.0Hz,1H),4.18(br.s., 1H),3.73-3.51(m,3H),3.50-3.43(m,1H),3.37(s,3H),2.15-1.84(m,4H).

[0142] Step 5: Dissolve 4-(pyrrolidone-1-yl)benzoic acid (4 g, 20.94 mmol) in dry dichloromethane (30 mL), then add 2 drops of N,N-dimethylformamide. Cool the reaction mixture to 0 °C and stir for 15 minutes, then slowly add oxaloyl chloride (5.3 mL, 19.05 mmol). Rise the reaction mixture to room temperature and stir for 2 hours. Concentrate under reduced pressure and dry to obtain 4.22 g of 4-(pyrrolidone-1-yl)benzoyl chloride (1-7, 96% yield), which is used directly in the next step of the reaction.

[0143] Step 6: Cool the dried tetrahydrofuran (40 mL) to -70 °C and purge with nitrogen. Add bis(trimethylsilylamino)lithium (2 M, 40 mL, 40 mmol). Then add a solution of (E)-2-(dimethylamino)methylene)-3-oxobutyrate (4.48 g, 24.23 mmol) and 1-7 (4.22 g, 20.19 mmol) in tetrahydrofuran (40 mL) while maintaining the reaction temperature below -40 °C. After the addition is complete, raise the reaction solution to room temperature and stir for 20 minutes. Cool the reaction solution to -40 °C and quench the reaction by slowly adding 3N hydrochloric acid aqueous solution (40 mL). Filter and dry to obtain 2.7 g of ethyl 4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-4H-pyran-3-carboxylate (1-8).

[0144] MS(ESI)M / Z:314.0[M+H] + .

[0145] 1 H NMR (400MHz, CDCl3) δ8.52(s,1H),7.63(d,J=8.9Hz,2H),6.72(s,1H),6.63(d,J=8.9Hz, 2H), 4.37 (q, J = 7.1Hz, 2H), 3.43-3.33 (m, 4H), 2.12-2.02 (m, 4H), 1.38 (t, J = 7.1Hz, 3H).

[0146] Step 7: At room temperature, ethyl 4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-4H-pyran-3-carboxylic acid (400.0 mg, 1.2 mmol) and (R)-2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-amine (330 mg, 1.3 mmol) were dissolved in glacial acetic acid (10 mL). The mixture was microwaved to 120°C and reacted for 40 minutes. The reaction solution was concentrated under reduced pressure, and the residue was diluted with dichloromethane (100 mL). The organic phase was washed successively with water (20 mL × 2 times), saturated sodium bicarbonate solution (20 mL × 2 times), and saturated brine (10 mL), then dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 280 mg of (R)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyridin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid ethyl ester (1-9, yield 40.4%).

[0147] MS(ESI)M / Z:543.2[M+H] + .

[0148] Step 8: At room temperature, ethyl (R)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyridin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (280 mg, 0.5 mmol) was dissolved in tetrahydrofuran (3 mL). Then, an aqueous solution of sodium hydroxide (41 mg, 1.1 mmol) (3 mL) was added to the above solution under ice-water bath conditions. The reaction mixture was stirred overnight at room temperature. The reaction system was acidified to pH 3-4 by adding 2N dilute hydrochloric acid (0.6 mL). After diluting the reaction solution with methanol (10 mL), the product (R)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyridin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (compound 1) was obtained by preparative high performance liquid chromatography.

[0149] MS(ESI)M / Z:514.9[M+H] + .

[0150] 1 H NMR (400MHz, CDCl3) δ16.00(s,1H),8.65(s,1H),7.26(d,J=8.4Hz,1H),7.05(d,J=1.9Hz,1H),6.95(d,J=8.8Hz,3H),6.79(s,1H ),6.34(d,J=8.8Hz,2H),4.22(s,1H),3.76-3.51(m,4H),3.38(s,3H),3.27-3.19(m,4H),2.17-2.05(m,3H),2.04-1.94(m,5H).

[0151] Example 2

[0152] 1-(2-(dimethylamino)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0153]

[0154] The preparation method is described in Example 1, using dimethylamine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0155] MS(ESI)M / Z:445.1[M+H] + .

[0156] 1H NMR(400MHz,DMSO-d6)δ8.50(s,1H),7.60(s,1H),7.25-7.15(m,2H),7.04(d,J=8.5Hz,2H ),6.74(s,1H),6.36(d,J=8.5Hz,2H),3.20-3.12(m,4H),3.11(s,6H),1.92-1.82(m,4H).

[0157] Example 3

[0158] (S)-1-(2-(3-methoxypyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0159]

[0160] The preparation method is described in Example 1, using (S)-3-methoxypyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0161] MS(ESI)M / Z:501.4[M+H] + .

[0162] 1 H NMR (400MHz, DMSO-d6) δ8.51(s,1H),7.64(d,J=1.8Hz,1H),7.25-7.17(m,2H),7.04(d,J=8.8Hz,2H),6.75(s,1H),6.37(d,J=8.9Hz, 2H),4.12-4.05(m,1H),3.71-3.58(m,3H),3.58-3.47(m,1H),3.26(s,3H),3.21-3.10(m,4H),2.15-2.00(m,2H),1.94-1.84(m,4H).

[0163] Example 4

[0164] (R)-1-(2-(3-methoxypyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0165]

[0166] The preparation method is described in Example 1, using (R)-3-methoxypyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0167] MS(ESI)M / Z:501.1[M+H]+ .

[0168] 1 H NMR (400MHz, DMSO-d6) δ8.51(s,1H),7.63(d,J=1.9Hz,1H),7.25-7.16(m,2H),7.04(d,J=8.8Hz,2H),6.75(s,1H),6.36(d,J=8.8Hz,2H), 4.12-4.05(m,1H),3.72-3.58(m,3H),3.57-3.48(m,1H),3.26(s,3H),3.20-3.10(t,J=6.2Hz,4H),2.15-1.99(m,2H),1.95-1.84(m,4H).

[0169] Example 5

[0170] 1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0171]

[0172] The preparation method is described in Example 1, using 1-(2-methoxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0173] MS(ESI)M / Z:544.0[M+H] + .

[0174] 1 H NMR (400MHz, CD3OD) δ8.68(s,1H),7.39(s,1H),7.31(d,J=8.0Hz,1H),7.23(d,J=8.0Hz,1H),7.03(d,J=7.8Hz,2H),6.8 0(s,1H),6.38(d,J=8.1Hz,2H),3.91(br.s.,4H),3.70(br.s.,2H),3.41(s,3H),3.30-3.13(m,8H),2.04-1.92(m,4H).

[0175] Example 6

[0176] 1-(2-(4-methoxypiperidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0177]

[0178] The preparation method is described in Example 1, using 4-methoxypiperidine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0179] MS(ESI)M / Z:515.1[M+H] + .

[0180] 1 HNMR (400MHz, CDCl3) δ8.67(s,1H),7.34(d,J=8.5Hz,1H),7.08(d,J=2.0Hz,1H),7.02-6.98(m,1H),6.95(d,J=8.7Hz,2H),6.86(s,1H),6.36(d ,J=8.7Hz,2H),3.92-3.85(m,2H),3.70-3.60(m,2H),3.58-3.51(m,1H) ,3.40(s,3H),3.29-3.20(m,4H),2.03-1.91(m,6H),1.86-1.76(m,2H).

[0181] Example 7

[0182] 1-(2-(3-methoxyazacyclobutane-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0183]

[0184] The preparation method is described in Example 1, using 3-methoxyazacyclobutane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0185] MS(ESI)M / Z:487.1[M+H] + .

[0186] 1 H NMR (400MHz, CDCl3) δ8.65(s,1H),7.32(d,J=8.4Hz,1H),7.06(d,J=1.9Hz,1H),7.02-6.97(m,1H),6.93(d,J=8.8Hz,2H),6.81(s,1H),6. 34(d,J=8.8Hz,2H),4.52-4.44(m,2H),4.44-4.38(m,1H),4.21(dd,J=9.5,3.7Hz,2H),3.36(s,3H),3.28-3.18(m,4H),2.04-1.95(m,4H).

[0187] Example 8

[0188] (S)-1-(2-(3-(dimethylamino)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0189]

[0190] The preparation method is described in Example 1, using (S)-N,N-dimethylpyrrolidine-3-amine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0191] MS(ESI)M / Z:514.2[M+H] + .

[0192] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.33 (d, J = 8.3Hz, 1H), 7.11 (d, J = 2.0Hz, 1 H),7.04-6.99(m,1H),6.94(d,J=8.8Hz,2H),6.84(s,1H),6.35(d,J=8.9Hz,2 H),4.16-4.01(m,3H),3.87-3.81(m,1H),3.75(d,J=10.6Hz,1H),3.27-3.20( m,4H),2.92(s,6H),2.67-2.62(m,1H),2.57-2.53(m,1H),2.02-1.95(m,4H).

[0193] Example 9

[0194] (R)-1-(2-(3-(dimethylamino)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0195]

[0196] The preparation method is described in Example 1, using (R)-N,N-dimethylpyrrolidine-3-amine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0197] MS(ESI)M / Z:514.1[M+H] + .

[0198] 1H NMR (400MHz, CDCl3) δ8.64(s,1H),7.31(d,J=8.3Hz,1H),7.09(s,1H),7.00(d,J=8.4Hz,1H),6.93(d,J=8.6Hz,2H),6.82(s,1H),6.35(d,J=8.6Hz,2H ),4.18-3.96(m,3H),3.90-3.79(m,1H),3.79-3.69(m,1H),3.29-3.16(m, 4H),2.91(s,6H),2.69-2.59(m,1H),2.56-2.49(m,1H),2.04-1.92(m,4H).

[0199] Example 10

[0200] (R)-6-(3-chloro-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0201]

[0202] The preparation method is described in Example 1, using 3-chloro-4-(pyrrolidine-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0203] MS(ESI)M / Z:550.6[M+H] + .

[0204] 1 H NMR (400MHz, CDCl3) δ8.73(s,1H),7.56(d,J=7.4Hz,1H),7.39(s,1H),7.25(s,1H),7.14(d,J=7.4Hz,1H),7.00(s,1H), 6.88(s,2H),4.48(br.s.,1H),3.94-3.76(m,2H),3.70-3.47(m,6H),3.36(s,3H),2.32-2.10(m,4H),2.04(br.s.,4H).

[0205] Example 11

[0206] (R)-6-(3-fluoro-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0207]

[0208] The preparation method is described in Example 1, using 3-fluoro-4-(pyrrolidine-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0209] MS(ESI)M / Z:532.9[M+H] + .

[0210] 1 H NMR (400MHz, CDCl3) δ8.68 (s, 1H), 7.52 (d, J = 8.4Hz, 1H), 7.29 (s, 1H), 7.05 (d, J=8.2Hz,1H),6.91(s,1H),6.74(d,J=12.1Hz,2H),6.50(t,J=8.6Hz,1H),4.43( br.s.,1H),3.90-3.81(m,1H),3.81-3.71(m,1H),3.70-3.59(m,1H),3.56-3.4 8(m,1H),3.49-3.39(m,4H),3.36(s,3H),2.30-2.06(m,4H),2.00-1.89(m,4H).

[0211] Example 12

[0212] (R)-6-(3-cyano-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0213]

[0214] Step 1: Methyl 3-cyano-4-fluorobenzoate (25 g, 140 mmol) and cesium carbonate (77.4 g, 237 mmol) were added to DMF (200 mL), followed by pyrrolidine (15 mL). The reaction mixture was reacted at 95 °C for 4 hours. After cooling the reaction solution to room temperature, water (300 mL) was added, resulting in the precipitation of a large amount of white solid. After filtration and drying, 30 g of methyl 3-cyano-4-(pyrrolidine-1-yl)benzoate (12-2) was obtained.

[0215] MS(ESI)M / Z:230.9[M+H] + .

[0216] Step 2: Methyl 3-cyano-4-(pyrrolidine-1-yl)benzoate (30 g, 130.4 mmol) was dissolved in tetrahydrofuran (100 mL) and water (50 mL), and sodium hydroxide (10.4 g, 260.9 mmol) was added. The mixture was stirred overnight at 50 °C. The tetrahydrofuran was removed by vacuum concentration, and the pH was adjusted to 3 with 2M dilute hydrochloric acid in the aqueous phase, producing a large amount of white solid. The solid was filtered under vacuum, washed with water, and dried to obtain 27 g of 3-cyano-4-(pyrrolidine-1-yl)benzoic acid (12-3).

[0217] MS(ESI)M / Z: 216.8 [M+H] + .

[0218] Step 3: Under ice bath conditions, dissolve 14 g (64.8 mmol) of 3-cyano-4-(pyrrolidone-1-yl)benzoic acid in 210 mL of dry dichloromethane. Then, add 0.5 mL of N,N-dimethylformamide dropwise and stir for 15 minutes. Next, add 16.5 mL of oxaloyl chloride dropwise, keeping the temperature below 0°C. After the addition is complete, bring the mixture to room temperature and stir for 2 hours. Concentrate the reaction solution and dry under vacuum to obtain 15 g of 3-cyano-4-(pyrrolidone-1-yl)benzoyl chloride (12-4), which can be directly used in the next step.

[0219] Step 4: Under nitrogen protection, dissolve LiHMDS (1M, 128 mL, 128 mmol) in dry tetrahydrofuran (128 mL), cool to -60℃ to -70℃ in a dry ice-acetone bath, and slowly add a tetrahydrofuran (128 mL) solution of ethyl 2-acetyl-3-(dimethylamino)acrylate (14.2 g, 76.8 mmol) and 3-cyano-4-(pyrrolidine-1-yl)benzoyl chloride (15 g, 64 mmol), controlling the temperature not to exceed -40℃. After the addition is complete, remove the dry ice bath, raise the temperature to room temperature, and stir for 20 minutes. 3M dilute hydrochloric acid (128 mL) was slowly added dropwise to the reaction solution while maintaining the temperature at around 10°C. After stirring for 10 minutes, a large amount of yellow solid precipitated out. The solid was then filtered under vacuum, washed with water, and dried to obtain 8.5 g of ethyl 6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid (12-5).

[0220] MS(ESI)M / Z:339.2[M+H] + .

[0221] Step 5: Ethyl 6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid (8.1 g, 23.96 mmol) and (R)-2-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-amine (5.4 g, 21.86 mmol) were added to acetic acid solution (30 mL). The mixture was stirred at 5 °C for 5 minutes, and then heated to 95 °C for 3 hours. After cooling to room temperature, most of the solvent was removed by concentration. The reaction mixture was neutralized by adding saturated sodium carbonate solution (50 mL), and extracted with dichloromethane (100 mL × 3 times). The organic phases were combined, washed with saturated brine (100 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 5.9 g of (R)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(cyano)phenyl)-1,4-dihydropyridine-3-carboxylic acid ethyl ester (12-6).

[0222] MS(ESI)M / Z:568.3[M+H] + .

[0223] 1 H NMR(400MHz, CDCl3)δ8.33(s,1H),7.28-7.22(m,2H),7.08(s,1H),6.99(d, J=7.9Hz,1H),6.91(d,J=7.8Hz,1H),6.58(s,1H),6.41(d,J=8.8Hz,1H),4. 38(q,J=7.2Hz,2H),4.24(br.s.,1H),3.72-3.62(m,2H),3.62-3.52(m,6H) ,3.38(s,3H),2.16-2.06(m,4H),2.04-1.93(m,4H),1.37(t,J=7.2Hz,3H).

[0224] Step 6: At room temperature, ethyl (R)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(cyano)phenyl)-1,4-dihydropyridine-3-carboxylic acid (5.9 g, 10.39 mmol) was dissolved in tetrahydrofuran / water solution (3:1, 60 mL), and lithium hydroxide monohydrate (872.53 mg, 20.77 mmol) was added. The mixture was stirred overnight at room temperature. A suitable amount of water was added, and the solution was concentrated to remove the tetrahydrofuran. The mixture was filtered, and the filtrate was neutralized with 15 mL of citric acid aqueous solution. A yellow solid precipitated as the product. Filter and dry to obtain 2.5 g of (R)-6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (compound 12).

[0225] MS(ESI)M / Z:540.4[M+H] + .

[0226] 1 H NMR (400MHz, CDCl3) δ15.59(s,1H),8.65(s,1H),7.32(d,J=8.3Hz,1H),7.25(s,1H),7.11(s,1H),6.99-6.90(m,2H),6.76(s,1H ),6.44(d,J=9.0Hz,1H),4.29(s,1H),3.80-3.67(m,2H),3.64-3.55(m,6H),3.39(s,3H),2.18-2.09(s,3H),2.05-1.98(m,5H).

[0227] Example 13

[0228] (R)-6-(3-methoxy-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0229]

[0230] The preparation method is described in Example 1, using 3-methoxy-4-(pyrrolidone-1-yl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0231] MS(ESI)M / Z:544.9[M+H] + .

[0232] 1H NMR (400MHz, CD3OD) δ8.71(s,1H),7.35(s,1H),7.30-7.17(m,2H),6.89-6.75(m,2H),6.64(s,1H),6.55(d,J=7.7H z,1H),4.20(br.s.,1H),3.71-3.45(m,9H),3.33(s,3H),2.14-2.04(m,3H),2.03-1.96(m,1H),1.92-1.81(m,4H).

[0233] Example 14

[0234] 1-(2-((R)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-6-(4-((R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0235]

[0236] The preparation method is described in Example 1, using (R)-4-(3-methoxypyrrolidone-1-yl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0237] MS(ESI)M / Z:545.2[M+H] + .

[0238] 1 H NMR (400MHz, DMSO-d6) δ8.51(s,1H),7.64(d,J=1.6Hz,1H),7.28-7.16(m,2H),7.05(d,J=8.7Hz,2H),6.75(s,1H),6.38(d,J=8.8Hz,2H),4 .13(br.s.,1H),4.03(s,1H),3.64-3.49(m,3H),3.49-3.40(m,1H),3.35-3.30(m,2H),3.27(s,3H),3.24-3.16(m,5H),2.09-1.87(m,6H).

[0239] Example 15

[0240] 1-(2-((S)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-6-(4-((R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0241]

[0242] The preparation method is described in Example 1, using (S)-4-(3-methoxypyrrolidone-1-yl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0243] MS(ESI)M / Z:545.3[M+H] + .

[0244] 1 H NMR (400MHz, CDCl3) δ8.68(s,1H),7.50(d,J=8.5Hz,1H),7.15-7.05(m,2H),6.94(d,J=8.7Hz,2H),6.90(s,1H),6.37(d,J= 8.7Hz,2H),4.38(br.s.,1H),4.08(br.s.,1H),3.87-3.67(m,3H),3.64-3.48(m,3H),3.46-3.28(m,8H),2.26-2.00(m,6H).

[0245] Example 16

[0246] 1-(2-morpholinobenzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0247]

[0248] The preparation method uses morpholine instead of (R)-2-(methoxymethyl)pyrrolidine as a raw material, and is described in Example 1.

[0249] MS(ESI)M / Z:487.1[M+H] + .

[0250] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.28 (d, J = 8.4Hz, 1H), 7.06 (d, J = 2.0Hz, 1H), 6.99 (dd, J = 8.3, 2.1Hz, 1H), 6.95 (d, J = 8. 8Hz,2H),6.80(s,1H),6.34(d,J=8.9Hz,2H),3.87-3.79(m,4H),3.74-3.64(m,4H),3.28-3.17(m,4H),2.03-1.95(m,4H).

[0251] Example 17

[0252] 6-(3-chloro-4-(pyrrolidone-1-yl)phenyl)-1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0253]

[0254] The preparation method is described in Example 1, using 3-chloro-4-(pyrrolidine-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 1-(2-methoxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0255] MS(ESI)M / Z:579.5[M+H] + .

[0256] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.35 (d, J = 8.3Hz, 1H), 7.15-7.00 (m, 3H), 6.84 (s, 1H), 6.81 -6.72(m,1H),6.56(d,J=8.7Hz,1H),4.69-3.66(m,8H),3.52-3.08(m,11H),2.02-1.84(m,4H).

[0257] Example 18

[0258] (S)-1-(2-(3-hydroxypyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0259]

[0260] The preparation method is described in Example 1, using (S)-pyrrolidine-3-ol instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0261] MS(ESI)M / Z:487.1[M+H] + .

[0262] 1H NMR(400MHz,CD3OD)δ8.70(s,1H),7.34(s,1H),7.27-7.20(m,1H),7.18(br.s.,1H),7.02(br.s.,2H),6.80(br.s.,1H),6.39(d,J=6.7Hz,2 H),4.53(br.s.,1H),3.79-3.67(m,3H),3.59(d,J=10.5Hz,1H),3.21(br.s.,4H),2.21-2.12(m,1H),2.08-2.03(m,1H),2.01-1.90(m,4H).

[0263] Example 19

[0264] (S)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1-(2-((tetrahydrofuran-3-yl)amino)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0265]

[0266] The preparation method is described in Example 1, using (S)-tetrahydrofuran-3-amine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0267] MS(ESI)M / Z:487.2[M+H] + .

[0268] 1 H NMR (400MHz, CD3OD) δ8.70(s,1H),7.32(s,1H),7.24(d,J=8.3Hz,1H),7.19-7.12(m,1H),7.03(d,J=8.7Hz,2H),6.81(s,1H),6.40 (d,J=8.7Hz,2H),4.38(br.s.,1H),4.00-3.91(m,2H),3.89-3.75(m,2H),3.25-3.16(m,4H),2.37-2.26(m,1H),2.10-1.92(m,5H).

[0269] Example 20

[0270] (R)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1-(2-((tetrahydrofuran-3-yl)amino)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0271]

[0272] The preparation method is described in Example 1, using (R)-tetrahydrofuran-3-amine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0273] MS(ESI)M / Z:487.2[M+H] + .

[0274] 1 H NMR (400MHz, CD3OD) δ8.70 (s, 1H), 7.46-6.91 (m, 5H), 6.87-6.53 (m, 2H), 6.40 (d, J = 7.5Hz, 1H), 4.37 ( s,1H),4.02-3.89(m,2H),3.89-3.72(m,2H),3.26-2.96(m,4H),2.38-2.24(m,1H),2.16-1.63(m,5H).

[0275] Example 21

[0276] (R)-6-(3-methoxy-4-(3-methoxypropoxy)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0277]

[0278] The preparation method is described in Example 1, using 3-methoxy-4-(3-methoxypropoxy)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0279] MS(ESI)M / Z: 564.5 [M+H] + .

[0280] 1 H NMR (400MHz, CDCl3) δ8.71 (s, 1H), 7.57 (d, J = 8.2Hz, 1H), 7.19 (d, J = 7.8Hz, 1H),7.07(s,1H),6.95(s,1H),6.77(d,J=8.2Hz,1H),6.70(d,J=7.6Hz,1H), 6.58(s,1H),4.42(s,1H),4.06(t,J=6.4Hz,2H),3.88-3.72(m,2H),3.71-3 .59(m,4H),3.58-3.49(m,3H),3.36(s,3H),3.34(s,3H),2.27-2.03(m,6H).

[0281] Example 22

[0282] (R)-6-(3-methoxy-4-(1-methyl-1H-pyrazol-4-yl)phenyl)-1-(2-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0283]

[0284] The preparation method is described in Example 1, using 3-methoxy-4-(1-methyl-1H-pyrazole-4-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0285] MS(ESI)M / Z:556.3[M+H] + .

[0286] 1 H NMR (400MHz, CDCl3) δ8.71(s,1H),7.97(s,1H),7.90(s,1H),7.52(d,J=8.3H z,1H),7.38(d,J=7.9Hz,1H),7.23-7.14(m,2H),7.00(s,1H),6.78(s,1H),6. 74(d,J=7.9Hz,1H),4.36(s,1H),4.00(s,3H),3.85-3.77(m,4H),3.76-3.66( m,1H),3.64-3.54(m,1H),3.54-3.45(m,1H),3.33(s,3H),2.26-2.02(m,4H).

[0287] Example 23

[0288] 1-(2-(isoindoline-2-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0289]

[0290] The preparation method is described in Example 1, using isoyindole instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0291] MS(ESI)M / Z:519.1[M+H] + .

[0292] 1H NMR (400MHz, CDCl3) δ8.79(s,1H),7.59(d,J=8.4Hz,1H),7.41(s,4H),7.36(s,1H),7.11(d,J=8.3Hz,1H),7 .08(s,1H),7.04(d,J=8.5Hz,2H),6.63(d,J=8.5Hz,2H),5.14(s,4H),340-3.26(m,4H),2.10-1.99(m,4H).

[0293] Example 24

[0294] 4-Oxo-6-(4-(pyrrolidone-1-yl)phenyl)-1-(2-(tetrahydro-1H-furano[3,4-c]pyrrol-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0295]

[0296] The preparation method is described in Example 1, using hexahydrofuran[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrole as the raw material.

[0297] MS(ESI)M / Z:513.2[M+H] + .

[0298] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.29 (s, 1H), 7.05 (d, J = 2.1Hz, 1H), 6.9 9-6.94(m,2H),6.94-6.91(m,1H),6.79(s,1H),6.34(d,J=8.8Hz,2H),4.01 -3.93(m,2H),3.93-3.86(m,2H),3.74(dd,J=9.2,3.1Hz,2H),3.62(dd,J= 11.1,3.2Hz,2H),3.28-3.19(m,4H),3.18-3.08(m,2H),2.01-1.95(m,4H).

[0299] Example 25

[0300] (R)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-6-(3-methyl-4-(pyrrolidin-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0301]

[0302] The preparation method is described in Example 1, using 3-methyl-4-(pyrrolidone-1-yl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0303] MS(ESI)M / Z:529.2[M+H] + .

[0304] 1 H NMR (400MHz, CDCl3) δ8.70(s,1H),7.51(d,J=8.1Hz,1H),7.20(s,2H),7.16(d,J=8.6Hz,1H),7.10-6.99(m,2H),6.90(s, 1H),4.39(s,1H),3.86-3.66(m,6H),3.64-3.56(s,1H),3.55-3.48(m,1H),3.35(s,3H),2.47(s,3H),2.31-2.05(m,8H).

[0305] Example 26

[0306] (R)-6-(4-cyclopentylphenyl)-1-(2-(2-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0307]

[0308] The preparation method is described in Example 1, using 4-cyclopentylbenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0309] MS(ESI)M / Z:514.1[M+H] + .

[0310] 1 H NMR (400MHz, CDCl3) δ8.69(s,1H),7.39(d,J=8.3Hz,1H),7.13(t,J=7.6Hz,3H),7.04(d,J=7.8Hz,2H),6.98(d,J=7.9Hz,1H),6.88(s,1H),4.31(s,1H ),3.82-3.73(m,1H),3.73-3.63(m,1H),3.62-3.49(m,2H),3.36(s,3H),2 .99-2.87(m,1H),2.23-1.96(m,6H),1.81-1.59(m,4H),1.56-1.43(m,2H).

[0311] Example 27

[0312] 1-(2-Cyclopentylbenzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0313]

[0314] Step 1: At room temperature, 2-amino-5-nitrophenol (500 mg, 3.25 mmol) was dissolved in dichloromethane (15 mL), followed by the addition of cyclopentanoyl chloride (430 mg, 3.25 mmol) and stirring. After 10 minutes, triethylamine (1312 mg, 12.99 mmol) was added, and the reaction mixture was stirred overnight at room temperature. The reaction solution was diluted with dichloromethane (50 mL), and the reaction was quenched with 2N dilute hydrochloric acid (20 mL). The pH was adjusted to 1. The aqueous phase was extracted twice with dichloromethane, and the organic phases were combined. The organic phase was first washed with saturated brine (50 mL), then dried with anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure to obtain 650 mg of N-(2-hydroxy-4-nitrophenyl)cyclopentaneformamide (27-1).

[0315] MS(ESI)M / Z:251.0[M+H] + .

[0316] Step 2: N-(2-hydroxy-4-nitrophenyl)cyclopentaneformamide (650 mg, 2.6 mmol) and p-toluenesulfonic acid (753 mg, 3.17 mmol) were dissolved in toluene (15 mL). The reaction system was heated under reflux for 3 hours, cooled to room temperature, concentrated under reduced pressure to remove toluene, and water (20 mL) was added. The mixture was extracted with ethyl acetate (20 mL × 3 times). The organic phases were combined, washed with saturated brine (20 mL × 3 times), dried with anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure to obtain 500 mg of 2-cyclopentyl-6-nitrobenzo[d]oxazole (27-2).

[0317] MS(ESI)M / Z:233.1[M+H] + .

[0318] 1 H NMR (400MHz, CDCl3) δ8.40(s,1H),8.28(dd,J=8.4,2.0Hz,1H),7.75(d,J=8.8,1H),3.38- 3.53(m,1H),2.24-2.18(m,2H),2.09-2.03(m,2H),1.92-1.84(m,2H),1.81-1.74(m,2H).

[0319] Step 3: Dissolve 2-cyclopentyl-6-nitrobenzo[d]oxazole (500 mg, 2.15 mmol) in a mixture of ethanol (10 mL) and water (10 mL), add reduced iron powder (603.4 mg, 10.78 mmol) and ammonium chloride (1.15 g, 21.55 mol), and react overnight at room temperature. After concentration under reduced pressure, add water (20 mL), extract with dichloromethane (20 mL × 3 times), combine the organic phases, dry with anhydrous sodium sulfate, and concentrate under reduced pressure to obtain 400 mg of 2-cyclopentylbenzo[d]oxazole-6-amine (27-3).

[0320] MS(ESI)M / Z:202.9[M+H] + .

[0321] 1 H NMR(400MHz, CDCl3) δ7.41(d,J=8.4Hz,1H),6.78(d,J=2.0Hz,1H),6.64(dd,J=8.4,2.0Hz,1H), 3.37-3.25(m,1H),2.15-2.09(m,2H),2.02-1.97(m,2H),1.85-1.81(m,2H),1.73-1.68(m,2H).

[0322] Step 4: Ethyl 6-(4-(pyrrolidone-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid ester (400 mg, 1.28 mmol) and 2-cyclopentylbenzo[d]oxazol-6-amine (283 mg, 1.41 mmol) were added to acetic acid solution (3 mL). The reaction was stirred at 5°C for 5 minutes and then heated to 95°C for 2 hours. After cooling to room temperature, most of the solvent was removed by concentration. The reaction was neutralized by adding saturated sodium bicarbonate solution (20 mL). The mixture was extracted with dichloromethane (20 mL × 3 times). The organic phases were combined, washed with saturated brine (20 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 103 mg of ethyl 1-(2-cyclopentylbenzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidinyl-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylate (27-4).

[0323] MS(ESI)M / Z:498.2[M+H] + .

[0324] Step 5: At room temperature, ethyl 1-(2-cyclopentylbenzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidinyl-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (103 mg, 0.21 mmol) was dissolved in tetrahydrofuran / water (3 / 1, 4 mL), and lithium hydroxide monohydrate (17.4 mg, 0.42 mmol) was added. The mixture was stirred overnight at room temperature. Citric acid was added to neutralize the reaction mixture, followed by the addition of water (4 mL) and stirring. The reaction mixture was extracted with dichloromethane (3 mL × 2 times), the organic phases were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solid residue was slurried with n-hexane, filtered, and dried to give 26 mg of 1-(2-cyclopentylbenzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (compound 27).

[0325] MS(ESI)M / Z:470.1[M+H] + .

[0326] 1 H NMR (400MHz, CDCl3) δ8.65(s,1H),7.61(d,J=8.5Hz,1H),7.34(d,J=1.9Hz,1H),7.08(dd,J=8.4,2.0Hz,1H),6.94(d,J=8.8Hz,2H),6.81(s,1 H),6.34(d,J=8.8Hz,2H),3.43-3.33(m,1H),3.29-3.16(m,4H),2.24- 2.13(m,2H),2.08-1.93(m,6H),1.89-1.81(m,2H),1.80-1.70(m,2H).

[0327] Example 28

[0328] 6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0329]

[0330] The preparation method is described in Example 1, using 3-bromo-4-(pyrrolidine-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 1-(2-methoxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0331] MS(ESI)M / Z:623.1[M+H] + .

[0332] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.39-7.30 (m, 2H), 7.12-7.03 (m, 2H), 6.85-6.78 (m, 2H), 6.56 (d, J = 8. 7Hz,1H),4.23-3.95(m,4H),3.81(s,2H),3.57-3.39(m,6H),3.37(s,3H),3.32(s,4H),1.98-1.86(m,4H).

[0333] Example 29

[0334] 4-Oxo-1-(2-phenylbenzo[d]oxazol-6-yl)-6-(4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0335]

[0336] The preparation method is described in Example 27, where benzoyl chloride is used instead of cyclopentyl chloride as a raw material.

[0337] MS(ESI)M / Z:478.1[M+H] + .

[0338] 1 H NMR (400MHz, CDCl3) δ15.86(s,1H),8.70(s,1H),8.24(d,J=6.9Hz,2H),7.74(d,J=8.4Hz,1H),7.63-7.51(m,3H),7.42(d,J=1.8Hz,1H ),7.18(dd,J=8.4,1.9Hz,1H),6.95(d,J=8.7Hz,2H),6.83(s,1H),6.33(d,J=8.8Hz,2H),3.21(t,J=6.3Hz,4H),1.96(t,J=6.4Hz,4H).

[0339] Example 30

[0340] (R)-6-(4-(dimethylamino)phenyl)-1-(2-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0341]

[0342] The preparation method is described in Example 1, using 4-(dimethylamino)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid as the raw material.

[0343] MS(ESI)M / Z:489.2[M+H] + .

[0344] 1 H NMR (400MHz, CD3OD) δ8.73(s,1H),7.42(d,J=1.7Hz,1H),7.26(d,J=8.4Hz,1H),7.20(dd,J=8.3,1.8Hz,1H),7.09(d,J=8.9Hz,2H),6.84(s,1H),6 .61(d,J=9.0Hz,2H),4.24(br.s.,1H),3.70-3.61(m,2H),3.56(d,J=5.1 Hz,2H),3.35(s,3H),2.92(s,6H),2.17-2.06(m,3H),2.04-1.98(m,1H).

[0345] Example 31

[0346] (R)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0347]

[0348] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0349] MS(ESI)M / Z:583.1[M+H] + .

[0350] 1 H NMR(400MHz,CD3OD)δ8.74(s,1H),7.49-7.43(m,2H),7.30-7.19(m,3H),6.88-6.81(m,2H),4.24(br.s.,1H),3.7 3-3.60(m,2H),3.56(d,J=4.9Hz,2H),3.38-3.32(m,7H),2.20-2.05(m,3H),2.04-1.98(m,1H),1.97-1.85(m,4H).

[0351] Example 32

[0352] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-(3-methoxyazacyclobutane-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0353]

[0354] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 3-methoxyazacyclobutane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0355] MS(ESI)M / Z:512.0[M+H] + .

[0356] 1 H NMR (400MHz, CDCl3) δ15.59(s,1H),8.64(s,1H),7.32-7.27(m,2H),7.07(d,J=1.7Hz,1H),6.93(dd,J=6.8,4.5Hz,2H),6.74(s,1H) ,6.41(d,J=9.1Hz,1H),4.51-4.44(m,2H),4.44-4.36(m,1H),4.25-4.15(m,2H),3.64-3.52(m,4H),3.36(s,3H),2.04-1.95(m,4H).

[0357] Example 33

[0358] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0359]

[0360] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 1-(2-methoxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0361] MS(ESI)M / Z:569.0[M+H] + .

[0362] 1H NMR (400MHz, DMSO-d6) δ11.97(s,1H),8.55(s,1H),7.61(d,J=1.9Hz,1H),7.48(d,J=2.3Hz,1H),7.27(dd,J=8.3,2.0Hz,1H),7. 19-7.10(m,2H),6.87(s,1H),6.60(d,J=9.2Hz,1H),3.67(br.s.,8H),3.53-3.45(m,4H),2.60-2.51(m,7H),1.93-1.84(m,4H).

[0363] Example 34

[0364] (R)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6'-(pyrrolidin-1-yl)-1,4-dihydro-[2,3'-bipyridine]-5-carboxylic acid

[0365]

[0366] The preparation method is described in Example 1, using 6-(pyrrolidone-1-yl)nicotinic acid instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0367] MS(ESI)M / Z:516.1[M+H] + .

[0368] 1 H NMR (400MHz, CDCl3) δ15.72(s,1H),8.66(s,1H),8.03(s,1H),7.28(d,J=8.5Hz,1H),7.11-7.02(m,2H),6.95(d,J=7.9Hz,1H),6.78(s,1H ),6.16(d,J=8.8Hz,1H),4.27-4.19(m,1H),3.75-3.62(m,3H),3.59(br.s.,2H),3.47-3.35(m,6H),2.17-2.06(m,3H),2.05-1.94(m,5H).

[0369] Example 35

[0370] (R)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(piperidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0371]

[0372] The preparation method is described in Example 1, using 4-(piperidin-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid as the raw material.

[0373] MS(ESI)M / Z:529.1[M+H] + .

[0374] 1 H NMR (400MHz, DMSO-d6) δ8.53(s,1H),7.64(s,1H),7.26-7.17(m,2H),7.08(d,J=8.8Hz,2H),6.84-6.77(m,3H),4.13(s,1H) ,3.62-3.49(m,3H),3.48-3.41(m,1H),3.27(s,3H),3.22-3.11(m,4H),2.08-1.97(m,2H),1.97-1.87(m,2H),1.52(s,6H).

[0375] Example 36

[0376] (R)-6-(3-bromo-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0377]

[0378] Step 1: Methyl 3-bromo-4-fluorobenzoate (5.0 g, 21.5 mmol), pyrrolidine (3.1 g, 101 mmol), and triethylamine (9.0 mL, 64.5 mmol) were dissolved in acetonitrile (100 mL), and the reaction mixture was stirred overnight at room temperature. The reaction mixture was quenched with water, diluted with ethyl acetate (400 mL), and the organic phase was washed successively with water (100 mL), 5% citric acid aqueous solution (100 mL × 3 times), and saturated brine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 6.0 g of methyl 3-bromo-4-(pyrrolidine-1-yl)benzoate (36-2).

[0379] MS(ESI)M / Z:285.4[M+H] + .

[0380] Step 2: Methyl 3-bromo-4-(pyrrolidone-1-yl)benzoate (6.0 g, 21.2 mmol) was dissolved in tetrahydrofuran (50 mL), and sodium hydroxide solution (1.7 g, 42.4 mmol, in 50 mL of water) was added. The reaction mixture was stirred overnight at room temperature. The pH was adjusted to 3-4 with 2N dilute hydrochloric acid (25 mL). The aqueous phase was extracted with ethyl acetate (100 mL × 3 times). The organic phases were combined, washed with saturated brine (50 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was slurried with petroleum ether / ethyl acetate, filtered, and dried to give 2.9 g of 3-bromo-4-(pyrrolidone-1-yl)benzoic acid (36-3).

[0381] MS(ESI)M / Z:225.8[M+H] + .

[0382] Step 3: Dissolve 1.0 g (3.7 mmol) of 3-bromo-4-(pyrrolidone-1-yl)benzoic acid in 10 mL of dichloromethane, then add 1.3 g (11.2 mmol) of oxalyl chloride. After reacting at 35 °C for 1 hour, concentrate under reduced pressure to obtain crude 3-bromo-4-(pyrrolidone-1-yl)benzoyl chloride, which is directly used in the next reaction (36-4).

[0383] Step 4: Crude 3-bromo-4-(pyrrolidone-1-yl)benzoyl chloride was dissolved in anhydrous tetrahydrofuran (20 mL), and ethyl 2-acetyl-3-(dimethylamino)acrylate (0.8 g, 4.1 mmol) was added. The resulting solution was added dropwise to hexamethyldisilamide lithium (1 M, 9.3 mL, 9.3 mmol) pre-cooled to -78 °C. The reaction solution was reacted at -78 °C for 1–2 hours. The reaction was carefully quenched with 2N dilute hydrochloric acid, and then the pH was adjusted to 8–9 with sodium bicarbonate. The mixture was extracted with ethyl acetate (100 mL × 3 times), and the organic phases were combined. The organic phase was first washed with saturated brine (50 mL × 3 times), then dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 480 mg of ethyl 6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid (36-5).

[0384] MS(ESI)M / Z:393.9[M+H] + .

[0385] Step 5: At room temperature, ethyl 6-(3-bromo-4-(pyrrolidine-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid (300 mg, 0.8 mmol) and (R)-2-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-amine (208 mg, 0.9 mmol) were dissolved in glacial acetic acid (10 mL). The reaction mixture was microwaved to 120 °C for 40 minutes. After concentration under reduced pressure, the concentrate was diluted with dichloromethane (100 mL). The organic phase was washed successively with water (20 mL × 3 times), saturated sodium bicarbonate solution (20 mL × 3 times), and saturated brine (10 mL), then dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 170 mg of (R)-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (36-6).

[0386] MS(ESI)M / Z: 621.5 [M+H] + .

[0387] Step 6: At room temperature, ethyl (R)-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (170 mg, 0.3 mmol) was dissolved in tetrahydrofuran (2 mL). An aqueous solution of sodium hydroxide (22 mg, 0.6 mmol) (2 mL) was added to the above solution under ice-water bath conditions. The reaction mixture was stirred overnight at room temperature. The pH was acidified to 3-4 by adding 2N dilute hydrochloric acid (0.4 mL). After extraction with ethyl acetate (50 mL), the organic phase was washed with saturated brine (10 mL × 2 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by preparative high performance liquid chromatography to give 37 mg of (R)-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (compound 36).

[0388] MS(ESI)M / Z:594.1[M+H] + .

[0389] 1H NMR (400MHz, CDCl3) δ8.68(s,1H),7.52(d,J=8.4Hz,1H),7.36(d,J=2.1Hz,1H),7. 24-7.20(m,1H),7.07(d,J=8.1Hz,1H),6.90(s,1H),6.82(dd,J=8.6,2.2Hz,1H),6. 63(d,J=8.7Hz,1H),4.40(br.s.,1H),3.87-3.79(m,1H),3.79-3.69(m,1H),3.65- 3.58(m,1H),3.57-3.42(m,5H),3.36(s,3H),2.28-2.05(m,4H),2.00-1.89(m,4H).

[0390] Example 37

[0391] 1-(2-(4-methylpiperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0392]

[0393] The preparation method is described in Example 1, using 1-methylpiperazine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0394] MS(ESI)M / Z:500.3[M+H] + .

[0395] 1 H NMR(400MHz,DMSO-d6)δ8.50(s,1H),7.65(s,1H),7.32-7.21(m,2H),7.04(d,J=8.3Hz,2H),6.75(s,1H),6 .37(d,J=8.4Hz,2H),3.69(br.s.,4H),3.16(br.s.,4H),2.68(br.s.,4H),2.42(s,3H),1.89(br.s.,4H).

[0396] Example 38

[0397] 4-Oxo-1-(2-(pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-6-(4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0398]

[0399] The preparation method is described in Example 1, using pyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0400] MS(ESI)M / Z:471.1[M+H] + .

[0401] 1 H NMR(400MHz, CDCl3)δ8.73(s,1H),7.52(s,1H),7.37(s,1H),7.12(s,1H),7.06-6.91(m,3H), 6.48(d,J=7.7Hz,2H),3.83(br.s.,4H),3.30(br.s.,4H),2.17(br.s.,4H),2.03(br.s.,4H).

[0402] Example 39

[0403] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-4-oxo-1-(2-(pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0404]

[0405] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and pyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0406] MS(ESI)M / Z:496.1[M+H] + .

[0407] 1 H NMR (400MHz, CDCl3) δ15.61(s,1H),8.65(s,1H),7.29-7.23(m,2H),7.07(d,J=1.7Hz,1H),6.97(dd,J=9.1,2.1Hz,1H),6.89(dd,J =8.3,1.8Hz,1H),6.75(s,1H),6.41(d,J=9.1Hz,1H),3.73-3.63(m,4H),3.61-3.51(m,4H),2.12-2.03(m,4H),2.02-1.94(m,4H).

[0408] Example 40

[0409] (R)-6-(4-(azacyclobutan-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0410]

[0411] The preparation method is described in Example 1, using 4-(azacyclobutane-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid as the raw material.

[0412] MS(ESI)M / Z:501.2[M+H] + .

[0413] 1 H NMR (400MHz, CD3OD) δ8.72(s,1H),7.38(s,1H),7.24(d,J=8.3Hz,1H),7.17(d,J=8.4Hz,1H),7.05(d,J=8.7Hz,2H),6.82(s,1H),6.27(d,J= 8.7Hz,2H),4.22(s,1H),3.84(t,J=7.3Hz,4H),3.72-3.60(m,2H),3.57(d,J=5.0Hz,2H),3.35(s,3H),2.39-2.31(m,2H),2.15-1.97(m,4H).

[0414] Example 41

[0415] 1-(2-(7-oxo-2-azaspirocyclic[3.5]non-2-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0416]

[0417] The preparation method is described in Example 1, using 7-oxo-2-azaspirocyclic[3.5]nonane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0418] MS(ESI)M / Z:527.1[M+H] + .

[0419] 1H NMR (400MHz, CDCl3) δ15.96(s,1H),8.64(s,1H),7.30-7.27(m,1H),7.05(d,J=2.0Hz,1H),6.98(dd,J=8.3,2.0Hz,1H),6.94(d,J=8.7 Hz,2H),6.79(s,1H),6.33(d,J=8.8Hz,2H),4.03(s,4H),3.71-3.62(m,4H),3.28-3.19(m,4H),2.03-1.94(m,4H),1.91-1.85(m,4H).

[0420] Example 42

[0421] (R)-1-(2-(2-(hydroxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0422]

[0423] The preparation method is described in Example 1, using (R)-pyrrolidine-2-ylmethanol instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0424] MS(ESI)M / Z:501.3[M+H] + .

[0425] 1 H NMR (400MHz, CDCl3) δ8.66(s,1H),7.36(s,1H),7.19(s,1H),7.04(s,1H),6.93(d,J=8.3Hz,2H),6.88(s,1H),6.37(d,J= 8.4Hz,2H),4.32(br.s.,1H),3.96-3.63(m,4H),3.25(br.s.,4H),2.34-2.05(m,3H),2.00(br.s.,4H),1.90(br.s.,1H).

[0426] Example 43

[0427] 4-Oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrol-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0428]

[0429] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and hexahydro-1H-furan[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0430] MS(ESI)M / Z:581.2[M+H] + .

[0431] 1 H NMR (400MHz, CDCl3) δ15.70 (s, 1H), 8.66 (s, 1H), 7.41 (d, J = 2.0Hz, 1H), 7.29 ( d,J=8.3Hz,1H),7.05(d,J=1.8Hz,1H),6.96(dd,J=8.6,1.9Hz,2H),6.79(s,1 H),6.62(d,J=9.0Hz,1H),4.02-3.85(m,4H),3.75(dd,J=9.1,2.8Hz,2H),3.6 2(dd,J=11.0,3.0Hz,2H),3.42-3.29(m,4H),3.14(s,2H),2.00-1.87(m,4H).

[0432] Example 44

[0433] 1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0434]

[0435] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 1-(2-methoxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0436] MS(ESI)M / Z:612.3[M+H] + .

[0437] 1H NMR (400MHz, CDCl3) δ15.70(s,1H),8.65(s,1H),7.41(d,J=2.2Hz,1H),7.29-7.24(m,1H),7.04(d,J=1.8Hz,1H),6.99-6.94( m,2H),6.79(s,1H),6.62(d,J=9.0Hz,1H),3.76(s,4H),3.55(s,2H),3.43-3.30(m,7H),2.65(br.s.,6H),1.99-1.89(m,4H).

[0438] Example 45

[0439] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0440]

[0441] The preparation method is described in Example 1, using 3-azabicyclo[3.1.0]hexane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0442] MS(ESI)M / Z:483.2[M+H] + .

[0443] 1 H NMR (400MHz, CDCl3) δ15.99(s,1H),8.64(s,1H),7.23(s,1H),7.03(s,1H),6.94(d,J=8.8Hz,3H),6.79(s,1H),6.33(d,J=8.3Hz,2H), 3.90-3.81(m,2H),3.74-3.65(m,2H),3.28-3.19(m,4H),2.03-1.93(m,4H),1.76-1.66(m,2H),0.89-0.80(m,1H),0.34-0.25(m,1H).

[0444] Example 46

[0445] 1-(2-(hexahydro-1H-furan[3,4-c]pyrrole)benzo[d]oxazol-6-yl)-4-oxo-6-(3-cyano-4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0446]

[0447] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and hexahydro-1H-furan[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0448] MS(ESI)M / Z:538.2[M+H] + .

[0449] 1 H NMR (400MHz, CDCl3) δ8.66(s,1H),7.39(d,J=7.6Hz,1H),7.25(s,1H),7.15(s,1H),6.96(s,2H),6.80(s,1H),6.44(d,J=7. 8Hz,1H),3.96(br.s.,4H),3.79(d,J=8.8Hz,2H),3.74-3.63(m,2H),3.59(br.s.,4H),3.18(br.s.,2H),2.09-1.94(m,4H).

[0450] Example 47

[0451] 6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-4-oxo-1-(2-(pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0452]

[0453] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-bromobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and pyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0454] MS(ESI)M / Z:550.7[M+H] + .

[0455] 1 H NMR (400MHz, CDCl3) δ15.68(s,1H),8.66(s,1H),7.35(s,1H),7.30(d,J=8.1Hz,1H),7.03(s,1H) ,6.97(d,J=9.1Hz,1H),6.81(d,J=8.3Hz,1H),6.78(s,1H),6.59(d,J=8.7Hz,1H),3.73-3.64(m, 4H),3.47-3.38(m,4H),2.12-2.03(m,4H),1.97-1.87(m,4H).

[0456] Example 48

[0457] 1-(2-(3-azabicyclo[3.1.0]hexyl)benzo[d]oxazol-6-yl)-4-oxo-6-(3-bromo-4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0458]

[0459] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-bromobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 3-azabicyclo[3.1.0]hexane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0460] MS(ESI)M / Z:562.3[M+H] + .

[0461] 1 H NMR (400MHz, CDCl3) δ15.63(s,1H),8.65(s,1H),7.37(s,1H),7.31(d,J=8.2 Hz,1H),7.03(s,1H),6.98(d,J=9.7Hz,1H),6.81(d,J=8.7Hz,1H),6.78(s,1H ),6.71(s,1H),3.89(d,J=10.1Hz,2H),3.74(d,J=9.1Hz,2H),3.46(br.s.,4H ),1.96(br.s.,4H),1.76-1.69(m,2H),0.91-0.83(m,1H),0.35-0.29(m,1H).

[0462] Example 49

[0463] 1-(2-(3-methoxyazacyclobutane)benzo[d]oxazol-6-yl)-4-oxo-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0464]

[0465] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-bromobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 3-methoxyazacyclobutane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0466] MS(ESI)M / Z: 566.9 [M+H] + .

[0467] 1H NMR (400MHz, CDCl3) δ8.65(s,1H),7.36-7.30(m,2H),7.04(s,1H),6.99(d,J=8.2Hz,1H),6.84-6.76(m,2H),6.67(s,1H ),4.52-4.45(m,2H),4.44-4.38(m,1H),4.22(dd,J=9.3,3.7Hz,2H),3.49-3.40(m,4H),3.36(s,3H),2.00-1.91(m,4H).

[0468] Example 50

[0469] 1-(2-(7-oxa-2-azaspiro[3.5]nonyl-2-yl)benzo[d]oxazol-6-yl)-6-(3-bromo-4-(pyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0470]

[0471] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-bromobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 7-oxo-2-azaspirocyclic[3.5]nonane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0472] MS(ESI)M / Z:607.3[M+H] + .

[0473] 1 H NMR (400MHz, CDCl3) δ8.65(s,1H),7.35-7.29(m,2H),7.02(s,1H),7.00(d,J=8.6Hz,1H),6.81(d,J=8.7Hz,1 H),6.78(s,1H),6.58(d,J=8.8Hz,1H),4.05(s,4H),3.71-3.62(m,4H),3.65-3.47(m,4H),1.96-1.85(m,8H).

[0474] Example 51

[0475] (R)-6-(3-azabicyclo[3.1.0]hexane-3-yl)phenyl)-1-(2-((R)-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid)

[0476]

[0477] The preparation method is described in Example 1, using 4-(3-azabicyclo[3.1.0]hexane-3-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0478] MS(ESI)M / Z:527.2[M+H] + .

[0479] 1 H NMR (400MHz, CDCl3) δ8.66(s,1H),7.44(d,J=8.4Hz,1H),7.15(d,J=1.7Hz,1H),7.04-6.98(m,1 H),6.92(d,J=8.7Hz,2H),6.87(s,1H),6.34(d,J=8.7Hz,2H),4.34(s,1H),3.82-3.76(m,1H),3 .74-3.66(m,1H),3.63-3.57(m,1H),3.56-3.51(m,1H),3.44(d,J=9.3Hz,2H),3.37(s,3H),3.2 7(d,J=8.3Hz,2H),2.26-2.03(m,4H),1.70-1.59(m,2H),0.81-0.72(m,1H),0.27-0.23(m,1H).

[0480] Example 52

[0481] 1-(2-((R)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(hexahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0482]

[0483] The preparation method is described in Example 1, using 4-(hexahydro-1H-furano[3,4-c]pyrrolo-5(3H)-yl)benzoic acid instead of 4-(pyrrolidin-1-yl)benzoic acid.

[0484] MS(ESI)M / Z:557.2[M+H] + .

[0485] 1H NMR (400MHz, CDCl3) δ8.67 (s, 1H), 7.44 (d, J = 8.1Hz, 1H), 7.12 (s, 1H), 7.03 ( d,J=7.8Hz,1H),6.96(d,J=8.2Hz,2H),6.88(s,1H),6.41(d,J=8.3Hz,2H),4. 34(s,1H),4.02-3.91(m,2H),3.83-3.75(m,1H),3.74-3.65(m,3H),3.63-3.4 2(m,4H),3.36(s,3H),3.21(d,J=9.4Hz,2H),3.06(s,2H),2.27-1.99(m,4H).

[0486] Example 53

[0487] 1-(2-(indol-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0488]

[0489] The preparation method using indoline instead of (R)-2-(methoxymethyl)pyrrolidine is as described in Example 1.

[0490] MS(ESI)M / Z:519.3[M+H] + .

[0491] 1 H NMR (400MHz, CDCl3) δ15.96(s,1H),8.68(s,1H),7.97(d,J=8.0Hz,1H),7.42(d,J=8.3Hz,1H),7.33-7.27(m,2H),7.18(s,1H),7.09-7.01(m,2H ),6.96(d,J=8.3Hz,2H),6.81(s,1H),6.33(d,J=8.5Hz,2H),4.33(t,J= 8.6Hz,2H),3.32(t,J=8.5Hz,2H),3.26-3.16(m,4H),2.02-1.91(m,4H).

[0492] Example 54

[0493] 6-(3-bromo-4-(pyrrolidine-1-yl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrol-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0494]

[0495] The preparation method is described in Example 1, using 3-bromo-4-(pyrrolidine-1-yl)benzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and hexahydro-1H-furan[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0496] MS(ESI)M / Z:592.5[M+H] + .

[0497] 1 H NMR(400MHz, CDCl3)δ15.69(s,1H),8.67-8.63(m,1H),7.35(s,1H),7.29(d, J=8.2Hz,1H),7.03(s,1H),6.98(d,J=8.4Hz,1H),6.83-6.76(m,2H),6.55(d ,J=8.7Hz,1H),4.00-3.94(m,2H),3.94-3.86(m,2H),3.78-3.71(m,2H),3.6 3(dd,J=11.1,2.5Hz,2H),3.47-3.38(m,4H),3.13(s,2H),1.97-1.87(m,4H).

[0498] Example 55

[0499] 1-(2-(2-oxa-7-azaspirocyclic[3.5]nonane-7-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0500]

[0501] The preparation method is described in Example 1, using 2-oxo-7-azaspirocyclic[3.5]nonane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0502] MS(ESI)M / Z:527.2[M+H] + .

[0503] 1H NMR (400MHz, CDCl3) δ15.96(s,1H),8.64(s,1H),7.24(s,1H),7.04(s,1H),6.99-6.91(m,3H),6.7 9(s,1H),6.34(d,J=8.3Hz,2H),4.50(s,4H),3.68-3.58(m,4H),3.28-3.17(m,4H),2.04-1.93(m, 8H).

[0504] Example 56

[0505] 4-Oxo-6-(4-(pyrrolidin-1-yl)-3-(trifluoromethyl)phenyl)-1-(2-(pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0506]

[0507] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and pyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0508] MS(ESI)M / Z:539.1[M+H] + .

[0509] 1 H NMR (400MHz, CDCl3) δ15.73(s,1H),8.67(s,1H),7.41(s,1H),7.27(s,1H),7.04(s,1H),7.01-6.91(m,2H),6. 79(s,1H),6.62(d,J=8.9Hz,1H),3.71-3.61(m,4H),3.39-3.29(m,4H),2.11-2.03(m,4H),1.97-1.88(m,4H).

[0510] Example 57

[0511] 1-(2-(isoindol-2-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0512]

[0513] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and isoindoline instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0514] MS(ESI)M / Z:587.0[M+H] + .

[0515] 1 H NMR (400MHz, CDCl3) δ15.70(s,1H),8.69(s,1H),7.42(d,J=1.9Hz,1H),7.39-7.32(m,5H),7.12(d,J=1.7Hz,1 H),7.02-6.96(m,2H),6.81(s,1H),6.63(d,J=9.1Hz,1H),5.02(s,4H),3.39-3.31(m,4H),1.96-1.89(m,4H).

[0516] Example 58

[0517] 1-(2-(3-methoxyazacyclobutane-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0518]

[0519] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 3-methoxyazacyclobutane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0520] MS(ESI)M / Z:555.2[M+H] + .

[0521] 1 H NMR(400MHz,DMSO-d6)δ8.54(s,1H),7.68(s,1H),7.42(s,1H),7.31-7.22(m,3H),6.86(s,1H),6.8 2(d,J=9.0Hz,1H),4.43-4.32(m,3H),4.02(d,J=6.9Hz,2H),3.29-3.19(m,7H),1.89-1.79(m,4H).

[0522] Example 59

[0523] 6-(3-cyano-4-(R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0524]

[0525] Steps 1-3: Replace 4-(pyrrolidine-1-yl)benzoic acid with 4-bromo-3-cyanobenzoic acid. The preparation method is the same as in Example 1. Steps 5-7 yield ethyl 6-(4-bromo-3-cyanophenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid (59-4).

[0526] MS(ESI)M / Z: 576.3 [M+H] + .

[0527] Step 4: Dissolve ethyl 6-(4-bromo-3-cyanophenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylate (220 mg, 0.38 mmol), (R)-3-methoxypyrrolidine (105.4 mg, 0.77 mmol), and cesium carbonate (375 mg, 1.15 mmol) in 1,4-dioxane (15 mL), add X-Phos-PdG2 (catalytic amount), and heat the reaction solution to 120°C for 2 hours. Cool to room temperature and filter. The filtrate was extracted with dichloromethane, washed with saturated brine, and the organic phases were combined, dried, and concentrated to give 170 mg of ethyl 6-(3-cyano-4-((R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid (59-5).

[0528] MS(ESI)M / Z:595.4[M+H] + .

[0529] Step 5: At room temperature, ethyl 6-(3-cyano-4-((R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid (170 mg, 0.29 mmol) was dissolved in tetrahydrofuran (9 mL). Subsequently, an aqueous solution of sodium hydroxide (23 mg, 0.57 mmol) (8 mL) was added to the above solution under ice-water bath conditions. The reaction mixture was stirred overnight at room temperature. The reaction system was acidified to pH 5-6 by adding saturated citric acid (1 mL). After extraction with dichloromethane (20 mL), the organic phase was washed with saturated brine (10 mL × 2 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was separated by preparative high performance liquid chromatography to yield 24 mg of 6-(3-cyano-4-(R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid (compound 59).

[0530] MS(ESI)M / Z:568.4[M+H] + .

[0531] 1 H NMR (400MHz, CDCl3) δ15.58(s,1H),8.65(s,1H),7.34-7.27(m,2H),7.07-6.91(m,3H),6.75(s,1H),6.42(d,J=9.0Hz,1H),4.06(br.s .,1H),4.01-3.87(m,4H),3.84-3.72(m,3H),3.72-3.54(m,5H),3.34(s,3H),3.14(br.s.,2H),2.26-2.15(m,1H),2.03-1.93(m,1H).

[0532] Example 60

[0533] 6-(4-((R)-3-methoxypyrrolidine-1-yl)-3-(trifluoromethyl)phenyl)-4-oxo-1-(2-(tetrahydro-1H-furan[3,4-c]pyrrolo-5(3H)-yl)benzo[d]oxazol-6-yl)-1,4-dihydropyridine-3-carboxylic acid

[0534]

[0535] The preparation method is described in Example 59, where 4-bromo-3-(trifluoromethyl)benzoic acid is used instead of 4-bromo-3-cyanobenzoic acid.

[0536] MS(ESI)M / Z:611.2[M+H] + .

[0537] 1 H NMR (400MHz, CDCl3) δ15.68(s,1H),8.66(s,1H),7.41(s,1H),7.31(d,J=8.3 Hz,1H),7.04-6.95(m,3H),6.79(s,1H),6.63(d,J=8.8Hz,1H),4.02(br.s.,1 H),4.00-3.87(m,4H),3.78-3.71(m,2H),3.67-3.58(m,3H),3.57-3.47(m,1H ),3.38-3.27(m,5H),3.14(br.s.,2H),2.17-2.09(m,1H),2.04-1.92(m,1H).

[0538] Example 61

[0539] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0540]

[0541] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 3-azabicyclo[3.1.0]hexane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0542] MS(ESI)M / Z:508.1[M+H] + .

[0543] 1 H NMR(400MHz,CD3OD)δ8.71(s,1H),7.45-7.38(m,2H),7.29-7.18(m,2H),7.15(dd,J=9.1,2.2Hz,1H),6.83(s,1H),6.57(d,J=9.1Hz,1H), 3.84-3.78(m,2H),3.74-3.65(m,2H),3.59-3.51(m,4H),2.04-1.93(m,4H),1.79-1.71(m,2H),0.88-0.81(m,1H),0.27(q,J=4.2Hz,1H).

[0544] Example 62

[0545] 1-(2-(7-oxa-2-azaspiro[3.5]non-2-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0546]

[0547] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 7-oxo-2-azaspirocyclic[3.5]nonane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0548] MS(ESI)M / Z:551.9[M+H] + .

[0549] 1 H NMR (400MHz, CDCl3) δ15.58(s,1H),8.64(s,1H),7.30-7.22(m,2H),7.09(s,1H),6.98(d,J=9.1Hz,1H),6.92(d,J=8.4Hz,1H) ,6.74(s,1H),6.42(d,J=9.1Hz,1H),4.05(s,4H),3.71-3.63(m,4H),3.60-3.53(m,4H),2.02-1.95(m,4H),1.93-1.86(m,4H).

[0550] Example 63

[0551] 1-(2-(2-azabicyclo[3.1.0]hex-2-yl)benzoxazol-6-yl)-4-oxazol-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0552]

[0553] The preparation method is described in Example 1, using 2-azabicyclo[3.1.0]hexane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0554] MS(ESI)M / Z:483.3[M+H] + .

[0555] 1H NMR(400MHz, CDCl3)δ16.01(s,1H),8.66(s,1H),7.28(s,1H),7.05(s,1H),7 .00-6.91(m,3H),6.80(s,1H),6.34(d,J=8.4Hz,2H),4.00-3.90(m,1H),3.7 2-3.64(m,1H),3.33-3.16(m,5H),2.38-2.24(m,1H),2.15(t,J=10.4Hz,1H) ,1.99(br.s.,4H),1.84-1.72(m,1H),0.96-0.84(m,1H),0.75-0.65(m,1H).

[0556] Example 64

[0557] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0558]

[0559] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 3-azabicyclo[3.1.0]hexane instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0560] MS(ESI)M / Z:551.2[M+H] + .

[0561] 1 H NMR (400MHz, CDCl3) δ15.72(s,1H),8.65(s,1H),7.41(s,1H),7.04(s,1H),6.95(d,J=6.2Hz,2H),6.79(s,1H),6.62(d,J=8.9Hz,1H),3.86( d,J=10.3Hz,2H),3.70(d,J=10.1Hz,2H),3.35(br.s.,4H),1.94(br.s.,4H),1.71(br.s.,3H),0.85(q,J=7.6Hz,1H),0.31(q,J=4.8Hz,1H).

[0562] Example 65

[0563] 1-(2-(7-oxo-2-azaspiro[3.5]non-2-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0564]

[0565] The preparation method is described in Example 1, using 4-(pyrrolid-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolid-1-yl)benzoic acid and 7-oxo-2-azaspirocyclic[3.5]nonane(R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0566] MS(ESI)M / Z:595.1[M+H] + .

[0567] 1 H NMR(400MHz,CD3OD)δ8.75(s,1H),7.45(s,2H),7.34-7.20(m,3H),6.92-6.79(m,2H),4.0 7(br.s.,4H),3.69-3.61(m,4H),3.40-3.32(m,4H),1.98-1.91(m,4H),1.91-1.82(m,4H).

[0568] Example 66

[0569] 6-(3-cyano-4-(R)-3-methoxypyrrolidine-1-yl)phenyl)-1-(2-((2(R)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid)

[0570]

[0571] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-cyanobenzoic acid is used instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0572] MS(ESI)M / Z:570.3[M+H] + .

[0573] 1H NMR (400MHz, CDCl3) δ15.59(s,1H),8.65(s,1H),7.33-7.27(m,2H),7.10-6.87(m,3H),6.75(s,1H),6.43( d,J=9.1Hz,1H),4.26(s,1H),4.06(s,1H),3.84-3.51(m,8H),3.38(s,3H),3.34(s,3H),2.26-1.93(m,6H).

[0574] Example 67

[0575] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(4-((R)-3-methoxypyrrolidine-1-yl)-3-(trifluoromethyl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0576]

[0577] The preparation method is the same as that in Example 1 and Example 59, where 4-bromo-3-(trifluoromethyl)benzoic acid is used instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0578] MS(ESI)M / Z:581.2[M+H] + .

[0579] 1 H NMR (400MHz, CDCl3) δ15.69 (s, 1H), 8.65 (s, 1H), 7.41 (d, J = 1.8Hz, 1H), 7.28 (s, 1H), 7.02 -6.93(m,3H),6.78(s,1H),6.63(d,J=8.9Hz,1H),4.02(s,1H),3.85(d,J=10.4Hz,2H),3.7 0(d,J=10.1Hz,2H),3.66-3.57(m,1H),3.56-3.47(m,1H),3.38-3.26(m,5H),2.17-2.08( m,1H),2.03-1.91(m,1H),1.76-1.67(m,2H),0.84(q,J=7.6Hz,1H),0.32(q,J=4.3Hz,1H).

[0580] Example 68

[0581] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-((R)-3-fluoropyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0582]

[0583] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-cyanobenzoic acid is used instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0584] MS(ESI)M / Z:526.4[M+H] + .

[0585] 1 H NMR (400MHz, CDCl3) δ15.55(s,1H),8.65(s,1H),7.32-7.27(m,2H),7.08-6.85(m,3H),6.75(s,1H),6.45(d,J=9.1Hz,1H),5.35(d,J= 52.5Hz,1H),4.03-3.62(m,8H),2.47-2.32(m,1H),2.21-1.98(m,1H),1.77-1.66(m,2H),0.86(q,J=7.6Hz,1H),0.32(d,J=4.6Hz,1H).

[0586] Example 69

[0587] (R)-6-(3-fluoro-4-(3-methoxypyrrolidin-1-yl)phenyl)-1-(2-(3-methoxyazacyclobutan-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0588]

[0589] The preparation method is the same as that in Example 1 and Example 59, in which 4-bromo-3-fluorobenzoic acid is used instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0590] MS(ESI)M / Z:535.2[M+H] + .

[0591] 1H NMR (400MHz, CDCl3) δ15.75(s,1H),8.64(s,1H),7.30(d,J=8.8Hz,1H),7.00(d,J =6.8Hz,2H),6.76(s,1H),6.71(d,J=12.5Hz,2H),6.40(t,J=8.7Hz,1H),4.51-4.4 4(m,2H),4.44-4.36(m,1H),4.24-4.16(m,2H),4.01(br.s.,1H),3.63-3.55(m,1H ),3.55-3.38(m,3H),3.34(d,J=4.3Hz,6H),2.16-2.07(m,1H),2.02-1.90(m,1H).

[0592] Example 70

[0593] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-((R)-3-methoxypyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0594]

[0595] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-cyanobenzoic acid is used instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0596] MS(ESI)M / Z:538.4[M+H] + .

[0597] 1 H NMR (400MHz, CDCl3) δ15.59(s,1H),8.64(s,1H),7.28(s,1H),7.05-6.89(m,3H),6.74(s,1H),6.41(d,J=9.1Hz,1H),4.06(s,1H),3.86(d,J=1 0.3Hz,2H),3.82-3.53(m,7H),3.34(s,3H),2.26-2.16(m,1H),2.04-1. 92(m,1H),1.76-1.67(m,2H),0.85(q,J=7.6Hz,1H),0.38-0.29(m,1H).

[0598] Example 71

[0599] (R)-6-(3-cyano-4-(3-methoxypyrrolidin-1-yl)phenyl)-1-(2-(3-methoxyazacyclobutane-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0600]

[0601] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-cyanobenzoic acid is used instead of 4-(pyrrolidine-1-yl)benzoic acid.

[0602] MS(ESI)M / Z:542.3[M+H] + .

[0603] 1 H NMR (400MHz, CDCl3) δ15.56(s,1H),8.65(s,1H),7.32(d,J=8.3Hz,1H),7.28(d,J =2.0Hz,1H),7.07-6.91(m,3H),6.75(s,1H),6.42(d,J=9.1Hz,1H),4.54-4.45(m, 2H),4.45-4.37(m,1H),4.23(dd,J=9.1,3.6Hz,2H),4.07(s,1H),3.85-3.74(m,1H ),3.72-3.56(m,3H),3.36(d,J=3.1Hz,6H),2.25-2.18(m,1H),2.05-1.93(m,1H).

[0604] Example 72

[0605] 1-(2-((R)-2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-6-(4-((R)-3-methoxypyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0606]

[0607] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-(trifluoromethyl)benzoic acid is used instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0608] MS(ESI)M / Z: 613.4 [M+H] + .

[0609] 1H NMR (400MHz, CDCl3) δ15.70(s,1H),8.66(s,1H),7.42(s,1H),7.29(d,J=8.3Hz,1H),7.05-6.94(m,3H),6.79(s,1H),6.64(d,J=8 .9Hz,1H),4.24(s,1H),4.02(s,1H),3.75-3.49(m,6H),3.37(br.s.,4H),3.32(br.s.,4H),2.18-2.06(m,4H),2.05-1.92(m,2H).

[0610] Example 73

[0611] (R)-1-(2-(3-methoxyazacyclobutan-1-yl)benzo[d]oxazol-6-yl)-6-(4-(3-methoxypyrrolidan-1-yl)-3-(trifluoromethyl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0612]

[0613] The preparation method is described in Example 1 and Example 59, in which 4-bromo-3-(trifluoromethyl)benzoic acid is used instead of 4-(pyrrolidone-1-yl)benzoic acid.

[0614] MS(ESI)M / Z:585.1[M+H] + .

[0615] 1 H NMR (400MHz, CDCl3) δ15.66(s,1H),8.66(s,1H),7.40(d,J=2.2Hz,1H),7.31(d,J= 8.5Hz,1H),7.04-6.94(m,3H),6.79(s,1H),6.64(d,J=8.9Hz,1H),4.51-4.44(m,2 H),4.44-4.37(m,1H),4.21(dd,J=9.3,3.7Hz,2H),4.05-4.00(m,1H),3.66-3.58( m,1H),3.57-3.47(m,1H),3.39-3.28(m,8H),2.17-2.09(m,1H),2.03-1.93(m,1H).

[0616] Example 74

[0617] (R)-6-(3-bromo-4-(3-methoxypyrrolidin-1-yl)phenyl)-1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxy-1,4-dihydropyridine-3-carboxylic acid

[0618]

[0619] MS(ESI)M / Z: 653.6 [M+H] + .

[0620] 1 H NMR (400MHz, CDCl3) δ15.69 (s, 1H), 8.65 (s, 1H), 7.34 (d, J = 2.1Hz, 1H), 7.28 ( d,J=8.3Hz,1H),7.03-6.93(m,2H),6.82(dd,J=8.6,2.2Hz,1H),6.77(s,1H), 6.55(d,J=8.7Hz,1H),4.03-3.98(m,1H),3.83-3.70(m,5H),3.58-3.50(m,3H ),3.41-3.29(m,8H),2.64(br.s.,6H),2.12-2.05(m,1H),2.04-1.93(m,1H).

[0621] Example 75

[0622] 1-(2-(2-azaspirocyclic[4.4]non-2-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0623]

[0624] The preparation method is described in Example 1, using 2-azaspirocyclic[4.4]nonane instead of (R)-2-(methoxymethyl)pyrrolidine as the raw material.

[0625] MS(ESI)M / Z:525.6[M+H] + .

[0626] 1 H NMR (400MHz, CDCl3) δ16.02(s,1H),8.65(s,1H),7.24(s,1H),7.03(d,J=2.0Hz,1H),6.97- 6.92(m,3H),6.79(s,1H),6.34(d,J=8.8Hz,2H),3.71(t,J=6.9Hz,2H),3.48(s,2H),3.27-3 .19(m,4H),2.01-1.96(m,4H),1.94(t,J=7.0Hz,2H),1.73-1.68(m,4H),1.67-1.58(m,4H).

[0627] Example 76

[0628] 1-(2-(5-methylhexahydropyrrolo[3,4-c]pyrrolo-2(1H)-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid)

[0629]

[0630] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 2-methyloctahydropyrrole[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0631] MS(ESI)M / Z:594.4[M+H] + .

[0632] 1 H NMR (400MHz, CDCl3) δ15.72(s,1H),8.66(s,1H),7.41(d,J=2.3Hz,1H),7.28(d,J =8.3Hz,1H),7.03(d,J=2.1Hz,1H),6.99-6.92(m,2H),6.79(s,1H),6.62(d,J=9.0 Hz,1H),3.91-3.80(m,2H),3.63(d,J=11.5Hz,2H),3.41-3.30(m,4H),3.13(br.s. ,2H),2.81(br.s.,2H),2.67(br.s.,2H),2.45(br.s.,3H),1.94(t,J=6.5Hz,4H).

[0633] Example 77

[0634] 1-(2-(5-(2-methoxyethyl)hexahydropyrrolo[3,4-c]pyrrolo-2(1H)-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0635]

[0636] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 2-(2-methoxyethyl)octahydropyrrole[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0637] MS(ESI)M / Z: 638.4 [M+H] + .

[0638] 1 H NMR (400MHz, CDCl3) δ15.72 (s, 1H), 8.66 (s, 1H), 7.40 (d, J = 2.2Hz, 1H), 7. 29(d,J=8.3Hz,1H),7.06(d,J=2.1Hz,1H),6.99-6.94(m,2H),6.79(s,1H), 6.63(d,J=9.0Hz,1H),3.86-3.77(m,2H),3.73-3.57(m,4H),3.42-3.28(m, 8H),3.18(brs,3H),2.88(br.s.,2H),2.68(br.s.,2H),1.99-1.90(m,4H).

[0639] Example 78

[0640] 6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-1-(2-(5-methylhexahydropyrrolo[3,4-c]pyrrolo-2(1H)-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0641]

[0642] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and 2-methyloctahydropyrrole[3,4-c]pyrrole instead of (R)-2-(methoxymethyl)pyrrole as raw materials.

[0643] MS(ESI)M / Z:551.5[M+H] + .

[0644] 1 H NMR(400MHz, CDCl3)δ15.62(s,1H),8.65(s,1H),7.29-7.27(m,2H),7.04(d, J=2.1Hz,1H),6.93(dd,J=8.3,2.1Hz,2H),6.75(s,1H),6.41(d,J=9.1Hz,1H ),3.91-3.82(m,2H),3.63(d,J=10.9Hz,2H),3.58(t,J=6.5Hz,4H),3.12(br .s.,2H),2.80(br.s.,2H),2.70(br.s.,2H),2.44(s,3H),2.04-1.95(m,4H).

[0645] Example 79

[0646] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-(3,3-difluoropyrrolidone-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0647]

[0648] The preparation method is described in Example 1 and Example 59, using 4-bromo-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid as the raw material.

[0649] MS(ESI)M / Z:544.2[M+H] + .

[0650] 1 H NMR (400MHz, CDCl3) δ8.65(s,1H),7.37(d,J=8.3Hz,1H),7.31(d,J=2.0Hz,1H),7. 13(s,1H),7.07(dd,J=9.0,1.9Hz,1H),6.92(d,J=7.2Hz,1H),6.79(s,1H),6.45(d ,J=9.0Hz,1H),3.98(t,J=12.5Hz,2H),3.88(d,J=10.5Hz,2H),3.84-3.71(m,4H), 2.54-2.41(m,2H),1.79-1.72(m,2H),0.91(q,J=7.8Hz,1H),0.33(q,J=4.3Hz,1H).

[0651] Example 80

[0652] 1-(2-(3-azabicyclo[3.1.0]hexane-3-yl)benzo[d]oxazol-6-yl)-6-(3-cyano-4-((S)-3-fluoropyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0653]

[0654] The preparation method is described in Example 1 and Example 59, using 4-bromo-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid as the raw material.

[0655] MS(ESI)M / Z: 526.6 [M+H] + .

[0656] 1H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.40 (d, J = 8.3Hz, 1H), 7.29 (s, 1H), 7.12 (s, 1H) ),7.02(d,J=8.8Hz,1H),6.96(s,1H),6.80(s,1H),6.47(d,J=9.1Hz,1H),4.01-3. 94(m,1H),3.93-3.82(m,3H),3.81-3.75(m,2H),3.74-3.66(m,2H),2.46-2.34(m ,1H),2.21-1.97(m,2H),1.80-1.71(m,2H),0.94-0.84(m,1H),0.37-0.30(m,1H).

[0657] Example 81

[0658] (R)-6-(3-(4-pyrazole)-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester

[0659]

[0660] At room temperature, ethyl (R)-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (200 mg, 0.32 mmol) was added to DME (7 mL) and water (3.5 mL), followed by potassium carbonate (133.5 mg, 0.97 mmol) and pyrazole-4-boric acid (72 mg, 0.64 mmol), and finally Pd(PPh3)4 (catalytic amount). The reaction mixture was reacted at 90 °C for 2 h. The reaction solution was cooled to room temperature, and water (20 mL) was added. The mixture was extracted with dichloromethane (20 mL × 3 times), and the organic phases were combined. The organic phases were washed with saturated brine (20 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The crude product was purified by preparative high performance liquid chromatography and lyophilized to obtain 21.22 mg of (R)-6-(3-(4-pyrazole)-4-(pyrrolidine-1-yl)phenyl)-1-(2-(2-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (compound 81).

[0661] MS(ESI)M / Z:581.3[M+H] + .

[0662] 1H NMR (400MHz, CDCl3) δ8.67(s,1H),7.54(br.s.,2H),7.33(d,J=8.3Hz,1H),7.10(d,J=2.1Hz,1H),7.00-6.90(m,3H),6.84(s,1H),6.67(d,J=8.5 Hz,1H),3.78-3.65(m,1H),3.64-3.55(m,2H),3.40-3.34(m,4H),2.95(b r.s.,4H),2.15-2.09(m,4H),2.09-2.01(d,J=13.5Hz,1H),1.80(s,4H).

[0663] Example 82

[0664] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-((2R,5S)-2,5-dimethylpyrrolidone-1-ylbenzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid)

[0665]

[0666] Step 1: 2-Chloro-6-nitrobenzo[d]oxazole (500 mg, 2.52 mmol) was dissolved in DCM / DMF (2 / 1, 15 mL), and (2R,5S)-2,5-dimethylpyrrolidine (411 mg, 3.03 mmol) and triethylamine (770 mg, 7.6 mmol) were added. The reaction mixture was kept at room temperature overnight. After cooling to room temperature, water (20 mL) was added, and the mixture was extracted with dichloromethane (20 mL × 3 times). The organic phases were combined, washed with saturated brine (20 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure to obtain 630 mg of 2-((2R,5S)-2,5-dimethylpyrrolidine-1-yl)-6-nitrobenzo[d]oxazole (82-1).

[0667] MS(ESI)M / Z:261.7[M+H] + .

[0668] 1 H NMR (400MHz, CDCl3) δ7.15 (d, J=8.4Hz, 1H), 6.71 (s, 1H), 6.55 (dd, J=8.0, 2.0Hz, 1H), 4.15 -4.11(m,2H),3.15(s,2H),2.21-2.02(m,2H),1.78-1.74(m,2H),1.41(s,3H),1.40(s,3H).

[0669] Step 2: Dissolve 2-((2R,5S)-2,5-dimethylpyrrolidone-1-yl)-6-nitrobenzo[d]oxazole (630 mg, 2.42 mmol) in a mixture of ethanol (10 mL) and water (10 mL), add reduced iron powder (678.5 mg, 12.11 mmol) and ammonium chloride (1295 mg, 24.2 mmol), and react the mixture overnight at room temperature. After cooling to room temperature, concentrate under reduced pressure, add water (20 mL), extract with dichloromethane (20 mL × 3 times), combine the organic phases, wash with saturated brine, dry with anhydrous sodium sulfate, and concentrate under reduced pressure to obtain 500 mg of 2-((2R,5S)-2,5-dimethylpyrrolidone-1-yl)-6-aminobenzo[d]oxazole (82-2).

[0670] MS(ESI)M / Z:230.7[M+H] + .

[0671] Step 3: Ethyl 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid ester (404 mg, 1.20 mmol) and 2-((2R,5S)-2,5-dimethylpyrrolidone-1-yl)-6-aminobenzo[d]oxazole (250 mg, 1.09 mmol) were added to acetic acid solution (6 mL). The mixture was stirred at 5 °C for 5 minutes, and then heated to 95 °C for 2 hours. After cooling to room temperature, most of the solvent was concentrated, and the reaction was neutralized by adding saturated sodium bicarbonate solution (20 mL). The mixture was extracted with dichloromethane (20 mL × 3 times), and the organic phases were combined. The organic phases were washed with saturated brine (20 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 250 mg of ethyl 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-((2R,5S)-2,5-dimethylpyrrolidone-1-ylbenzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylate (82-3).

[0672] MS(ESI)M / Z:552.4[M+H] + .

[0673] Step 4: At room temperature, ethyl 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-((2R,5S)-2,5-dimethylpyrrolidone-1-ylbenzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylate (250 mg, 0.45 mmol) was dissolved in tetrahydrofuran / water (3 / 1, 10 mL), and lithium hydroxide monohydrate (38.1 mg, 0.91 mmol) was added. The mixture was stirred overnight at room temperature. Citric acid was added to the reaction system. The reaction was neutralized (2 mL), then water (4 mL) was added and stirred. The mixture was extracted with dichloromethane (3 mL × 2 times), the organic phases were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative high performance liquid chromatography to give 28.1 mg of 6-(3-cyano-4-(pyrrolidine-1-yl)phenyl)-1-(2-((2R,5S)-2,5-dimethylpyrrolidine-1-ylbenzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (compound 82).

[0674] MS(ESI)M / Z:524.3[M+H] + .

[0675] 1 H NMR (400MHz, CDCl3) δ8.64(s,1H),7.41(d,J=8.3Hz,1H),7.25(d,J=2.1Hz,1H),7.22(s,1H),6.99(d,J=6.6Hz,1H),6.92(d,J=8.2Hz,1H),6.78 (s,1H),6.47(d,J=8.9Hz,1H),4.29(s,2H),3.66-3.54(m,4H),2.27-2. 17(m,2H),2.05-1.96(m,4H),1.92-1.81(m,2H),1.47(d,J=6.1Hz,6H).

[0676] Example 83

[0677] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2R,5R)-2,5-dimethylpyrrolidone-1-ylbenzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0678]

[0679] The preparation method is described in Example 1 and Example 82, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (2R,5R)-2,5-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0680] MS(ESI)M / Z:524.4[M+H] + .

[0681] 1 H NMR (400MHz, CDCl3) δ8.65(s,1H),7.46(d,J=8.4Hz,1H),7.26-7.22(m,2H),7.00(s,1H),6.92(d,J=8.4Hz,1H),6.80(s,1H),6.52- 6.44(m,1H),4.48-4.36(m,2H),3.63-3.56(m,4H),2.39-2.29(m,2H),2.05-1.95(m,4H),1.85-1.75(m,2H),1.35(d,J=4.0Hz,6H).

[0682] Example 84

[0683] (R)-6-(3-acetyl-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0684]

[0685] Step 1: At room temperature, (R)-6-(3-bromo-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (400 mg, 0.65 mmol), tributyl(1-ethoxyvinyl)tin (232 mg, 0.65 mmol), and Pd(PPh3)Cl2 (catalytic amount) were suspended in DMF, purged with nitrogen, and reacted overnight at 100°C. The reaction solution was concentrated under reduced pressure, diluted with water, extracted with ethyl acetate (20 mL × 3 times), the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by preparative high performance liquid chromatography to give 78 mg of (R)-6-(3-(4-pyrazole)-4-(pyrrolidine-1-yl)phenyl)-1-(2-(2-(2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (84-1).

[0686] MS(ESI)M / Z:585.3[M+H] + .

[0687] Step 2: At room temperature, ethyl (R)-6-(3-acetyl-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (78 mg, 0.13 mmol) was dissolved in tetrahydrofuran (6 mL). Subsequently, an aqueous solution of sodium hydroxide (10.6 mg, 0.27 mmol) (2 mL) was added to the above solution in an ice-water bath. The reaction mixture was stirred overnight at room temperature. After adding water (10 mL) and concentrating under reduced pressure to remove tetrahydrofuran, citric acid was added to the reaction system to adjust the pH to 5-6, and a yellow solid precipitated out. After filtration, 13.53 mg of (R)-6-(3-acetyl-4-(pyrrolidone-1-yl)phenyl)-1-(2-(2-(methoxymethyl)pyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid (compound 84) was obtained.

[0688] MS(ESI)M / Z:557.0[M+H] + .

[0689] 1 H NMR (400MHz, CD3OD) δ8.74(s,1H),7.50-7.37(m,2H),7.31-7.17(m,3H),6.88(s,1H),6.73(d,J=8.9Hz,1H),4.21(br.s.,1H),3.71-3. 58(m,2H),3.55(d,J=4.8Hz,2H),3.34(s,3H),3.07-3.00(m,4H),2.37(s,3H),2.15-2.06(m,3H),2.03-1.97(m,1H),1.94-1.88(m,4H).

[0690] Example 85

[0691] 1-(2-(4-(2-hydroxyethyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0692]

[0693] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 1-(2-hydroxyethyl)piperazine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0694] MS(ESI)M / Z:597.5[M+H]+ .

[0695] 1 H NMR(400MHz, CDCl3)δ8.66(s,1H),7.37-7.33(m,2H),7.13(d,J=2.1Hz,1H),7.04(dd,J=8.4,2.2Hz,1H),7.01-6.97(m,1H),6.82(s,1H) ,6.65(d,J=9.0Hz,1H),4.17(br.s.,4H),4.11-4.06(m,2H),3.52(br.s.,4H),3.39-3.30(m,4H),3.28-3.25(m,2H),1.98-1.89(m,4H).

[0696] Example 86

[0697] 1-(2-(2-(2-hydroxy-2-methylpropyl)piperazin-1-yl)benzo[d]oxazol-6-yl)-6-(4-(pyrrolidin-1-yl)pyridine-3-(trifluoromethyl)phenyl)-1,4-dihydro-4-oxo-3-carboxylic acid

[0698]

[0699] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and 2-methyl-1-(piperazin-1-yl)acetone-2-ol instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0700] MS(ESI)M / Z: 626.6 [M+H] + .

[0701] 1 H NMR (400MHz, CDCl3) δ8.72 (s, 1H), 7.39-7.33 (m, 2H), 7.24 (d, J = 2.0Hz, 1H), 7.03-6.96 (m, 3H), 6.65 (d ,J=9.1Hz,1H),4.44-3.80(m,6H),3.38(br.s.,5H),3.21(br.s.,3H),1.98-1.92(m,4H),1.44(s,6H).

[0702] Example 87

[0703] (S)-6-(3-cyano-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-methylpyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0704]

[0705] The preparation method is described in Example 1, using 4-(pyrrolidine-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidine-1-yl)benzoic acid and (S)-2-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0706] MS(ESI)M / Z:510.3[M+H] + .

[0707] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.48 (d, J = 8.4Hz, 1H), 7.26-7.21 (m, 2H ),7.02-6.97(m,1H),6.96-6.91(m,1H),6.80(s,1H),6.49-6.44(m,1H),4 .40(s,1H),3.91-3.84(m,1H),3.79-3.72(m,1H),3.62-3.57(m,4H),2.25 -2.11(m,3H),2.03-1.99(m,4H),1.90-1.83(m,1H),1.41(d,J=6.4Hz,3H).

[0708] Example 88

[0709] (R)-6-(3-cyano-4-(pyrrolidin-1-yl)phenyl)-1-(2-(2-methylpyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0710]

[0711] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (R)-2-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0712] MS(ESI)M / Z:510.2[M+H] + .

[0713] 1H NMR (400MHz, CDCl3) δ15.58(br.s.,1H),8.65(s,1H),7.34(d,J=8.4Hz,1H),7.25(s,1 H),7.14(s,1H),6.98(d,J=9.0Hz,1H),6.91(dd,J=8.4,1.9Hz,1H),6.76(s,1H),6.44 (d,J=8.0Hz,1H),4.30(br.s.,1H),3.84-3.76(m,1H),3.74-3.65(m,1H),3.63-3.54( m,4H),2.24-2.12(m,2H),2.02-1.98(m,4H),1.83-1.78(m,2H),1.39(d,J=6.4Hz,3H).

[0714] Example 89

[0715] 1-(2-((2R,5S)-2,5-dimethylpyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0716]

[0717] The preparation method is described in Example 1 and Example 82, using 4-(pyrrolidine-1-yl)benzoic acid and (2R,5S)-2,5-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0718] MS(ESI)M / Z:499.4[M+H] + .

[0719] 1 H NMR (400MHz, CDCl3) δ8.64 (s, 1H), 7.35 (d, J = 8.4Hz, 1H), 7.13 (d, J = 2.0Hz, 1H), 7.00-6.95 (m, 3H), 6.81 (s, 1H), 6.37 (d, J = 8. 6Hz,2H),4.23(br.s.,2H),3.30-3.20(m,4H),2.20-2.16(m,2H),2.02-1.97(m,4H),1.87-1.81(m,2H),1.44(d,J=4.0Hz,6H).

[0720] Example 90

[0721] (R)-1-(2-(2-methylpyrrolidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0722]

[0723] The preparation method is described in Example 1 and Example 82, using 4-(pyrrolidine-1-yl)benzoic acid and (R)-2-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0724] MS(ESI)M / Z:485.4[M+H] + .

[0725] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.42 (d, J = 8.4Hz, 1H), 7.17 (s, 1H), 7.01-6.97 (m, 1H), 6.95-6. 91(m,2H),6.82(s,1H),6.39-6.34(m,2H),4.36(br.s.,1H),3.89-3.80(m,1H),3.77-3.69(m,1H), 3.29-3.22(m,4H),2.22-2.07(m,2H),2.02-1.98(m,4H),1.86-1.81(m,2H),1.39(d,J=6.4Hz,3H).

[0726] Example 91

[0727] 1-(2-(R)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-6-(4-(R)-2-methylpyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0728]

[0729] The preparation method is described in Example 1 and Example 59, using 4-bromobenzoyl chloride instead of 4-bromo-3-cyanobenzoic acid and (R)-2-methylpyrrole instead of (R)-3-methoxypyrrolidine as raw materials.

[0730] MS(ESI)M / Z:529.5[M+H] + .

[0731] 1H NMR (400MHz, CDCl3) δ8.67(s,1H),7.43(d,J=8.4Hz,1H),7.18(s,1H),7.02(d,J=9.7Hz ,1H),6.97-6.92(m,2H),6.88(s,1H),6.44-6.38(m,2H),4.34(br.s.,1H),3.87-3.82(m ,1H),3.80-3.76(m,1H),3.73-3.67(m,1H),3.62-3.57(m,1H),3.56-3.52(m,1H),3.42 -3.38(m,1H),3.37(s,3H),3.17-3.10(m,1H),2.19-1.98(m,8H),1.13(d,J=6.4Hz,3H).

[0732] Example 92

[0733] 1-(2-(S)-2-(methoxymethyl)pyrrolidine-1-yl)benzo[d]oxazol-6-yl)-6-(4-(S)-2-methylpyrrolidine-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0734]

[0735] The preparation method is described in Example 1 and Example 59, using 4-bromobenzoyl chloride instead of 4-bromo-3-cyanobenzoic acid and (S)-2-methylpyrrole instead of (R)-3-methoxypyrrolidine as raw materials.

[0736] MS(ESI)M / Z:529.5[M+H] + .

[0737] 1 H NMR (400MHz, CDCl3) δ8.70(s,1H),7.51(d,J=8.6Hz,1H),7.06(d,J=8.2Hz,1H),7.01-6.94(m,3H),6.60-6.53(m,2H),4.43(s,1H),3.88-3.8 1(m,2H),3.80-3.72(m,1H),3.67-3.59(m,1H),3.55-3.44(m,2H),3.3 7(s,3H),3.22-3.12(m,1H),2.27-2.00(m,8H),1.16(d,J=6.4Hz,3H).

[0738] Example 93

[0739] 1-(2-((2R,5S)-2,6-dimethylpyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0740]

[0741] The preparation method is described in Example 1 and Example 82, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (2R,5S)-2,5-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0742] MS(ESI)M / Z:567.5[M+H] + .

[0743] 1 H NMR (400MHz, CDCl3) δ15.75 (s, 1H), 8.66 (s, 1H), 7.45 (d, J = 2.4Hz, 1H), 7.28 (s ,1H),7.07(d,J=2.2Hz,1H),6.97(dd,J=9.0,2.4Hz,1H),6.93(dd,J=8.4,2.2Hz ,1H),6.80(s,1H),6.63(d,J=9.0Hz,1H),4.20-4.12(m,2H),3.39-3.33(m,4H), 2.18-2.13(m,2H),1.97-1.90(m,4H),1.85-1.77(m,2H),1.43(d,J=6.4Hz,6H).

[0744] Example 94

[0745] 1-(2-((2R,5R)-2,6-dimethylpyrrolidone-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0746]

[0747] The preparation method is described in Example 1 and Example 82, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (2R,5R)-2,5-dimethylpyrrolidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0748] MS(ESI)M / Z:567.4[M+H] + .

[0749] 1 H NMR (400MHz, CDCl3) δ8.68(s,1H),7.50(d,J=8.4Hz,1H),7.40(d,J=2.3Hz,1H),7.25(s,1H),7.01-6.94(m,2H),6.89(s,1H),6.66( d,J=9.0Hz,1H),4.46-4.39(m,2H),3.38(br.s,4H),2.41-2.28(m,2H),1.99-1.91(m,4H),1.86-1.75(m,2H),1.33(d,J=6.3Hz,6H).

[0750] Example 95

[0751] 1-(2-((2R,6S)-2,6-dimethylpiperidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidin-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0752]

[0753] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-(trifluoromethyl)benzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (2R,6S)-2,6-dimethylpiperidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0754] MS(ESI)M / Z:581.4[M+H] + .

[0755] 1 H NMR (400MHz, CDCl3) δ15.73(br.s.,1H),8.66(s,1H),7.42(d,J=2.4Hz,1H),7.2 8(s,1H),7.06(d,J=2.0Hz,1H),6.98(dd,J=9.0,2.4Hz,1H),6.93(dd,J=8.4,2.2 Hz,1H),6.80(s,1H),6.64(d,J=8.8Hz,1H),4.57-4.46(m,2H),3.40-3.32(m,4H) ,1.97-1.92(m,4H),1.86-1.76(m,3H),1.73-1.68(m,3H),1.37(d,J=7.0Hz,6H).

[0756] Example 96

[0757] 6-(3-cyano-4-(pyrrolidone-1-yl)phenyl)-1-(2R,6S)-2,6-dimethylpiperidin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0758]

[0759] The preparation method is described in Example 1, using 4-(pyrrolidone-1-yl)-3-cyanobenzoic acid instead of 4-(pyrrolidone-1-yl)benzoic acid and (2R,6S)-2,6-dimethylpiperidine instead of (R)-2-(methoxymethyl)pyrrolidine as raw materials.

[0760] MS(ESI)M / Z:538.0[M+H] + .

[0761] 1 H NMR (400MHz, CDCl3) δ8.65 (s, 1H), 7.34 (d, J = 8.4Hz, 1H), 7.29 (s, 1H), 7.14 (s, 1H), 7.00-6.95 (m, 1H), 6.92-6.88 (m, 1H), 6.77 (s,1H),6.48-6.43(m,1H),4.60-4.51(m,2H),3.61-3.56(m,4H),2.02-1.98(m,4H),1.95-1.83(m,6H),1.41(d,J=6.9Hz,6H).

[0762] Example 97

[0763] 1-(2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid

[0764]

[0765] Step 1: At room temperature, (2R,6S)-2,6-dimethylpiperazine-1-carboxylic acid tert-butyl ester (5.0 g, 23.35 mmol) was dissolved in DMF (50 mL), followed by the addition of 2-bromoethyl methyl ether (6.49 g, 46.7 mmol) and potassium carbonate (3.55 g, 25.69 mmol). The reaction mixture was heated under reflux overnight. After cooling to room temperature, the reaction was quenched with water (50 mL), extracted with dichloromethane (50 mL × 3 times), and the organic phases were combined. The mixture was washed with saturated brine (50 mL × 3 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure to obtain 4.2 g of (2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazine-1-carboxylic acid tert-butyl ester (97-2).

[0766] MS(ESI)M / Z:272.8[M+H] + .

[0767] Step 2: Dissolve (2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazine-1-carboxylic acid tert-butyl ester (4.2 g, 15.44 mmol) in ethyl acetate (30 mL), add hydrogen chloride / ethyl acetate (6N, 30 mL) solution under ice bath, react at room temperature for 2 hours, and concentrate under reduced pressure to obtain 3.4 g of (3R,5S)-1-(2-methoxyethyl)-3,5-dimethylpiperazine hydrochloride (97-3).

[0768] MS(ESI)M / Z:173.1[M+H] + .

[0769] Step 3: 2-Chloro-6-nitrobenzo[d]oxazole (2.68 g, 13.58 mmol) was dissolved in DCM / DMF (2 / 1, 30 mL), and (3R, 5S)-1-(2-methoxyethyl)-3,5-dimethylpiperazine hydrochloride (3.4 g, 16.3 mmol) and triethylamine (8.2 g, 81.5 mmol) were added. The mixture was stirred overnight at room temperature. The reaction was quenched with water (50 mL), and the mixture was extracted with dichloromethane (50 mL × 3 times). The organic phases were combined, washed with saturated brine (50 mL × 2 times), dried over anhydrous sodium sulfate, filtered, and finally concentrated under reduced pressure to obtain 3.0 g of 2-((2R, 6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)-6-nitrobenzo[d]oxazole (97-4).

[0770] MS(ESI)M / Z:335.0[M+H] + .

[0771] Step 4: Dissolve 3.0 g (8.99 mmol) of 2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)-6-nitrobenzo[d]oxazole in a mixture of 40 mL of ethanol and 40 mL of water. Add 2.52 g (44.95 mmol) of reduced iron powder and 4.8 g (89.9 mmol) of ammonium chloride and stir overnight at room temperature. Cool to room temperature, concentrate under reduced pressure, add water (50 mL), and extract with dichloromethane (50 mL × 3 times). Combine the organic phases, wash with saturated brine, dry with anhydrous sodium sulfate, concentrate under reduced pressure, and purify by silica gel column chromatography to obtain 500 mg of 2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazole-6-amine (97-5).

[0772] MS(ESI)M / Z: 327.3 [M+Na] + .

[0773] 1 H NMR (400MHz, CDCl3) δ7.18-7.13(m,1H),6.69(d,J=2.2Hz,1H),6.56-6.52(m,1H),4.32-4.24(m,2H),3.6 2-3.56(m,2H),3.38(s,3H),2.85-2.78(m,2H),2.65(br.s.,2H),2.42(br.s.,2H),1.44(d,J=7.0Hz,6H).

[0774] Step 5: At 5°C, 6-(3-trifluoromethyl-4-(pyrrolidone-1-yl)phenyl)-4-oxo-4H-pyran-3-carboxylic acid ethyl ester (704 mg, 1.8 mmol) and 2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazol-6-amine (500 mg, 1.64 mmol) were added to acetic acid solution (8 mL). After stirring for 5 minutes, the reaction solution was heated to 95°C and reacted for 2 hours. Cool to room temperature, remove most of the solvent under reduced pressure, neutralize with saturated sodium bicarbonate solution (40 mL), extract with dichloromethane (40 mL × 3 times), combine the organic phases and wash with saturated brine (40 mL × 3 times), then dry with anhydrous sodium sulfate, filter, concentrate under reduced pressure and purify by silica gel column chromatography to obtain 200 mg of ethyl 1-(2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (97-6).

[0775] Step 6: At room temperature, ethyl 1-(2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidine-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (200 mg, 0.29 mmol) was dissolved in tetrahydrofuran / water (3 / 1, 15 mL), and sodium hydroxide (35 mg, 0.87 mmol) was added. The mixture was stirred overnight at room temperature. The reaction system was acidified to pH 3-4 by adding saturated citric acid (5 mL). The reaction solution was extracted with dichloromethane (5 mL × 3), and the organic phase was washed with saturated brine (10 mL × 2 times), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by preparative high performance liquid chromatography to give 28.4 mg of 1-(2-((2R,6S)-4-(2-methoxyethyl)-2,6-dimethylpiperazin-1-yl)benzo[d]oxazol-6-yl)-4-oxo-6-(4-(pyrrolidone-1-yl)-3-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-carboxylic acid (compound 97).

[0776] MS(ESI)M / Z: 640.6 [M+H] + .

[0777] 1 H NMR (400MHz, CDCl3) δ15.72 (s, 1H), 8.66 (s, 1H), 7.41 (d, J = 2.4Hz, 1H), 7.30-7.2 3(m,1H),7.07(s,1H),6.99(dd,J=8.9,2.4Hz,1H),6.93(dd,J=8.3,1.9Hz,1H),6. 80(s,1H),6.64(d,J=8.9Hz,1H),4.33(br.s.,2H),3.59(s,2H),3.39-3.33(m,7H) ,2.86(s,2H),2.66(s,2H),2.45(s,2H),1.97-1.92(m,4H),1.48(d,J=6.6Hz,6H).

[0778] Below are the structures of control compounds 1-3, synthesized according to existing technology, such as the method disclosed in patent US2020 / 0017459, or according to methods known in the art.

[0779] Control 1

[0780] 6-(3-chloro-4-(pyrrolidone-1-yl)phenyl)-1-(2-(4-(2-methoxyethyl)piperazin-1-yl)benzothiazo-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0781]

[0782] Control 2

[0783] (R)-6-(3-fluoro-4-(3-methoxypyrrolidin-1-yl)phenyl)-1-(2-(3-methoxyazacyclobutan-1-yl)benzothiazo-6-yl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0784]

[0785] Control 3

[0786] 1-(2-(R)-2-(methoxymethyl)pyrrolidone-1-yl)benzothiazolyl-6-yl)-6-(4-(R)-3-methoxypyrrolidone-1-yl)phenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid

[0787]

[0788] HBV in vitro test

[0789] The levels of HBV surface antigen and E antigen were detected by enzyme-linked immunosorbent assay (ELISA), with the IC50 of the compounds as the metric. 50 The value is used as an indicator to evaluate the inhibitory effect of compounds on HBV.

[0790] 1. Experimental Materials

[0791] Cell line: HepG2.2.15 cells

[0792] HepG2.2.15 cell culture medium (MEM, Gibco-12561056; 10 v / v% serum, Gibco-10099-141; 100 units / mL penicillin and 100 μg / mL streptomycin, Gibco-15140122; 1% non-essential amino acid solution, Gibco-11140050; 1 v / v% GlutaMAX, Gibco-35050061)

[0793] 2. Reagents:

[0794] Pancreatic enzyme (Gibco-25200-072)

[0795] DPBS (Duborough Phosphate Buffer, Gibco-14200075)

[0796] Hepatitis B Surface Antigen Detection Kit (KHB Kehua Biotechnology)

[0797] Cell-Tilter Glo reagent (Promega-G7572)

[0798] 3. Consumables and Instruments:

[0799] 96-well cell culture plate (Corning-CLS3690)

[0800] EnVision Multifunctional Microplate Reader (PerkinElmer)

[0801] CO2 incubator (Thermofisher, Steri-i160)

[0802] 4. Experimental steps and methods:

[0803] 4.1 HepG2.2.15 cells (1.5 × 10⁻⁶) were placed in the culture medium. 4 (10 cells / well) were seeded into 96-well plates and incubated overnight at 37°C in a 5v / v% CO2 incubator.

[0804] 4.2 The compound was serially diluted 3-fold at the highest concentration of 1 μM, resulting in a total of 9 concentrations. Twenty-four hours after cell seeding, the serially diluted compound was added to each well in duplicate. The final DMSO (dimethyl sulfoxide) concentration in the culture medium was ensured to be 0.5 v / v%. 1 μM RG7834 was used as a 100% inhibition control, and 0.5 v / v% DMSO was used as a 0% inhibition control.

[0805] 4.3 On the third day after drug administration, the culture medium in the 96-well plate was collected and diluted 1:5 for ELISA to detect the expression levels of hepatitis B virus S antigen and E antigen; 50 μL of CTG reagent was added to the cells to detect the drug's cytotoxicity.

[0806] 4.4 ELISA detection of hepatitis B virus S antigen content

[0807] Add 60 μL of DPBS as a diluent to the ELISA plate, then add 15 μL of supernatant, mix thoroughly, and incubate at 37°C for 30 minutes. Add 50 μL of enzyme conjugate to each well, vortex to mix, and incubate at 37°C for 30 minutes. Wash the plate 5 times with washing buffer, add 50 μL of color development solution A and 50 μL of color development solution B to each well, incubate at 37°C for 10 minutes, then add 50 μL of luminescent substrate. Finally, use a microplate reader to detect the chemiluminescence intensity.

[0808] 4.5 ELISA detection of hepatitis B virus e antigen content

[0809] Add 40 μL of DPBS as a diluent to the ELISA plate, then add 10 μL of supernatant, mix thoroughly, and add 50 μL of enzyme conjugate to each well. Vortex to mix and incubate at 37°C for 30 minutes. Wash the plate 5 times with washing buffer, add 50 μL of color development solution A and 50 μL of color development solution B to each well, incubate at 37°C for 10 minutes, and then add 50 μL of luminescent substrate. Finally, use a microplate reader to detect the chemiluminescence intensity.

[0810] 4.6 Cell viability assay

[0811] The Cell-Tilter Glo reagent was used for detection. 50 μL of CTG reagent was added to a 96-well plate, and the plate was shaken for 10 minutes before the fluorescence intensity was detected using a microplate reader.

[0812] 5. Data Analysis:

[0813] Calculate the percentage of inhibition: %Inh. = (100% inhibition - value in sample / 100% inhibition - 0% inhibition) × 100.

[0814] Computing IC 50 The 50% inhibitory concentration (IC50) of the compound against HBV was calculated using GraphPad Prism software. 50 )value.

[0815] Experimental results

[0816] The test results are shown in Table 1.

[0817] Table 1. Inhibitory effects of the compounds of this invention on hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg).

[0818] Control 1 2.25 3.83 Control 2 3.62 5.92 Control 3 7.41 14.50 1 4.07 4.86 2 5.02 4.86 5 5.71 6.67 7 6.68 5.02 9 5 13

[0819] 11 5.61 5.81 12 2.1 3.09 14 5.54 9.6 17 4.76 7.88 23 6.7 3.8 24 4.8 3.9 28 1.1 1.8 31 2.1 2.3 32 3.9 1.9 36 3.3 4.4 39 1.8 2.8 43 1.1 1.7 44 1.3 1.6 45 4.1 4.8 46 6.4 9.7 47 6.1 13.2 48 5.6 11.3 49 7.2 11.2 50 5.1 6.9 54 6 9.95 56 3.4 6.8 57 2.4 3.3 58 1.1 1.8 60 2.32 3.05 61 0.88 1.28 62 2.4 3.6 64 2.04 2.94 65 1.2 2.32 67 1.56 1.37 72 1.44 1.53 73 4.03 6.44 76 6.85 16.42 77 3.18 5.95 82 0.57 0.72 83 1.34 1.53 86 1.97 2.8 87 1.14 1.73 88 1.02 1.58 89 2.95 4.49 90 4.81 4.11 91 0.95 1.11 93 0.82 0.99

[0820] 95 2.75 4.06 96 0.96 1.22 97 0.7 1.50

[0821] Conclusion: The representative compounds of this invention can effectively inhibit hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg).

[0822] HBV-DNA in vitro test

[0823] 1. Experimental objective:

[0824] The HBV DNA content in HepG2.2.15 cells was detected by real-time quantitative qPCR, and IC50 was used. 50An evaluation was conducted to assess the inhibitory effect of the compound on HBV.

[0825] 2. Experimental materials:

[0826] 2.1 Cell line: HepG2.2.15 cells

[0827] HepG2.2.15 cell culture medium (MEM, Gibco-12561056; 10 v / v% serum, Gibco-10099-141; 100 units / mL penicillin and 100 μg / mL streptomycin, Gibco-15140122; 1 v / v% non-essential amino acid solution, Gibco-11140050; 1 v / v% GlutaMAX, Gibco-35050061)

[0828] 2.2 Reagents:

[0829] Pancreatic enzyme (Gibco-25200-072)

[0830] DPBS (Gibco-14200075)

[0831] qPCR reagent (PowerUp) TM SYBR TM Green Master Mix, Applied Biosystems-A25742)

[0832] 3. Consumables and Instruments:

[0833] 96-well cell culture plate (Corning-CLS3690)

[0834] qPCR plate (Applied Biosystem-4483354)

[0835] qPCR instrument (Applied Biosystems)

[0836] CO2 incubator (Thermofisher, Steri-i160)

[0837] 4. Experimental steps and methods:

[0838] 4.1 HepGG2.2.15 cells (1.0 × 10⁴ cells / well) were seeded into 96-well plates and incubated overnight at 37°C in a 5v / v% CO₂ incubator.

[0839] 4.2 The compound was serially diluted 3-fold at the highest concentration of 1000 nM, resulting in a total of 9 concentrations. Twenty-four hours after cell seeding, the serially diluted compound was added to triplet wells. The final DMSO concentration in the culture medium was ensured to be 0.5 v / v%. The 100 nM RG7834 CT value served as the 100% inhibition control, and the 0.5 v / v% DMSO CT value served as the 0% inhibition control.

[0840] 4.3 On the fifth day after drug administration, discard the supernatant in the 96-well plate, wash with PBS, and lyse the cells with 20 μL of 0.2 wt% CA630 for 15 minutes.

[0841] 4.4 Add 80 μL of ultrapure water.

[0842] 4.5 Take 8 μL for qPCR.

[0843] 4.6 Preparation of qPCR reaction solution:

[0844] PowerUp Mix 10 Pre-primer (10 micromoles) 1 Post-primer (10 micromoles) 1 template 8 Total volume 20

[0845] Pre-primer sequence: CTGTGCCTTGGGTGGCTTT (SEQ NO ID.1);

[0846] Back primer sequence: AAGGAAAGAAGTCAGAAGGCAAAA (SEQ NO ID.2).

[0847] 4.7 Add 20 μL of reaction mixture to each well of a 96-well PCR plate. The qPCR conditions are: 55℃ for 2 minutes, 95℃ for 10 minutes, followed by denaturation at 95℃ for 15 seconds and extension at 60℃ for 1 minute, for a total of 40 cycles.

[0848] 5. Data Analysis:

[0849] Calculate the percentage of inhibition:

[0850] %Inh. = [1 / 2 (0％inhibition样品中的CT值-待测样品中的CT值) ×100%.

[0851] Computing IC 50 The 50% inhibitory concentration (IC50) of the compound against HBV-DNA was calculated using GraphPad Prism software. 50 )value.

[0852] Experimental results

[0853] The test results are shown in Table 2.

[0854] Table 2. Inhibitory effect of the compounds of this invention on HBV-DNA

[0855] 11 2.74 12 0.62 43 0.69 47 0.98 77 1.39 82 0.20 83 0.40 86 0.33 87 0.19 88 0.28 89 0.16 91 0.68 93 0.23 94 0.74 95 0.60 96 0.11

[0856] Conclusion: The representative compound of this invention can effectively inhibit HBV-DNA.

[0857] Rat tissue distribution test

[0858] 1. Experimental Objective

[0859] The compounds were administered orally to SD rats, and the drug concentrations of each compound in rat plasma, liver, brain tissue, and cerebrospinal fluid at different time points after administration were measured to investigate the distribution and brain permeability of each compound in rats.

[0860] 2. Experimental Materials

[0861] 2.1 Experimental Animals

[0862] Healthy adult male SD rats, SPF grade, 180-200g, 15 rats for each compound.

[0863] 2.2 Reagents

[0864] Polyoxyethylene hydrogenated castor oil RH40 (RH40), anhydrous ethanol or 95 v / v% ethanol, ultrapure water;

[0865] Methanol, acetonitrile, DMSO, isopropanol, formic acid.

[0866] 3. Main Instruments

[0867] High-performance liquid chromatograph (Shimadzu HPLC 20-AD)

[0868] Mass spectrometer (AB Sciex API 4000 triple quadrupole)

[0869] Electronic balance (Mettler Toledo XSE205)

[0870] Millipore Milli-Q Integral 3 water purifier

[0871] High-speed refrigerated centrifuge (Sigma 2-16K / Thermo Scientific Sorvall ST8R)

[0872] Vortex Oscillator (Scientific Industries VORTEX-2)

[0873] Multi-tube vortex oscillator (Beijing Tajin Technology Co., Ltd. VX-II)

[0874] -20℃ / 2-8℃ refrigerator (Qingdao Haier Co., Ltd. BCD-290W)

[0875] -80℃ Ultra-Low Temperature Freezer (Qingdao Haier Co., Ltd. DW-86L628)

[0876] Pipettes (Eppendorf / Thermo / BIO-DL / RAININ)

[0877] Chromatographic column: Waters C18 3.5μm (3.0×50mm)

[0878] 4. Experimental Procedures and Methods

[0879] 4.1 Preparation of test sample

[0880] Weigh an appropriate amount of the compound and add the following solvent: 5 v / v% RH40 + 5 v / v% ethanol + 90 v / v% pure water (adjust the pH to 8-9 with NaOH solution). Mix well. If the compound cannot be completely dissolved, use 1 mmol / L NaOH solution to finely adjust the pH to obtain a clear solution, but the pH should not exceed 9.

[0881] 4.2 Sample Collection

[0882] SD rats were fasted overnight and then administered the drugs via gavage at a volume of 10 mL / kg, depending on their body weight. Three animals were administered each compound at five time points: 0.25 h ± 2 min, 1 h ± 5 min, 2 h ± 5 min, 4 h ± 10 min, and 8 h ± 10 min. After anesthesia, approximately 1 mL of blood and 0.1–0.2 mL of cerebrospinal fluid were collected from the abdominal vein, along with brain tissue and liver tissue. Whole blood was anticoagulated with heparin and centrifuged at 12,000 rpm for 1 min to obtain plasma. The plasma and tissues were frozen at -70°C for later analysis.

[0883] 4.3 Detection of biological samples

[0884] Weigh tissue samples (brain tissue and liver), add ultrapure water at a ratio of tissue sample: ultrapure water (1g: 5mL) to homogenize the tissue and obtain tissue homogenate.

[0885] Biological samples (plasma, cerebrospinal fluid, liver homogenate, brain tissue homogenate) were pretreated with methanol or acetonitrile solution containing internal standard for protein precipitation, and then centrifuged for LC-MS / MS analysis.

[0886] Eight calibration concentration levels were used, excluding blank and zero-concentration samples. Results from blank and zero-concentration samples were not included in the calculation of standard curve parameters. The standard curve range was 2–2000 ng / mL.

[0887] 5. Data Analysis

[0888] Chromatograms of the analyte and internal standard were acquired using an AB Sciex mass spectrometer, and their peak areas were calculated using Analyst 1.7.2 software, employing a 1 / C ratio. 2 A weighted linear regression equation was established to calculate the concentration. Concentration units: ng / mL or ng / g.

[0889] Experimental results

[0890] The test results are shown in Table 3.

[0891] Table 3 Drug concentrations of the compounds and control substances of the present invention in tissues.

[0892]

[0893] Conclusion: Compared with the control, the representative compound of this invention has a higher liver / plasma distribution ratio and a lower brain / cerebrospinal fluid exposure, further reducing the risk of neurotoxicity.

Claims

1. A compound or a pharmaceutically acceptable salt thereof, having a structural formula selected from the following: 。 2. A pharmaceutical composition comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof as an active ingredient and a pharmaceutically acceptable carrier.

3. A hepatitis B virus DNA production inhibitor comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof.

4. An HBsAg inhibitor comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof.

5. Use of the compound of claim 1 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for the treatment or prevention of HBV infection.

6. Use of the compound of claim 1 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 2 in the preparation of a medicament for the treatment and prevention of HBV infection.

7. Use of the compound of claim 1 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 2 in the preparation of a medicament for inhibiting the production or secretion of HBsAg.

Images