A biosensing system, its preparation method and application
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU UNIV OF SCI & TECH
- Filing Date
- 2023-07-25
- Publication Date
- 2026-06-26
Smart Images
Figure CN117147501B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a biosensing system, its preparation method, and its application, belonging to the field of FORSPR detection technology. Background Technology
[0002] Based on deep sequencing and quantitative PCR, Fang et al. found that higher serum miR-103 levels are associated with a higher metastatic potential in hepatocellular carcinoma (HCC). miR-103 secreted by HCC cells can be delivered to endothelial cells via exosomes, directly inhibiting the expression of genes related to endothelial junction integrity. It can also promote tumor cell migration by inhibiting p120 expression in HCC cells. In vivo mouse experiments showed that individuals stably expressing miR-103 exhibited higher vascular permeability, higher exosomal miR-103 levels, more tumor cells in the bloodstream, and higher rates of liver and lung metastasis. Furthermore, Xia et al., in their HCC study, found that overexpression of kinase-anchoring protein 12 (AKAP12) inhibited HCC proliferation and promoted apoptosis in vitro and in xenograft HCC transplantation; they identified miR-103 as a potential inhibitor of AKAP12 by directly targeting the 3'UTR of AKAP12. AKAP12 and PKC inhibit telomerase activity in HCC, suggesting that the tumor-suppressive function of AKAP12 in HCC may be mediated by PKC inhibition of telomerase activity.
[0003] miR-103 is closely related to the development and progression of HCC, making close monitoring of its levels in the human body of great significance. Currently, classic methods for miRNA detection include Northern blotting, quantitative real-time PCR (qPCR), and microarray technology. These classic miRNA detection methods offer highly sensitive detection, driving research in areas such as diagnostic biomarkers, targeted therapy, and drug screening. However, these methods suffer from drawbacks such as high cost, cumbersome operation, the need for labeled molecules, and the requirement for specialized technical personnel. Therefore, novel analytical detection technologies are urgently needed to achieve rapid, sensitive, efficient, and specific detection of miRNAs. Fiber optic LSPR sensors, due to their high sensing sensitivity, simple analytical methods, and low cost, hold promise for solving these problems.
[0004] miRNA levels in the human body are extremely low, generally at the fM level. Currently, LSPR detection methods generally improve sensor sensitivity by changing sensor structure, LSPR material type and morphology, but still cannot detect miR-103, which poses a new challenge to LSPR detection methods. Summary of the Invention
[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a biosensing system with high sensitivity and low detection limit for miR-103, as well as its preparation method and application.
[0006] Technical Solution: To solve the above-mentioned technical problems, the present invention provides a biosensing system, the biosensing system comprising a FOLSPR biosensor and a substance containing a G-quadruplex structure; the substance containing the G-quadruplex structure comprises HexSG4, H1, H2 or H3; the HexSG4 is formed by sequentially connecting the terminal bases of H1, H2 and H3, the sequence of H1 is shown in SEQ ID NO.3, the sequence of H2 is shown in SEQ ID NO.4, and the sequence of H3 is shown in SEQ ID NO.5.
[0007] The FOLSPR biosensor includes AuNPs (gold nanoparticles) polymers and sulfhydryl-modified miR-103 probes, wherein the miR-103 probes are immobilized on the AuNPs polymers via gold-sulfur bonds.
[0008] The sequence of the miR-103 probe is shown in SEQ ID NO.1.
[0009] The AuNPs polymers have a particle size of 20 nm.
[0010] The fabrication of the FOLSPR biosensor includes the following steps:
[0011] (1) Preparation of AuNPs polymers;
[0012] (2) Clean the fiber end face and perform hydroxylation modification;
[0013] (3) The fiber modified in step (2) is further modified with APTES;
[0014] (4) The modified optical fiber in step (3) is modified with gold ammonia bonds to modify AuNPs;
[0015] (5) The modified optical fiber in step (4) is treated with PETMP to modify AuNPs on the optical fiber with thiol groups;
[0016] (6) The optical fiber processed in step (5) continues to be assembled into AuNPs polymers through Au-S bonds;
[0017] (7) The optical fiber processed in step (6) is treated with a thiol-modified miR-103 probe to obtain the FOLSPR sensor.
[0018] The catalytic deposition time in step (2) is 10-60 min.
[0019] In step (4), the modified optical fiber is processed by modifying AuNPs with gold ammonia bonds for 1-7 hours.
[0020] In step (5), the modified optical fiber is processed by PETMP for 1-5 hours.
[0021] The processing time for the processed optical fiber in step (6) to continue assembling AuNPs polymers through Au-S bonds is 1-10 hours.
[0022] The present invention also provides the application of the biosensing system in miR-103 detection.
[0023] The present invention also provides a method for detecting miR-103, comprising the following steps;
[0024] (1) Perform spectral scanning on the FOLSPR sensor in the biosensing system and record the peak position of the LSPR spectrum of the sensor.
[0025] (2) Immerse the FOLSPR sensor in the biosensing system into the test solution, add a substance containing a G-quadruplex structure, incubate, and capture miR-103 molecules in the test solution; immerse the optical fiber in a 4-chloro-1-naphthol (4-CN) solution for catalytic deposition, perform a spectral scan on the FOLSPR sensor again, and calculate the shift value of the LSPR peak position in the two scans.
[0026] (3) The concentration of miR-103 in the test solution was calculated by using the linear relationship between the LSPR peak shift value and the logarithm of the miR-103 concentration.
[0027] The linear relationship between the logarithm of the miR-103 concentration and the LSPR peak shift is: y = 1.5488x - 1.1037, where R... 2 = 0.9973, where x represents the logarithm of the miR-103 concentration, y represents the LSPR peak shift value, and the range of x is 10. 2 -10 7 fM.
[0028] The concentration of the 4-CN solution in step (2) is 0.025-0.1 g / L.
[0029] The G-quadruplex (G4) catalytic reaction process is widely used in signal amplification. Combining this with the significant enhancement of the electromagnetic field near hotspots by AuNP polymers allows for secondary amplification of the sensor signal. Furthermore, compared to monomers, AuNP polymers offer more modifiable sites, which is beneficial for capturing target molecules. Therefore, the method of coupling AuNP polymers with G4 can significantly enhance LSPR signal intensity, redshift, and sensor sensitivity.
[0030] This invention provides a FOLSPR biosensor based on G4-coupled AuNPs polymers. The sensor uses a multimode bare fiber endface as the sensing platform, AuNPs polymers as the sensing material, miR-103 probes and HexSG4 as specific trapping elements, and transmits the reflectance spectrum through a Y-type optical fiber. The working mechanism of the sensor is described in [reference needed]. Figure 1 The fiber optic sensor was constructed by assembling AuNPs onto the fiber end face in two steps to form AuNP polymers. Then, a sulfhydryl-modified miR-103 probe was fixed to the AuNP polymers via gold-sulfur bonds (Au-S) to complete the process. The processing times for the first and second steps of AuNPs, as well as the miR-103 probe concentration, capture time, 4-CN concentration, and catalytic deposition time, were optimized. miR-103 binds to the complementary sequences of the probe and HexSG4, but this process is insufficient to shift the LSPR peak of the fiber optic sensor. However, after G4 catalysis to form benzo-4-chlorohexadienone (4-CD) precipitation from 4-CN, a significant redshift of the LSPR peak occurs. The redshift is correlated with the concentration of miR-103, thus achieving the goal of quantitative detection of miR-103.
[0031] Installation and connection of fiber optic sensing system, such as Figure 2 As shown, high-throughput multimode bare fiber is used to construct the FOLSPR sensor, and Y-type fiber is used for signal transmission between the light source, sensor, and spectrometer. A halogen tungsten lamp (HL-2000, OceanOptics, USA) provides light in the 400-1000nm range. A CCD spectrometer (i-trometer, BW Tek., Newark, DE, USA) is used to receive the reflected light from the FOLSPR sensor, and it has the capability to receive light from 99% of the spectra. TM The interface for the reflectance spectrum of the Labsphere Inc. (North Sutton, USA) standard. If the fiber optic sensor is damaged, it can be reused by cutting off the damaged portion and polishing the end face.
[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. Compared with the prior art, the detection method of the present invention is fast and convenient, and can be carried out on-site; 2. It has low requirements for the operating skills of the detection personnel; 3. It can detect a large number of samples in a short time; 4. The fiber optic LSPR sensor prepared by the present invention has high sensitivity for miR-103 detection, with a minimum detection limit of 6.4 fM / L, and has high specificity for detecting miR-103 in serum, with accurate and reliable detection results. Attached Figure Description
[0033] Figure 1 Schematic diagram of the FOLSPR biosensor for detecting miR-103;
[0034] Figure 2 Construction of AuNPs polymers and the "hotspot effect";
[0035] Figure 3 Characterization of AuNPs: A is the appearance of the AuNPs solution; B is the TEM image of AuNPs; C is the UV-Vis absorption spectrum of AuNPs;
[0036] Figure 4 For FOLSPR sensing system;
[0037] Figure 5 Activity tests for HexSG4 and its constituent molecules: A shows the catalytic effect of HexSG4 in solution; B shows the catalytic effect of HexSG4 on 4-CN at the sensor end face.
[0038] Figure 6 Characterization of the fiber optic LSPR sensor: A shows the deposition of 4-CD AuNPs polymers on the fiber end face under SEM; B shows the change in the LSPR spectrum of the sensor before and after catalysis.
[0039] Figure 7 Optimization of conditions for multimer construction: A is the optimization of the first AuNPs treatment time; B is the optimization of the PETMP treatment time; C is the optimization of the second AuNPs treatment time.
[0040] Figure 8 For sensor fabrication and condition optimization: A) Optimization of miR-103 probe concentration; B) Optimization of incubation time; C) Optimization of 4-CN concentration; D) Optimization of catalytic precipitation time.
[0041] Figure 9The miR-103 fiber optic LSPR sensor detects miR-103: A shows the sensor's response to different concentrations of miR-103; B shows the nonlinear relationship between LSPR redshift and miR-103 concentration; C shows the linear relationship between LSPR redshift and miR-103 logarithmic concentration.
[0042] Figure 10 The sensor's response to different microRNA molecules;
[0043] Figure 11 The result is the amplification of the miR-103 signal by HexSG4. Detailed Implementation
[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0045] Example 1: Preparation and Characterization of AuNPs
[0046] The entire reaction process for synthesizing AuNPs was carried out with continuous stirring and reflux. 100 mL of chloroauric acid (0.01% wt) was added to a 250 mL three-necked flask and heated to boiling. Then, 3 mL of 1% sodium citrate solution was rapidly added dropwise to the reaction mixture. Heating and reflux were continued, and the reaction was continued for 15 min. Heating was then stopped, and the solution was allowed to cool to room temperature. The prepared AuNPs solution was collected, sealed, and stored at 4 °C. Figure 3 As shown in Figure A, the synthesized AuNPs are wine-red in appearance. The UV-Vis absorption spectrum of the AuNPs solution was measured using a fiber optic sensing system, and the absorption peak was located near 520 nm. Figure 3 C). Microscopic characterization using transmission electron microscopy (TEM) Figure 3 B) It can be found that the AuNPs synthesized in this invention are mainly distributed around 21 nm.
[0047] Example 2: Fabrication of the FOLSPR sensor
[0048] The bare optical fiber with a smooth end face was cleaned with ultrapure water and dried with nitrogen. Then, the end face of the bare optical fiber was immersed in a piranha solution (98% sulfuric acid and 30% hydrogen peroxide in a volume ratio of 7:3) for 2-3 cm and treated at 80°C for 40 min. After that, it was rinsed with ultrapure water, and the end face of the bare optical fiber was immersed in ultrapure water again and ultrasonically cleaned for 5 min. After that, it was removed and dried with nitrogen to obtain a hydroxylated optical fiber sensor.
[0049] Subsequent fiber processing and testing were performed at 25°C. The hydroxylated fiber end face was immersed in a 1.0% solution of (3-aminopropyl)triethoxysilane (APTES) (volume ratio: APTES:ethanol:water = 1:1:98) for approximately 1-2 cm and treated for 12 h. APTES was hydrolyzed and condensed to attach to the fiber end face, forming abundant amino groups. The fiber end face was then repeatedly rinsed with ethanol and ultrapure water, and dried with nitrogen to obtain an amination fiber sensor.
[0050] The ammoniated fiber sensor was immersed in an AuNPs solution for about 0.5 cm and treated for 5 h. The AuNPs were modified onto the fiber end face through gold-ammonia bonds. The fiber was rinsed with ultrapure water to remove non-covalently bonded AuNPs. The fiber was then dried with nitrogen gas to obtain an optical fiber with sparsely distributed AuNPs monomers.
[0051] Then, the optical fiber was immersed in 4 mg / mL pentaerythritol tetra(3-mercaptopropionate) (PETMP) (ethanol as solvent) for 3 hours, followed by rinsing with ethanol and ultrapure water, and drying with nitrogen. PETMP contains four thiol groups, some of which are firmly anchored to AuNPs via Au-S bonds, resulting in a rich thiol layer on the AuNP surface, which can bind to additional AuNPs. The optical fiber was then immersed in the AuNP solution again for 5 minutes, rinsed with ultrapure water, and dried with nitrogen. The AuNPs on the fiber end face and the AuNPs in the solution form AuNP-(PETMP-AuNPs) through Au-S bond interactions. n The structure allows for the assembly of AuNPs polymers at the fiber end face. Figure 2 ).
[0052] An optical fiber assembled with AuNP polymers was immersed in a 10 nM solution of thiol-modified miR-103 probes for 12 h. The fiber was then repeatedly rinsed with probe buffer to remove non-covalently bound miR-103 probes. The miR-103 probes were attached to the AuNPs surface via thiol groups, ultimately forming an optical fiber-AuNP polymer-miR-103 probe structure, thus completing the AuNP polymer-based FOLSPR biosensor. Figure 4The preparation of the sensor was crucial. Maintaining the cleanliness and preventing wear of the fiber end face during sensor fabrication is key to success. Specifically, the miR-103 probe sequence is shown in SEQ ID NO.1: 5'-GGATGAGTGTACAATGCTGCTAAAAA-(SH)-3', prepared by Shanghai Bioengineering Co., Ltd.; the miR-103 sequence is shown in SEQ ID NO.2: AGCAGAUUGUACAGGGCUAUGA.
[0053] Example 3: Activity test of HexSG4 and its constituent molecules
[0054] To verify the catalytic activity of the constructed HexSG4, the catalytic effects of HexSG4, HexS, H1, H2, and H3 were tested in solution. The sequence of H1 is shown in SEQ ID NO.3.
[0055] 5'-TCATAGCCCTACTCATCCGTCTTGGTAGTGTTCAGAGAGAGGTTGGGCGGGATGGGTTTCTCTCTGAGCTTCTTGTCGGGTTGGGCGGGA-3';
[0056] The sequence of H2 is shown in SEQ ID NO.4:
[0057] 5'-TGGGTTGACAAGAAGCCTGGTTCGAGGGTTGGGCGGGATGGGTTTCGAACCAGGTGCAGCGATGGGTTGGGCGGGA-3';
[0058] The sequence of H3 is shown in SEQ ID NO.5:
[0059] 5'-TGGGTTATCGCTGCACCTTGAACGCGGGTTGGGCGGGATGGGTTGCGTTCAAGACACTACCAAGAC-3'.
[0060] Since H1, H2, and H3 can only form one G-quadruplex (G4), the constructed HexSG4 additionally utilizes the terminal bases of H1, H2, and H3, thus forming a total of five G4s. HexS lacks heme and potassium. + Since G4 cannot be formed, they have no catalytic activity. Therefore, HexSG4 exhibits high catalytic activity, H1, H2, and H3 have lower catalytic activity, while HexS has almost no catalytic activity. Figure 5 A). This invention also investigated the catalytic effect of HexSG4 on the end face of an optical fiber sensor, and the test results are as follows: Figure 5As shown in B, since the two sequences recognizing miR-103 are located in the miR-103 probe and the H1 sequence, respectively, while H2 and H3 contain no recognizing sequences, HexSG4 and H1 can recognize miR-103 and assemble it onto the sensor end face, catalyzing the formation of 4-CD from 4-CN, resulting in a redshift. Furthermore, H1 can only form one G4, while HexSG4 contains five G4s, resulting in a better catalytic effect and a greater redshift.
[0061] AuNPs polymers were successfully constructed on the fiber end face. Figure 6 A) Compared to AuNPs, AuNP polymers can significantly enhance the LSPR signal intensity through the "hot spot" effect via nano-interstic gaps formed within their structure. HexSG4 can catalyze the formation of 4-CD from 4-CN, and TEM results show that the produced 4-CD is deposited on the surface of the AuNP polymers. The results indicate that the LSPR signal is enhanced after the deposition of 4-CD in the AuNP polymers. Figure 6 (B, red line). HexS lacks Hemin and K+, therefore it cannot form G4 and is inactive. Figure 6 (B is the black line).
[0062] Example 4: Optimization of Sensor Fabrication Conditions
[0063] Firstly, this embodiment optimizes the time for the first step of connecting AuNPs, using AuNPs to treat the optical fiber for 0h, 1h, 2h, 3h, 4h, 5h, 6h, and 7h. Specifically, the treatment time for 4mg / mL PETMP is 3h, the second AuNPs treatment time is 5min, and the miR-103 probe concentration is 10nm / L. Figure 7 Results A show the change in absorbance of the surface polymers of the optical fiber at 520 nm with processing time. The results indicate that when the second AuNPs treatment time is fixed at 5 min and the PETMP treatment time is 3 h, the absorbance of the sensor at 520 nm continuously increases within 1-5 h; it decreases slightly after 7 hours. Within 1-5 hours, the formation of AuNPs polymers increases with the increase in the number of AuNPs monomers in the first step, and the absorbance is also significantly enhanced. After 5 hours, the density of AuNPs monomers on the fiber end face is high, the number of AuNPs bound in the second step decreases, and the formed nano-gap structure also decreases. Simultaneously, there is an increase in AuNP aggregation, which weakens the absorbance of AuNPs near 520 nm, while increasing the absorbance near 600 nm. Therefore, the optimal first AuNPs treatment time is 5 h.
[0064] Secondly, the treatment time for 4 mg / mL PETMP was optimized for 1 h, 2 h, 3 h, 4 h, and 5 h. Figure 7(B) The first AuNPs treatment time was 5 hours; the second AuNPs treatment time was 5 minutes, and the miR-103 probe concentration was 10 nm / L. A suitable PETMP density will stably bind AuNPs without causing aggregation. Too low a concentration results in a less stable polymer structure that is easily destroyed, while too high a concentration increases the number of thiol groups on the surface of the AuNPs connected to the fiber end face in the first step, making aggregation more likely in the second step. Finally, it was found that a stable fiber optic sensor with a strong LSPR signal can be obtained with a treatment time of 3 hours.
[0065] The processing time for the second AuNPs treatment (1 min, 2 min, 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min) was then optimized. Figure 7 (C) The first AuNPs treatment time was 5 hours; the 4 mg / mL PETMP treatment time was 3 hours; and the miR-103 probe concentration was 10 nm / L. Within 1-5 minutes, AuNPs in the solution continuously combined with AuNPs on the fiber endface to form AuNP polymers, resulting in a continuous increase in the absorbance of the LSPR at 520 nm. After 5 minutes, the AuNPs in the solution continued to combine with the AuNP polymers on the fiber endface, causing aggregation and a decrease in the sensor's LSPR signal, which was detrimental to subsequent LSPR signal acquisition. Therefore, the second AuNPs treatment time was optimized to 5 minutes.
[0066] The coverage of miR-103 probes on the surface of AuNPs polymers is crucial to the sensor's detection limit, sensitivity, and response time. At low probe concentrations, the amount of miR-103 captured within a given incubation time is limited, and catalytic precipitation does not produce a significant redshift. At excessively high probe concentrations, steric hindrance occurs between the probes, miR-103, and HexSG4, hindering their binding. This reduces the number of HexSG4 connected to the fiber endface, resulting in a decrease in the amount of 4-CD catalytically deposited on the fiber endface, and a weakened LSPR redshift. Figure 8 Results A indicate that when the concentration of the miR-103 probe for AuNPs polymers is 10 nm / L, the LSPR shift of the sensor for a 10 ng / mL miR-103 solution reaches its maximum value. Figure 8 A). The first AuNPs treatment lasted 5 hours; the 4 mg / mL PETMP treatment lasted 3 hours; and the second AuNPs treatment lasted 5 minutes.
[0067] Example 5: Optimization of Sensor Response Time
[0068] The incubation time required for the sensor was optimized using processing times of 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min. The concentration of 4-CN was 0.1 g / L, and the catalytic time of 4-CN was 40 min. From 0 to 40 minutes, the optical fiber continuously captured miR-103 molecules through the miR-103 probe, and the LSPR shift value continuously increased. After 40 minutes, the miR-103 probe of the sensor reached saturation and could no longer capture miR-103 in the solution; therefore, the incubation time of the sensor was set to 40 min. Figure 8 B).
[0069] Example 64: Optimization of 4-chloro-1-naphthol (4-CN) concentration
[0070] The sensor was optimized using 0.025, 0.05, 0.1, 0.15, 0.2, 0.3, and 0.4 g / L of 4-CN, respectively. The incubation time for both the sensor and the 4-CN catalysis time was 40 min. Figure 8 The results showed that among 4-CN concentrations of 0.025, 0.05, and 0.1 g / L, the LSPRshift of 4-CD precipitate formed after 4-CN oxidation increased with increasing concentration. However, when the 4-CN concentration exceeded 0.1 g / L, white flocculent matter, i.e., undissolved 4-CN, appeared in the solution. With further increases in 4-CN concentration, the amount of flocculent matter increased, interfering with 4-CD formation and leading to a decrease in LSPRshift. Therefore, the optimal 4-CN concentration was 0.1 g / L. Figure 8 C). Among them, 4-CN was purchased from Shanghai E.N. Chemical Technology Co., Ltd.
[0071] Example 7: Optimization of Catalytic Precipitation Time
[0072] Insufficient catalytic precipitation time results in a smaller amount of 4-CN formed, leading to a weaker LSPR redshift and affecting sensor sensitivity. Therefore, the catalytic precipitation time of 4-CN was optimized at 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min. The incubation time for the sensor was 40 min, and the concentration of 4-CN was 0.1 g / L. Figure 8 The results showed that the sensor continuously catalyzed the formation of 4-CD before 40 min, leading to a continuous increase in the LSPR redshift. After 40 min, no more 4-CD could be deposited on the surface of the AuNPs polymers, and the redshift tended to plateau. Therefore, the optimized 4-CN catalytic time was 40 min. Figure 8 D).
[0073] Example 8: Detection of miR-103 by the FOLSPR sensor
[0074] The optimized LSPR sensing system was used to detect different concentrations (10) 2 10 3 10 4 10 5 10 6 With 10 7 miR-103 (fM). When the miR-103 probe is captured by the HexSG4 probe, it catalyzes the formation of 4-CD from 4-CN, which is deposited on the surface of AuNPs polymers. This leads to an increase in refractive index in the localized environment of the AuNPs polymers, resulting in a redshift of the LSPR peak. Furthermore, the hotspot effect of the polymers and the G4-catalyzed formation of 4-CD precipitate from 4-CN further enhance the redshift. Figure 9 A shows the normalized LSPR spectrum as the miR-103 concentration increases. The relationship between the degree of redshift and the miR-103 concentration is as follows: Figure 9 As shown in Figure B, the redshift increases with increasing miR-103 concentration, then plateaus at higher concentrations. The LSPR redshift exhibits a positively correlated non-linear relationship with miR-103 concentration, and a linear correlation with the logarithm of miR-103 concentration. Figure 9 C). Concentration logarithm in 10 2 -10 7 The relationship is linear within the range of fM: y = 1.5488x - 1.1037(R) 2 =0.9973, LOD=6.4fM).
[0075] Example 9: Sensor Selectivity and Repeatability Analysis
[0076] Human blood often contains multiple miRNAs. To examine the selectivity of the constructed LSPR biosensor, a fiber optic LSPR sensor was used under the same conditions to detect miR-21, miR-155, and miR-140 at concentrations of 10 ng / mL, and the LSPR shift of different miRNAs was analyzed. Figure 10The sequence of miR-21 is shown in SEQ ID NO.6: UAGCUUAUCAGACUGAUGUUGA; the sequence of miR-155 is shown in SEQ ID NO.7: UUAAUGCUAAUCGUGAUAGGGGUU; and the sequence of miR-140 is shown in SEQ ID NO.8: UACCACAGGGUAGAACCACGG. The results show that only miR-103 exhibited a significant redshift of 8 nm. Specifically, miR-21, miR-155, and miR-140 showed redshifts of 0.1, 0.2, and 0.2 nm, respectively. This indicates that the sensor's capture of miR-103 and signal generation are unaffected by interfering molecules, relying on the specific binding of miR-103 to the probe.
[0077] To verify the repeatability of the experiment, ten repeated tests were performed on the 1 nM miR-103 standard solution under the same test conditions. The RSD of the detection results was 4.41%, indicating that the LSPR sensor has good repeatability.
[0078] Human serum was used as the sample for reagent detection and spiked recovery tests. Three spiking concentrations of 1, 0.1, and 0.01 nM were set for analysis, with three replicates for each concentration. The recoveries were 89.0%, 104.6%, and 108.3%, respectively. This indicates that the sensor can be used for the detection of miR-103 in serum.
[0079] Example 10: HexSG4 amplification results of miR-103 signal from LSPR sensor
[0080] The sensor's response to 10, 100, and 1000 pM / L miR-103 was tested without HexSG4 catalysis, and the results were compared with those obtained with a fully constructed sensor. Figure 11 The results showed that complementary pairing between miR-103 and the probe molecule alone could not produce a significant redshift in the LSPR spectrum. However, under the catalytic precipitation of HexSG4, AuNPs polymers could achieve a highly sensitive response to the formed 4-CD precipitate, thereby determining the concentration of miR-103 in the sample.
Claims
1. A biosensing system, characterized in that, The biosensing system includes a FORSPR biosensor and a substance containing a G-quadruplex structure; the substance containing a G-quadruplex structure includes HexSG4, H1, H2 or H3; HexSG4 is formed by sequentially connecting the terminal bases of H1, H2 and H3, the sequence of H1 is shown in SEQ ID NO.3, the sequence of H2 is shown in SEQ ID NO.4, and the sequence of H3 is shown in SEQ ID NO.
5.
2. The biosensing system according to claim 1, characterized in that, The FORSPR biosensor includes an AuNPs polymer and a sulfhydryl-modified miR-103 probe, wherein the miR-103 probe is immobilized on the AuNPs polymer via gold-sulfur bonds.
3. The biosensing system according to claim 2, characterized in that, The sequence of the miR-103 probe is shown in SEQ ID NO.
1.
4. The biosensing system according to claim 2, characterized in that, The AuNPs polymers have a particle size of 20 nm.
5. The biosensing system according to claim 2, characterized in that, The method for preparing the FOLSPR biosensor includes the following steps: treating AuNPs polymer optical fiber with a thiol-modified miR-103 probe to obtain the FOLSPR biosensor.
6. The application of the biosensing system according to any one of claims 1-5 in miR-103 detection.
7. A method for detecting miR-103, characterized in that, Includes the following steps; (1) Perform spectral scanning on the FOLSPR sensor in the biosensing system of claim 1 and record the peak position of the LSPR spectrum of the sensor. (2) Immerse the FOLSPR sensor in the biosensing system of claim 1 into the test solution, add a substance containing a G-quadruplex structure, incubate, and capture miR-103 molecules in the test solution; immerse the optical fiber in a 4-chloro-1-naphthol solution for catalytic deposition, perform a spectral scan on the FOLSPR sensor again, and calculate the shift value of the LSPR peak position in the two scans. (3) The concentration of miR-103 in the test solution was calculated by using the linear relationship between the LSPR peak shift value and the logarithm of the miR-103 concentration.
8. The detection method according to claim 7, characterized in that, The linear relationship between the logarithm of the miR-103 concentration and the LSPR peak shift is: y = 1.5488x - 1.1037, where R 2 =0.9973, where x represents the logarithm of the miR-103 concentration, y represents the LSPR peak shift, and x ranges from 10. 2 -10 7 fM.
9. The detection method according to claim 7, characterized in that, The concentration of the 4-chloro-1-naphthol solution in step (2) is 0.025-0.1 g / L.
10. The detection method according to claim 7, characterized in that, The catalytic deposition time in step (2) is 10-60 min.