Composition for preventing or treating chronic kidney disease comprising a compound inducing expression of anti-aging gene klotho

Abstract

The present invention relates to a composition for preventing or treating chronic kidney disease (CKD) comprising a compound inducing the expression of an anti-aging gene, klotho. The compound represented by Chemical Formula 1 of the present invention is excellent in the effect of increasing the expression amount of the Klotho gene, which is a gene related to aging, and can be effectively used as a pharmaceutical composition for preventing, improving, or treating chronic kidney disease.

Description

Technical Field

[0001] This application claims priority to Korean patent applications filed on April 1, 2021, No. 10-2021-0042955 and March 31, 2022, No. 10-2022-0040453, the entire contents of which are incorporated herein by reference.

[0002] This invention relates to compositions for the prevention or treatment of chronic kidney disease (CKD) comprising compounds that induce the expression of the anti-aging gene klotho. Background Technology

[0003] Chronic kidney disease (CHD) refers to a condition characterized by kidney damage or decreased kidney function lasting for more than three months and is recognized worldwide as a serious disease. CHD is increasing with population aging and the rise of chronic diseases, becoming a significant public health issue in many countries, contributing to high prevalence and incidence, complications such as stroke, heart disease, diabetes and infections, and increased healthcare costs.

[0004] In 1981, the existence of genes that could regulate aging in rapidly aging mice (SAM) was identified. These mice, incidentally produced during the mating of AKR / J series rats, aged more rapidly than their counterparts and were found to have multiple gene variants. Subsequently, a group of aging-related genes were reported in the 1990s. These genes belong to the RecQ family and express genes called DNA helicases. Mutations in these genes have been reported to lead to premature aging or cancer, known to affect DNA repair. A single aging-related gene was the klotho gene, reported in 1997. The klotho gene was discovered incidentally during the creation of a transgenic rat model of hypertension. Rats that could not express this gene exhibited premature aging and shortened lifespan. More interestingly, subsequent increases in gene expression in male rats resulted in a 20.0%–30.8% increase in lifespan, and in females, an 18.8%–19.0% increase. This is the first time the world has been informed that the lifespan of rats can be extended or shortened based on the expression of a single gene. Furthermore, the base sequence of the Klotho gene is highly similar across animals; reportedly, rats and humans share 98% of it. This indicates that lifespan in humans can also be regulated based on the expression of the klotho gene.

[0005] In humans, the klotho gene, located on chromosome 13, produces a membrane protein with a base sequence similar to β-glucosidase. Klotho protein is reportedly expressed primarily in renal tubular epithelial cells and the choroid plexus of the brain, and in some parathyroid glands. The klotho gene is associated with various aging phenotypes. In rats lacking the klotho gene, aging-related syndromes such as shortened lifespan, reduced activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema are observed. In Klotho mutant rats, arteriosclerosis similar to Monckeberg-type arteriosclerosis caused by human aging was observed in all arteries from the aorta to the arterioles, with impaired angiogenesis and vasculogenesis.

[0006] Klotho mRNA expression was significantly higher in kidney tissue than in other tissues, but decreased in the kidneys of rats with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure models. In rats with decreased Klotho expression, the production of nitric oxide (NO), a vascular endothelial-derived relaxant, was reduced. Injection of the klotho gene into Otsuka Long-Evans Tokushima fatty rats (OLETF) with multiple cardiovascular disease risk factors using a viral gene delivery vector improved endothelial dysfunction, increased NO production, inhibited vascular thickening and fibrosis, and thus lowered blood pressure. Furthermore, the klotho gene affects glucose and insulin metabolism in rats, and statins, representative treatments for hypercholesterolemia, increase klotho mRNA expression in proximal renal tubular cells. In rats with reduced Klotho expression, bone loss due to impaired osteoblast and osteoclast differentiation and low bone turnover is observed, similar to age-related bone loss and senile osteoporosis in humans. Furthermore, in Klotho mutant rats, abnormal elongation of trabecular bone in the epiphyseal region and abnormal trabecular bone tissue in microcomputed tomography (MCT) imaging are observed, indicating impaired bone resorption. The clinical phenotypic changes caused by Klotho gene mutations in humans are diverse. Functional variants of Klotho (KL-VS) with mutations at three sites on the Klotho gene exon2 are associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease. Microsatellite and single nucleotide polymorphisms (SNPs) of the Klotho gene are associated with bone mineral density. In healthy adult women, single nucleotide polymorphisms of the Klotho gene have also been reported to be associated with cardiovascular disease risk factors and bone mineral density. Recently, several papers have reported the association between the Klotho gene and Alzheimer's disease. Reports indicate that in mouse models of Alzheimer's disease and dementia, overexpression of Klotho extended lifespan by 30% and inhibited cognitive decline. Simultaneously, Klotho expression reduced the production of β-amyloid protein in the brain by 50%. Furthermore, reports have been submitted showing that in humans, Klotho expression is inversely proportional to the progression of Alzheimer's disease, and that Klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's patients.

[0007] Efforts have been ongoing to develop substances that can induce the expression of the klotho gene, which has a significant anti-aging effect. Among known substances, those reported to induce klotho expression include rapamycin, vitamin D, and statins. In 2012, a research team at Boston University screened a library of up to 150,000 compounds for compounds that could induce klotho gene expression and reported three compounds.

[0008] Among the aforementioned compounds, the inventors selected a compound with a structure highly promising for drug development, designated compound H. Through experimental verification, they confirmed that this compound could express the klotho gene in cells, and published the results of their research on its mechanism of action. Subsequently, they conducted experiments analyzing the structure of compound H (Comparative Example 1) to determine the structural characteristics of compounds capable of inducing klotho expression, and based on this, prepared a novel compound with an activity increased more than 10-fold. Simultaneously, the inventors experimentally confirmed that the aforementioned novel compound, which induces the expression of the anti-aging gene klotho, is effective in the prevention or treatment of chronic kidney disease, thus completing this invention. Summary of the Invention

[0009] Technical issues

[0010] The object of the present invention is to provide a pharmaceutical composition comprising a compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof for the prevention or treatment of chronic kidney disease.

[0011] Technical solution

[0012] To achieve the above objectives, the present invention provides a pharmaceutical composition for the prevention or treatment of chronic kidney disease comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0013] Chemical Formula 1:

[0014]

[0015] (In the above chemical formula 1, L) 1 For single key or ;

[0016] R 1 and R 2 They are -H, -OH, and C, respectively. 1-10 Straight-chain or side-chain alkyl groups, or C 6-8 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-10 One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0017] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-8 aryl;

[0018] R 3 R 4 R 5 R 6 and R 7 These are -H, halogen, -NO2, or C, respectively. 1-10 (linear or side-chain alkyl groups).

[0019] Furthermore, the present invention provides a method for the prevention or treatment of chronic kidney disease, comprising the steps of administering or ingesting to an individual a composition comprising the compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0020] Furthermore, the present invention provides the use of compositions comprising the above-described compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient for the prevention or treatment of chronic kidney disease.

[0021] The effects of the invention

[0022] The compound of the present invention, represented by chemical formula 1, is highly effective in increasing the expression level of the Klotho gene, which is a gene related to aging, and can be effectively used as a pharmaceutical composition for the prevention, improvement or treatment of chronic kidney disease. Attached Figure Description

[0023] Figure 1 Part (a) shows the results of luciferase expression experiments of the reporter gene using a promoter including the start of the human klotho gene up to 1.7 kbp in Comparative Examples 1 to 4.

[0024] Figure 1 Part (b) shows the results of luciferase expression experiments of the reporter gene using the promoter of the human klotho gene from the start of the gene up to 240 bp in Comparative Examples 1 to 4.

[0025] Figure 2 The results of luciferase expression experiments using reporter genes with a promoter up to -2.1 kb upstream of the human klotho gene are shown in Examples 1 to 6.

[0026] Figure 3 The results of luciferase expression experiments using a reporter gene with a promoter up to -2.1 kb upstream of the human klotho gene are shown in Examples 1 to 3.

[0027] Figure 4The results were obtained by RT-PCR to confirm the mRNA expression levels of the klotho (KL) gene in Examples 1 and 2.

[0028] Figure 5 To confirm the results of the expression of the klotho gene in RPTEC cells treated with the compounds of Examples 1 to 2 and Examples 7 to 10.

[0029] Figure 6 To confirm the cytotoxicity results in HK2 cells treated with the compounds of Examples 1, 9 and 10.

[0030] Figure 7a This paper briefly illustrates the experimental protocol for preparing a disease model by treating HK-2 cells (human kidney cells) with cisplatin.

[0031] Figure 7b For analysis based on Figure 7a The results of the experimental protocol were obtained regarding the expression level of Klotho protein in HK-2 cells.

[0032] Figure 8a A brief description of the experimental protocol for obtaining experimental samples by injecting KS1 compound into an animal model of unilateral ureteral obstruction is presented.

[0033] Figure 8b To utilize according to Figure 8a The experimental samples obtained from the experimental protocol were analyzed to determine the degree of renal hypertrophy.

[0034] Figure 9 The results were obtained by confirming the nuclear and cytoplasmic changes in a unilateral ureteral obstruction model using hematoxylin and eosin (H&E) staining.

[0035] Figure 10 Results of confirming the degree of fibrosis in a unilateral ureteral obstruction model using Sirius Red staining.

[0036] Figure 11 shows the results of TUNEL staining to confirm the degree of apoptosis in a unilateral ureteral obstruction model.

[0037] Figure 12 To analyze the changes in Klotho protein expression in a unilateral ureteral obstruction model.

[0038] Figure 13 To analyze the changes in MMP-9 protein expression in a unilateral ureteral obstruction model.

[0039] Figure 14 and Figure 15 To analyze the changes in Klotho protein expression in a chronic kidney disease model.

[0040] Figure 16 To analyze the changes in microalbumin levels in a chronic kidney disease model.

[0041] Figure 17 To analyze the numerical changes in blood urea nitrogen (BUN) in a chronic kidney disease model. Detailed Implementation

[0042] The present invention will now be described in detail.

[0043] This invention relates to compositions for the prevention or treatment / improvement of chronic kidney disease comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0044] Chronic kidney disease is defined as a structural or functional abnormality of the kidneys (e.g., proteinuria, hematuria, or pathological abnormalities) over a period of 3 months or more, i.e., the presence of “kidney damage” or, unrelated to kidney damage, a glomerular filtration rate reduced to 60 mL / min / 1.73 mL. 2 The following are diseases that last for more than 3 months and are accompanied by multiple complications such as cardiovascular disease, mineral and bone metabolism, and anemia.

[0045] The compound of the present invention, represented by the following chemical formula 1, is highly effective in increasing the expression level of the Klotho gene, which is a gene related to aging, and can be effectively used as a pharmaceutical composition for the prevention, improvement or treatment of chronic kidney disease.

[0046] Pharmaceutical compositions for the prevention or treatment of chronic kidney disease

[0047] The present invention provides a pharmaceutical composition comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof for the prevention or treatment of chronic kidney disease.

[0048] Chemical Formula 1:

[0049]

[0050] In the above chemical formula 1,

[0051] L 1 For single key or ;

[0052] R 1 and R 2 They are -H, -OH, and C, respectively. 1-10 Straight-chain or side-chain alkyl groups, or C 6-8 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-10One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0053] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-8 aryl;

[0054] R 3 R 4 R 5 R 6 and R 7 They can be -H, halogen, -NO2, or C, respectively. 1-10 Straight-chain or side-chain alkyl groups.

[0055] In one embodiment of the present invention,

[0056] The above L 1 For single key or ;

[0057] R 1 and R 2 They are -H, -OH, and C, respectively. 1-5 Straight-chain or side-chain alkyl groups, or C 6-7 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-5 One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0058] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-7 aryl;

[0059] R 3 R 4 R 5 R 6 and R 7 They can be -H, halogen, -NO2, or C, respectively. 1-5 Straight-chain or side-chain alkyl groups.

[0060] In one embodiment of the present invention,

[0061] The above L 1 For single key or ;

[0062] R 1 and R 2 They are -H, -OH, -CH3 or phenylamide, wherein, in the phenyl group of the above phenylamide, one or more of -Cl, -NO2 and -CH2Cl can be substituted;

[0063] The above R 1 and R2 They can form phenyl groups together with the carbon atoms they are attached to;

[0064] R 3 R 4 R 5 R 6 and R 7 They can be -H, -F, -Cl, -NO2, or -CH2CH3, respectively.

[0065] In one embodiment of the present invention,

[0066] The above L 1 For single key or ;

[0067] R 1 -H, -OH, -CH3, , or ;

[0068] R 2 -H;

[0069] The above R 1 and R 2 They can form phenyl groups together with the carbon atoms they are attached to;

[0070] R 3 It is -H or -Cl;

[0071] R 4 -H, -F, or -Cl;

[0072] R 5 It can be -F, -Cl, -NO2, or -CH2CH3;

[0073] R 6 -H;

[0074] R 7 It can be -H.

[0075] As preferred examples of compounds represented by chemical formula 1 in this invention, the following group of compounds can be cited.

[0076] 1) N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide;

[0077] 2) 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole;

[0078] 3) 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol;

[0079] 4) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide;

[0080] 5) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide;

[0081] 6) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide;

[0082] 7) 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole;

[0083] 8) N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine;

[0084] 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and

[0085] 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0086] Furthermore, in one embodiment of the present invention, as a preferred embodiment of the compound represented by chemical formula 1, it may be a compound represented by the following chemical formula 1-1.

[0087] Chemical Formula 1-1

[0088]

[0089] In the above chemical formula 1-1, L 1 It is a single bond; R 1 and R 2 -H or C respectively 1-10 Straight-chain or branched alkyl groups, R 3 R 4 R 5 R 6 and R 7 They are -H or halogen, respectively.

[0090] The compounds of the present invention represented by the above-described Chemical Formula 1 can be used in the form of pharmaceutically acceptable salts. As salts, acid addition salts formed by pharmaceutically acceptable free acids are useful. The expression "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of a basic compound of Chemical Formula 1 at a concentration that is relatively non-toxic and harmless to the patient, and whose side effects do not diminish the beneficial efficacy of the basic compound of Chemical Formula 1. For these salts, inorganic and organic acids can be used as free acids. Inorganic acids include hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc., and organic acids include citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, mesylic acid, glycolic acid, succinic acid, tartaric acid, galacturonic acid, primordial acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, mesylic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid, etc. Furthermore, these salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, magnesium salts, etc.). For example, acid addition salts may include acetates, aspartates, benzoates, benzenesulfonates, bicarbonates / carbonates, bisulfates / sulfates, borates, dextrorotatory camphor sulfonic acid, citric acid, ethanedisulfonates, ethanesulfonates, formates, fumarates, glucohepanoates, gluconates, glucuronides, hexafluorophosphates, perbenzoates, hydrochlorides / chlorides, hydrobromates / bromines, hydroiodates / iodates, hydroxyethyl sulfonates, lactic acid, malates, maleates, and malonic acid. Salts, methanesulfonates, methyl sulfates, naphthalates, 2-naphthalenesulfonates, nicotinates, nitrates, orotates, oxalates, palmitates, pyrates, phosphates / hydrogen phosphates / dihydrogen phosphates, sucrose salts, stearates, succinates, tartrates, toluenesulfonates, trifluoroacetates, aluminum, arginine, benzylamine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, alkanolamine, potassium, sodium, tromethamine, zinc salts, etc., preferably hydrochloride or trifluoroacetate.

[0091] Furthermore, the compounds of the present invention represented by the above-described chemical formula 1 not only contain pharmaceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods.

[0092] The addition salts of the present invention can be prepared by conventional methods. For example, the compounds of Formula 1 can be prepared by dissolving a water-soluble organic solvent in a solution such as acetone, methanol, ethanol, or acetonitrile, adding an excess of organic acid or an aqueous solution containing an inorganic acid, followed by precipitation or crystallization. Then, the solvent or excess acid is evaporated from the mixture, and the mixture is dried to obtain the addition salt, or it can be prepared by filtration of the precipitated salt.

[0093] Preparation method 1

[0094] This invention provides a method for preparing a compound represented by chemical formula 1A, which comprises the following steps as shown in reaction formula 1:

[0095] Step 1: After dissolving compound 2 in an organic solvent, compound 3 is added, and the mixture is reacted at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 4; and

[0096] Step 2: Add an organic solvent containing potassium superoxide to an organic solvent containing compound 4 obtained in step 1 above, and react at a temperature of 15°C to 30°C for 10 to 16 hours to obtain compound 1A.

[0097] Reaction 1:

[0098]

[0099] In the above reaction formula 1,

[0100] R 1 R 2 R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 in this article,

[0101] The above-mentioned compound 1A is included in chemical formula 1 herein.

[0102] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO), or dioxane may be used alone or in combination.

[0103] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it may be 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazole-2-amine, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazole-2-amine or N-(3,4-difluorophenyl)benzo[d]oxazole-2-amine.

[0104] Preparation method 2

[0105] This invention provides a method for preparing a compound represented by chemical formula 1B, as shown in reaction formula 2 below, comprising the following steps:

[0106] Step 1: After dissolving compound 5 in an organic solvent, add compound 3 and react at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 6;

[0107] Step 2: Add dropwise an organic solvent containing potassium superoxide to an organic solvent containing compound 6 obtained in Step 1 above, and react for 12 to 24 hours to obtain compound 7; and

[0108] Step 3: Dissolve compound 7 in an organic solvent, add boron tribromide, and react at room temperature for 20 to 28 hours to obtain compound 1B.

[0109] Reaction 2:

[0110]

[0111] In reaction formula 2 above,

[0112] R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 in this article,

[0113] The aforementioned compound 1B is included in chemical formula 1 herein.

[0114] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0115] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.

[0116] Preparation method 3

[0117] This invention provides a method for preparing a compound represented by chemical formula 1C, as shown in reaction formula 3 below, comprising the following steps:

[0118] Step 1 involves dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent and reacting the mixture at a temperature of 10°C to 50°C for 2 to 8 hours to obtain compound 9; and

[0119] Step 2: After dissolving compound 9 and compound 2 in an organic solvent, react for 2 to 8 hours to obtain compound 1C.

[0120] Reaction 3:

[0121]

[0122] In the above reaction formula 3,

[0123] R 1 R 2 R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 in this article,

[0124] The aforementioned compound 1C is included in chemical formula 1 herein.

[0125] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0126] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide.

[0127] Preparation method 4

[0128] This invention provides a method for preparing a compound represented by compound 1D, as shown in reaction formula 4 below, comprising the following steps:

[0129] Step 1: Compound 10 and Compound 3 are dissolved in an organic solvent and reacted at a temperature of 10°C to 50°C for 20 to 28 hours to obtain Compound 11.

[0130] Step 2: Add an organic solvent containing potassium superoxide to an organic solvent containing compound 11 obtained in step 1 above, and react at a temperature of 10°C to 50°C for 12 to 24 hours to obtain compound 12.

[0131] Step 3: Compound 12 and the catalyst are added to an organic solvent, hydrogen gas is introduced, and the mixture is reacted at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 13; and

[0132] Step 4: After dissolving compounds 13 and 14 in an organic solvent, react them at a temperature of 10°C to 50°C for 12 to 24 hours to obtain compound 1D.

[0133] Reaction 4:

[0134]

[0135] In the above reaction formula 4,

[0136] R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 in this article;

[0137] R 8 Halogen, -NO2 and C 1-10 One or more of the straight-chain or side-chain haloalkanes;

[0138] The aforementioned compound 1D is contained in chemical formula 1 herein.

[0139] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0140] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide.

[0141] In this invention, the above composition can increase the expression level of the Klotho gene.

[0142] In this invention, the aforementioned chronic kidney disease can be defined as a disease state characterized by kidney damage or decreased kidney function lasting for more than 3 months.

[0143] The compounds of the present invention can be administered in various dosage forms, including oral and parenteral administration, in clinical applications. In the case of formulation, they are prepared by using diluents or excipients such as commonly used fillers, expanders, binders, wetting agents, disintegrants, and surfactants.

[0144] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, lozenges, etc., which are formulated by mixing one or more compounds of the present invention with at least one excipient such as starch, calcium carbonate, sucrose, lactose, or gelatin. Furthermore, in addition to simple excipients, lubricants such as magnesium stearate and talc are used. Liquid dosage forms for oral administration include suspensions, oral solutions, emulsions, or syrups, which may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0145] As preparations for parenteral administration, these include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solutions and suspensions may use propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, semi-synthetic fatty acid esters (witepsol), polyethylene glycol, Tween 61, cocoa butter, glyceryl laurate, glycerin, gelatin, etc., may be used.

[0146] Furthermore, the effective dosage of the compound of the present invention for the human body can vary depending on the patient's age, weight, sex, administration method, health status, and disease severity. Typically, it ranges from approximately 0.001 mg / kg / day to 100 mg / kg / day, preferably from 0.01 mg / kg / day to 35 mg / kg / day. When based on an adult patient weighing 70 kg, the dosage is typically from 0.07 mg / day to 7000 mg / day, preferably from 0.7 mg / day to 2500 mg / day. It can also be administered once daily or several times daily at prescribed intervals, as determined by a doctor or pharmacist.

[0147] The present invention will now be described in more detail through the following embodiments. However, the following embodiments are merely illustrative of the invention, and the scope of the invention is not limited to the following embodiments.

[0148] Example 1: Preparation of N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0149]

[0150] Step 1: Dimethyl (2-chloro-4-nitrobenzyl)imino dithiocarbonate (Dimethyl (2- Preparation of chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1)

[0151] 2-Chloro-4-nitrobenzamide (500 mg, 2.49 mmol), carbon disulfide (CS2) (759 mg, 9.97 mmol), and iodomethane (1.13 g, 7.97 mmol) were dissolved in dimethylformamide ( N,N After adding 7 mL of dimethylformamide, add 60% sodium hydride (200 mg, 4.98 mmol) and stir for 5 hours at room temperature.

[0152] Ice-cold water was slowly added to the reaction mixture, and ethyl acetate was extracted. The organic layer was washed with brine, dried over Na₂SO₄, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (10% ethyl acetate / n-hexane) to obtain a pale yellow solid of dimethyl (2-chloro-4-nitrobenzyl)iminodithiocarbonate (160 mg, 21%).

[0153] 1 H NMR (400 MHz, acetone-d6); δ8.34 (d, 1H, J = 2.0 Hz), 8.29 (dd, 1H, J =2.4, 8.8 Hz), 8.20 (d, 1H, J = 8.4 Hz), 2.65 (s, 6H).

[0154] Step 2: N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide ( N -(Benzo[d]oxazol-2- Preparation of yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0155] After dissolving the dimethyl(2-chloro-4-nitrobenzyl)iminodithiocarbonate (150 mg, 0.49 mmol) obtained in step 1 above in dimethylformamide (15 mL), 2-aminophenol (53 mg, 0.49 mmol) was added.

[0156] After circulating the reaction mixture for 6 hours, the solvent was removed under reduced pressure. Purification was performed by silica gel column chromatography (40% ethyl acetate / n-hexane). Diethyl ether was added to the reaction mixture, and the precipitated solid was filtered to obtain a brown solid, N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (70 mg, 30%).

[0157] 1 H NMR (400 MHz, acetone-d6); δ8.36 (d, 1H, J = 2.0 Hz), 8.33 (dd, 1H, J = 2.0, 8.4 Hz), 8.09 (d, 1H, J = 8.4 Hz), 7.62-7.56 (m, 2H), 7.40-7.33 (m, 2H).

[0158] Example 2: Preparation of 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065)

[0159]

[0160] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4- Preparation of Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, 17065-2-1)

[0161] 2-amino- p 2-Amino-p-cresol (300 mg, 2.44 mmol) was dissolved in methanol (12 mL), followed by the addition of 3,4-dichlolrophenyl isothiocyanate (497 mg, 2.44 mmol) and stirring at room temperature for 18 hours. The reaction was confirmed by thin-layer chromatography (TLC) and then cooled in a refrigerator (0–4 °C). The precipitated solid was filtered to obtain a white solid (346 mg) of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, which was used directly in the next step without further purification.

[0162] 1 H NMR (400 MHz, acetone-d6); δ7.98 (dd, 1H, J = 0.4, 2.0 Hz), 7.55-7.50 (m, 2H), 7.43 (br s, 1H), 6.94-6.90 (m, 1H), 6.85 (d, 1H, J = 8.4 Hz)2.24 (s, 3H).

[0163] Step 2: 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole) Preparation of dichlorophenyl)aminobenzoxazole (FCCS-17065)

[0164] Potassium superoxide (KO2) (375 mg, 5.29 mmol), acetonitrile

[0165] A solution of acetonitrile (MeCN) (15 mL) was slowly added to a solution of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (346 mg, 1.06 mmol) obtained in step 1 above, dissolved in acetonitrile (25 mL), and stirred at room temperature for 18 hours.

[0166] Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain the target compound 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (170 mg, 24%, step 2) as a white solid.

[0167] 1 H NMR (400 MHz, acetone-d6); δ8.29 (d, 1H, J = 2.8 Hz), 7.73 (dd, 1H, J = 2.8, 8.8 Hz), 7.76 (d, 1H, J = 8.8 Hz), 7.32-7.20 (m, 1H), 7.28 (d, 1H, J =8.0 Hz), 7.00-6.970 (m, 1H), 2.41 (s, 3H).

[0168] Example 3: Preparation of 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066)

[0169]

[0170] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (1-(3,4- Preparation of Dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea, 17066-3-1)

[0171] 2-Amino-4-methoxyphenol (1.13 g, 8.12 mmol) was dissolved in methanol (40 mL), followed by the addition of 3,4-dichlorophenyl isothiocyanate (1.99 g, 9.74 mmol). The mixture was stirred at room temperature for 18 hours. After confirming the completion of the reaction by thin-layer chromatography, the mixture was cooled in a refrigerator (0 °C–4 °C). The precipitated solid was filtered to obtain a brown solid (2 g) of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea, which was used directly in the next step without further purification.

[0172] 1 H NMR (400 MHz, methanol-d4); δ7.82 (d, 1H, J = 2.4 Hz), 7.48-7.44 (m,2H), 7.39 (dd, 1H, J = 1.4, 8.8 Hz), 6.81 (d, 1H, J = 8.8 Hz), 6.66 (dd, 1H, J =1.6, 8.8 Hz), 3.73 (s, 3H).

[0173] Step 2: N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4- Preparation of dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (17066-3-2)

[0174] A solution of potassium superoxide (540 mg, 7.6 mmol) and acetonitrile (20 mL) was slowly added to a solution of 17066-3-1 (525 mg, 1.52 mmol) dissolved in acetonitrile (30 mL), and the mixture was stirred at room temperature for 18 hours. Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to obtain a brown solid of N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (230 mg, 35%).

[0175] 1 H NMR (400 MHz, acetone-d6); δ8.29 (d, 1H, J = 2.4 Hz), 7.70 (dd, 1H, J = 2.4, 8.8 Hz), 7.55 (d, 1H, J = 8.8 Hz), 7.30 (d, 1H, J= 8.8 Hz), 7.08 (d, 1H, J = 2.8 Hz), 7.74 (dd, 1H, J = 2.4, 8.8 Hz), 3.84 (s, 3H).

[0176] Step 3: 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)) Preparation of amino)benzo[d]oxazol-5-ol (FCCS-17066)

[0177] Under an Ar atmosphere, 200 mg (0.65 mmol) of 17066-3-2 obtained in step 2 above was dissolved in 15 mL (anhydrous) of dichloromethane and cooled in an ice bath. Boron tribromide (3.23 mL, 1.0 M dichloromethane) was slowly added, and the temperature was raised to room temperature and stirred for 24 hours. Sodium hydroxide (NaOH) solution (8 mL, 1.0 M water) was slowly added to complete the reaction, and the mixture was transferred to a separatory funnel to separate the organic and aqueous layers. The aqueous layer was extracted with ethyl acetate, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (97 mg, 50%) as a brown solid.

[0178] 1 H NMR (400 MHz, acetone-d6); δ8.29 (br s, -OH), 8.26 (d, 1H, J = 2.4Hz), 7.72 (dd, 1H, J = 2.4, 8.8 Hz), 7.56 (d, 1H, J = 8.8 Hz), 7.21 (dd, 1H, J =2.0, 7.2 Hz), 6.95 (d, 1H, J = 2.0 Hz), 6.66 (dd, 1H, J = 2.4, 8.8 Hz).

[0179] Example 4: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067)

[0180]

[0181] Step 1: 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (1-(4-ethylphenyl)-3- Preparation of (2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1)

[0182] 2-Amino-4-nitrophenol (1.88 g, 12.25 mmol) and 4-ethylphenyl isothiocyanate (2 g, 12.25 mmol) were dissolved in methanol (80 mL) and stirred at room temperature for one day. After removing the solvent under reduced pressure, the solution was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to obtain 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (2.9 g, 65%) as a brown solid.

[0183] 1 H NMR (400 MHz, methanol-d4); δ9.24 (d, 1H, J = 2.8 Hz), 7.88 (dd, 1H, J = 2.0, 9.2 Hz), 7.36 (d, 2H, J = 8.4 Hz), 7.25 (d, 2H, J = 8.8 Hz), 6.94 (d, 1H, J = 9.2 Hz), 2.66 (q, 2H, J = 7.6 Hz), 1.24 (t, 3H, J = 7.6 Hz).

[0184] Step 2: N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine (N-(4-ethylphenyl)-5- Preparation of nitrobenzo[d]oxazol-2-amine (Interm-3-2)

[0185] After cooling a solution of potassium superoxide (2.8 g, 39.38 mmol) and acetonitrile (130 mL) in an ice bath, a solution of Interm-3-1 (2.5 g, 7.88 mmol) obtained in step 1 above dissolved in acetonitrile (170 mL) was slowly added, and the mixture was stirred at room temperature for 18 hours. Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain the compound Interm-3-2 (1.78 g, 80%) as a brown solid.

[0186] 1H NMR (400 MHz, methanol-d4); δ8.20 (d, 1H, J = 1.0 Hz), 8.08 (dd, 1H, J = 0.8, 9.6 Hz), 7.59 (d, 2H, J = 8.8 Hz), 7.51 (d, 1H, J = 8.8 Hz), 7.22 (d,2H, J = 8.8 Hz), 2.64 (q, 2H, J = 7.6 Hz), 1.24 (t, 3H, J = 7.6 Hz).

[0187] Step 3: N-(4-ethylphenyl)benzo[d]oxazol-2,5-diamine (N-(4-ethylphenyl)benzo[d] Preparation of oxazole-2,5-diamine (Interm-3-3)

[0188] Palladium on carbon (Pd / C) (1.70 g, 0.80 mmol, 10% by weight, wet support) was weighed and added to a round-flask, which was then purged with Ar gas. A solution of Interm-3-2 (1.58 g, 5.30 mmol) obtained in step 2 above, dissolved in methanol (80 mL), was slowly added, followed by substitution with H2(g). The mixture was stirred at room temperature for 18 hours while bubbling H2(g). The reaction was confirmed to be complete by thin-layer chromatography, and the solvent was removed by filtration through a diatomaceous earth pad under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain a light brown solid, Interm-3-3 (1.21 g, 90%).

[0189] 1 H NMR (400 MHz, Acetone-d6); δ7.71 (m, 2 H), 7.19 (m, 2H), 7.03 (dd,1H, J = 0.8, 8.4 Hz), 6.75 (dd, 1H, J = 0.8, 2.0 Hz), 6.44 (dd, 1H, J = 2.0, 8.4Hz), 2.60 (q, 2H, J = 7.6 Hz), 1.19 (t, 3H, J = 7.6 Hz).

[0190] Step 4: N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (N- (2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, FCCS- Preparation of 17067)

[0191] The Interm-3-3 (253 mg, 1 mmol) and 2-chloro-5-nitrobenzoyl chloride (220 mg, 1 mmol) obtained in step 3 above were dissolved in dimethylformamide (4 mL), and then diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added. The mixture was stirred at room temperature for 18 hours. After 18 hours, 0.5 equivalents of 2-chloro-5-nitrobenzoyl chloride and diisopropylethylamine were added, and the mixture was stirred for another 8 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed successively with saturated aqueous NaHCO3 solution and brine. After drying the organic layer with Na2SO4, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (120 mg, 27%) as a pale yellow solid.

[0192] 1 H NMR (400 MHz, DMSO-d6); δ10.71 (s, 1H), 10.53 (s, 1H), 8.48 (d, 1H, J = 2.8 Hz), 8.34 (dd, 1H, J = 2.4, 8.8 Hz), 7.90 (d, 1H, J = 8.8 Hz), 7.82 (d, 1H, J = 2.0 Hz), 7.64 (d, 2H, J = 8.8 Hz), 7.46 (d, 1H, J = 8.8 Hz), 7.40 (dd, 1H, J = 2.0, 8.4 Hz), 7.21 (d, 1H, J = 8.8 Hz), 2.58 (q, 2H, J = 7.6 Hz), 1.18(t, 3H, J = 7.6 Hz).

[0193] Example 5: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide (FCCS-17068)

[0194]

[0195] Interm-3-3 (253 mg, 1 mmol) and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) obtained in step 3 of Example 4 above were dissolved in dimethylformamide (4 mL), followed by the addition of diisopropylethylamine (129 mg, 1 mmol), and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed sequentially with saturated NaHCO3 aqueous solution and brine. The organic layer was dried with Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound FCCS-17068 (270 mg, 64%) as a pale white solid.

[0196] 1 H NMR (400 MHz, Acetone-d6); δ8.18 (d, 1H, J = 2.4 Hz), 7.99 (t, 1H, J = 2.4 Hz), 7.97 (d, 1H, J = 2.0 Hz), 7.80-7.20 (m, 3H), 7.70-7.50 (m, 1H), 7.35 (d, 1H, J = 8.8 Hz), 7.24 (d, 1H, J = 8.8 Hz), 2.63 (q, 2H, J = 7.6 Hz), 1.22 (t, 3H, J = 7.6 Hz).

[0197] Example 6: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide (FCCS-17069)

[0198]

[0199] Interm-3-3 (253 mg, 1 mmol) and 3-(chloromethyl)benzoyl chloride (189 mg, 1 mmol) obtained in step 3 of Example 4 above were dissolved in dimethylformamide (4 mL), followed by the addition of diisopropylethylamine (129 mg, 1 mmol), and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed sequentially with saturated NaHCO3 aqueous solution and brine. The organic layer was dried with Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (30% ethyl acetate / n-hexane) to obtain the target compound FCCS-17069 (170 mg, 40%) as a pale white solid.

[0200] 1 H NMR (400 MHz, Acetone-d6); δ8.08 (t, 1H, J = 1.2 Hz), 8.03 (d, 1H, J = 2.0 Hz), 7.98 (dt, 1H, J = 1.2, 7.6 Hz), 7.80-7.75 (m, 2H), 7.69-7.65 (m,1H), 7.57-7.52 (m, 3H), 7.34 (d, 1H, J = 8.8 Hz), 7.26-7.22 (m, 2H), 2.62 (q,2H, J = 7.6 Hz), 1.22 (t, 3H, J = 7.6 Hz).

[0201] Example 7: Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A)

[0202]

[0203] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-dichlorophenyl)-3- Preparation of (2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1)

[0204] Under an Ar atmosphere, 2-Aminophenol (300 mg, 2.749 mmol) was dissolved in methanol (anhydrous MeOH) (8 mL), followed by the slow dropwise addition of 3,4-dichlorophenylisothiocyanate (0.47 mL, 3.299 mmol). The mixture was stirred at room temperature for 14 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. After solvent removal under reduced pressure, silica was added to the crude product for adsorption, and silica gel column chromatography (30% EtOAc / hexane, R) was performed. f =0.4) to obtain 793 mg (light brown foamy solid, 92%) of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea.

[0205] 1 H NMR (400 MHz, CD3OD); δ7.82 (d, 1 H, J = 2.8 Hz), 7.63 (d, 1 H, J =7.6 Hz), 7.45 (d, 1 H, J = 8.8 Hz), 7.39 (dd, 1 H, J = 8.6, 2.2 Hz), 7.11-7.06(m, 1 H), 6.90 (dd, 1 H, J = 8.0, 1.2 Hz), 6.85 (td, 1 H, J = 7.6, 1.2 Hz).

[0206] Step 2: 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N-(3,4-dichlorophenyl)] Preparation of aminobenzoxazole (FCCS-17065-A)

[0207] Under an Ar atmosphere, FCCS-17065-A-2-1 (400 mg, 1.277 mmol) and potassium superoxide (454 mg, 6.386 mmol) obtained in step 1 above were added, along with acetonitrile (48 mL), and the mixture was stirred at room temperature for 14 hours. After confirming the complete disappearance of the starting material using thin-layer chromatography, silica was added to the crude product and adsorption was performed under reduced pressure. Silica gel column chromatography (20% EtOAc / hexane, R) was then performed. f =0.4) to obtain 231 mg (white solid, 65%) of the target compound 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole.

[0208] 1 H NMR (400 MHz, CD3OD); δ8.06 (d, 1 H, J = 2.8 Hz), 7.55 (dd, 1 H, J =8.6, 2,6 Hz), 7.48-7.45 (m, 2 H), 7.39 (d, 1 H, J = 8.0 Hz), 7.24 (td, 1 H, J =7.6, 1.2 Hz), 7.16 (td, 1 H, J = 7.8, 1.2 Hz).

[0209] Example 8: Preparation of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B)

[0210]

[0211] Step 1: 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthyl-2-yl)thiourea (1-(3,4-dichlorophenyl)- Preparation of 3-(3-hydroxynaphthalen-2-yl)thiourea (FCCS-17065-B-2-1)

[0212] Under an Ar atmosphere, 3-Amino-2-naphthol (350 mg, 2.119 mmol) was added to 7 mL of anhydrous MeOH and 2 mL of chloroform (CHCl3). After stirring at room temperature for 5 minutes, 0.38 mL of 3,4-dichlorophenyl isothiocyanate (2.638 mmol) was slowly added dropwise, and the mixture was stirred at room temperature for 13 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. After removing the solvent under reduced pressure, 8 mL of dichloromethane was added and the mixture was stirred for 5 minutes. The undissolved solid was filtered to obtain 792 mg (white solid, 99%) of 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphth-2-yl)thiourea.

[0213] 1 H NMR (400 MHz, DMSO-d6); δ10.48 (s, 1 H), 10.34 (s, 1 H), 9.57 (s, 1H), 8.59 (s, 1 H), 8.05 (d, 1 H, J = 2.0 Hz), 7.73 (d, 1 H, J = 8.0 Hz), 7.67(d, 1 H, J= 7.6 Hz), 7.60 (d, 1 H, J = 8.4 Hz), 7.52 (dd, 1 H, J = 8.6, 2.2Hz), 7.35 (t, 1 H, J = 7.2 Hz), 7.27 (t, 1 H, J = 7.6 Hz), 7.24 (s, 1 H).

[0214] Step 2: N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine Preparation of naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B)

[0215] Under an Ar atmosphere, FCCS-17065-B-2-1 (400 mg, 1.101 mmol) and potassium superoxide (391 mg, 5.505 mmol) obtained in step 1 above were added, followed by acetonitrile (42 mL) and stirring at room temperature for 14 hours. After confirming the complete disappearance of the starting material using thin-layer chromatography, silica was added to the crude product and adsorption was performed under reduced pressure. Silica gel column chromatography (20% EtOAc / hexane, R) was then performed. f =0.5) to obtain 236 mg (white solid, 65%) of the target compound N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine.

[0216] 1 H NMR (400 MHz, DMSO-d6); δ11.22 (s, 1 H), 8.20 (d, 1 H, J = 2.0 Hz),7.98-7.95 (m, 4 H), 7.72 (dd, 1 H, J = 8.8, 2.4 Hz), 7.66 (d, 1 H, J = 8.4 Hz),7.47-7.41 (m, 2 H).

[0217] Example 9: Preparation of N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C)

[0218]

[0219] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4- Preparation of difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, FCCS-17065-C-2-1)

[0220] Under an Ar atmosphere, methanol (anhydrous MeOH) (8 mL) was added to and dissolved in 2-amino-p-cresol (300 mg, 2.436 mmol), followed by the slow addition of 3,4-difluorophenylisothiocyanate (0.37 mL, 2.923 mmol). The mixture was stirred at room temperature for 13 hours. Thin-layer chromatography was used to confirm the complete disappearance of the starting material. After solvent removal under reduced pressure, silica was added to the crude product for adsorption, and silica gel column chromatography (30% EtOAc / hexane, R) was performed. f =0.4) to obtain 710 mg (white foamy solid, 99%) of 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea.

[0221] 1 H NMR (400 MHz, CD3OD); δ7.57-7.52 (m, 1 H), 7.40 (s, 1 H), 7.25-7.13(m, 2 H), 6.91 (dd, 1 H, J = 8.0, 1.6 Hz), 6.79 (d, 1 H, J = 8.0 Hz), 2.25 (s, 3 H).

[0222] Step 2: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (N-(3,4-difluorophenyl)- Preparation of 5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C)

[0223] Under an Ar atmosphere, FCCS-17065-C-2-1 (400 mg, 1.359 mmol) and potassium superoxide (483 mg, 6.795 mmol) obtained in step 1 above were added, along with acetonitrile (52 mL), and the mixture was stirred at room temperature for 14 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. Silica was added to the crude product, and adsorption was performed under reduced pressure. Silica column chromatography (20% EtOAc / hexane, R...) was then performed. f =0.45) to obtain 224 mg (white solid, 63%) of the target compound N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine.

[0224] 1 H NMR (400 MHz, CD3OD); δ= 7.83-7.78 (m, 1 H), 7.33-7.29 (m, 1 H), 7.27-7.20 (m, 3 H), 6.97-6.95 (m, 1 H), 2.41 (s, 3 H).

[0225] Example 10: Synthesis of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025)

[0226]

[0227] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-difluorophenyl)-3- Preparation of (2-hydroxyphenyl)thiourea (FCCS-19025-2-1)

[0228] Under an Ar atmosphere, 2-aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL), followed by the slow addition of 3,4-difluorophenyl isothiocyanate (224 μl, 1.65 mmol), and the mixture was stirred at room temperature for 13 hours. The reaction was confirmed to be complete by thin-layer chromatography, and methanol was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% acetone / n-hexane) to obtain a pale yellow solid of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (354 mg, 92%).

[0229] 1 H- NMR (400MHz, MeOH-d4)δ7.62 (d, J = 8.0 Hz, 1H), 7.55 (ddd, J = 2.4Hz, 1H), 7.25-7.13 (m, 2H), 7.11-7.05 (m, 1H), 6.92-6.82 (m, 2H); ESI-(+)281.3 [M+H] ＋ .

[0230] Step 2: N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine Preparation of oxazol-2-amine (FCCS-19025)

[0231] Under an Ar atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) and potassium superoxide (284 mg, 4.00 mmol) obtained in step 1 were dissolved in acetonitrile (25 mL), and the mixture was stirred at room temperature for 14 hours. After confirming the completion of the reaction by thin-layer chromatography, the acetonitrile was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10%–20% ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (160 mg, 82%) as a white solid.

[0232] 1 H- NMR (400MHz, MeOH-d4)δ7.82 (ddd, J= 2.8 Hz, 1H), 7.42 (d, J = 7.6Hz, 1H), 7.36 (d, J = 8.0 Hz, 1H), 7.34-7.29 (m, 1H), 7.28-7.18 (m, 2H), 7.16-7.10 (m, 1H); ESI-(+) 247.2 [M+H] ＋ .

[0233] The chemical structural formulas of Examples 1 to 10 are shown in Table 1 below.

[0234]

[0235] Comparative Example 1

[0236] N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1.

[0237]

[0238] Comparative Example 2

[0239] 2'-Chloroacetanilide (C0621) was purchased and used as Comparative Example 2.

[0240]

[0241] Comparative Example 3

[0242] N-methyl-1H-indole-3-carboxamide (FCCS-16030) was purchased and used as Comparative Example 3.

[0243]

[0244] Comparative Example 4: Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031)

[0245]

[0246] Step 1: Methyl 2-(1H-indole-3-carboxamide)acetate (methyl 2-(1H-indole-3- Preparation of carboxamidoacetate (CCS-16031-3-1)

[0247] Indole-3-carboxylic acid (600 mg, 3.72 mmol) and glycine methyl ester (467 mg, 3.72 mmol) were dissolved in chloroform (11 mL) under an Ar atmosphere and cooled in an ice bath. Triethylamine (1.04 mL, 7.446 mmol) and N,N-diisopropylcarbodiimide were then added, and the mixture was stirred at 0 °C for 14 hours. The solution was washed with 10% NaHCO3 aqueous solution, followed by washing with 5% HCl aqueous solution, and residual water was removed by passing through anhydrous Na2SO4 flakes. The solvent was removed under reduced pressure. Silica gel column chromatography (70% ethyl acetate / n-hexane) was performed to obtain 430 mg (white solid, 50%) of methyl 2-(1H-indole-3-carboxyamide) acetate in a mixture state. It was used directly in the next step without further purification. ESI-MS: 231.2 [MH] - .

[0248] Step 2: 2-(1H-indole-3-carboxamido)acetic acid Preparation of acid (FCCS-16031-3-2)

[0249] The 2-(1H-indole-3-carboxamide)acetate obtained in step 1 above (220 mg, 0.947 mmol) was dissolved in tetrahydrofuran (6 mL), and a solution of lithium hydroxide monohydrate (131 mg, 3.126 mmol) dissolved in water (2 mL) was added. The mixture was stirred at room temperature for 1 hour. After adjusting the pH to 2 by adding 1.0 N HCl aqueous solution, the mixture was extracted with ethyl acetate. After removing the remaining water with anhydrous Na2SO4 tablets, the solvent was removed under reduced pressure. 147 mg (71%) of 2-(1H-indole-3-carboxamide)acetic acid was obtained by silica gel column chromatography (10% methanol / dichloromethane).

[0250] 1 H NMR (400 MHz, CD3OD); δ8.10-8.08 (m, 1 H), 7.92 (s, 1 H), 7.43 (dt, J = 8.0, 1.2 Hz, 1 H), 7.17 (quint d, J = 7.2, 1.6 Hz, 2 H), 4.12 (s, 2 H).

[0251] Step 3: N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (N-(2-((2- Preparation of chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide, FCCS-16031)

[0252] Under an Ar atmosphere, 2-(1H-indole-3-carboxamide)acetic acid (200 mg, 0.917 mmol) and N,N,N',N'-tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate (TSTU) (290 mg, 0.962 mmol) obtained in step 2 above were dissolved in dimethylformamide (4 mL, anhydrous), and N,N-diisopropylethylamine (DIEA) (0.4 mL, 2.293 mmol) was added. The mixture was stirred at room temperature for 3 hours. 2-chloroaniline (0.29 mL, 2.751 mmol) and N,N-diisopropylethylamine (0.64 mL, 3.668 mmol) were then added, and the mixture was heated at 60 °C for 4 hours. After solvent removal under reduced pressure, extraction was performed with dichloromethane and saturated aqueous NH4Cl solution to obtain an organic layer. Residual water was removed by passing the layer through anhydrous Na2SO4 flakes, followed by solvent removal under reduced pressure. Silica gel column chromatography (70% ethyl acetate / n-hexane) yielded 20 mg (white solid, 6.6%) of the target compound N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide.

[0253] 1H NMR (400 MHz, CD3OD); δ8.15-8.12 (m, 1 H), 8.04 (dd, J = 8.0, 1.2Hz, 1 H), 7.97 (s, 1 H), 7.46-7.41 (m, 2 H), 7.33-7.28 (m, 1 H), 7.23-7.12(m, 3 H), 4.26 (s, 2 H)

[0254] Experiment 1-1: Luciferase Expression Experiment (Comparative Examples 1 to 4)

[0255] To evaluate whether the klotho gene is expressed by assessing luciferase activity, RPTEC (human renal proximal tubule epithelial cell, ATCC CRL-4031) cells, which are epithelial cells of the proximal tubule of human kidney, were purchased from Lonza, Inc.

[0256] For culturing, a Renal Epithelial Growth Medium (REGM™) Bulletkit manufactured by Lonza was used, and the medium was cultured at 37°C and 5% CO2. The plasmid used to express luciferase was configured in a manner that allows the expression of the firefly luciferase gene to be regulated by the promoter site of the human KL (klotho) gene.

[0257] The plasmid was introduced into cells using Roche's X-treme GENE transfection reagent. The activity of luciferase expressed in the cells was measured using a Promega Dual-Luciferase reporter assay system. Luciferase activity was measured after treating cells cultured at the indicated concentrations for 24 hours. Excessively high luciferase activity indirectly indicates increased expression of the klotho gene.

[0258] Comparative Examples 1 to 4 were treated with RPTEC cells at a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene that included a promoter from the start of the human klotho gene up to 1.7 kbp or a reporter gene that included a promoter from the start of the human klotho gene up to 240 kbp.

[0259] As a result, Figure 1 As shown, the compound of Comparative Example 1 was confirmed to have the highest luciferase activity.

[0260] Experimental Examples 1-2: Luciferase Expression Experiment (Examples 1 to 6)

[0261] Based on the results of Experiment 1-1 above, Examples 1 to 6, which have chemical structures similar to Comparative Example 1, were synthesized, and Experiment 1-2 was carried out.

[0262] Examples 1 to 6 were treated with RPTEC at concentrations of 0.5 μM, 1 μM, and 5 μM, respectively, using epithelial cells of the proximal tubules of human kidneys. Comparative Example 1 was treated with a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene (pHKP-luc) containing a promoter extending 2.1 kb upstream of the human klotho gene. The results are shown in [the table / incomplete]. Figure 2 and Figure 3 .

[0263] like Figure 2 As shown, the expression levels of the reporter genes of the compounds in Examples 1 and 2 were confirmed to be similar to those in Comparative Example 1.

[0264] like Figure 3 As shown, Comparative Example 1 and Examples 1 to 3 were treated with RPTEC cells at a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene (pHKP-luc) that includes a promoter up to -2.1 kb upstream of the human klotho gene. The results confirmed that the level of the compound in Example 2 was similar to that in Comparative Example 1.

[0265] Experiment Example 2: Quantitative evaluation of the expression level of the klotho (KL) gene using real-time polymerase chain reaction (Real-time PCR) experiment

[0266] RNA was extracted from RPTEC cells, which were epithelial cells of the proximal tubules of human kidneys, after being treated with the compounds of Comparative Example 1 and Examples 1 to 2 for 6 hours. The Qiagen RNeasy kit was used. The extracted RNA was used to prepare cDNA using the Thermo Fisher Scientific Superscript II kit. Results of the KL (klotho) gene-specific assay performed using the Applied Biosystems Taqman Gene Expression assays kit are shown below. Figure 4 .

[0267] like Figure 4 As shown, the levels of the compound in Example 2 were confirmed to be similar to those in Comparative Example 1.

[0268] Based on the results of this Experiment Example 2, compounds of Examples 7 to 10 with chemical structures similar to those of Example 2 were synthesized and used in subsequent Experiment Example 3.

[0269] Experimental Example 3: Quantitative evaluation of klotho (KL) gene expression using conventional polymerase chain reaction (PCR) experiments

[0270] In Examples 7 to 10, RPTEC cells, which are epithelial cells of the proximal tubules of human kidneys, were treated with 2.5 μM for 6 hours. RNA was extracted from the cells, and the extracted RNA was subjected to conventional polymerase chain reaction after cDNA preparation using the Superscript II kit from Thermo Fisher Scientific.

[0271] The primer information used in the experiment is as follows.

[0272] KL-F GATAGAGAAAAATGGCTTCCCTCC (serial number 1)

[0273] KL-R GGTCGGTAAACTGAGACAGAGTGG (Serial Number 2)

[0274] GAPDH-F TGACAACTTTGGTATCGTGGAAGG (Serial Number 3)

[0275] GAPDH-R AGGGATGATGTTCTGGAGAGCC (Serial Number 4)

[0276] After electrophoresis on an agarose gel, the DNA amplified by polymerase chain reaction was confirmed by ethidium bromide staining. The amount of DNA in the bands was quantified using the SpeedyQuant program and shown in the figure. Figure 5 .

[0277] like Figure 5 As shown, it was confirmed that the expression level of the klotho (KL) gene in Examples 8 to 10 was higher than that in Comparative Example 1. In particular, Example 10 showed an expression level that was about 10 times higher than that in Comparative Example 1.

[0278] Experiment Example 4: Toxicity Test

[0279] Comparative Examples 1, 2, and Examples 9 to 10 were treated with cultured HK2 (human kidney-2) cells at concentrations of 25 μM or 12.5 μM for 24 hours. Cytotoxicity was then determined using the EZ-Cytox kit. EZ-Cytox generates formazan with absorbance at 450 nm via mitochondrial enzymes in live cells, thus resulting in higher absorbance in live cells at 450 nm. The reduction in cytotoxicity by treatment with the compound sample was confirmed when the toxicity of cells treated with the same volume of dimethyl sulfoxide (DMSO) was considered as 1. The results are shown below. Figure 6 .

[0280] like Figure 6As shown, when treated at concentrations of 12.5 μM or 25 μM, the compound of Example 10 exhibited minimal toxicity, and when compared with Comparative Example 1, a toxicity improvement of more than 20% was confirmed.

[0281] Experiment Example 5: Analysis of Klotho protein expression in HK-2 cells

[0282] like Figure 7a The experimental protocol involved treating HK-2 cells (human kidney cells) with cisplatin (20 μM) to create a disease model, followed by treatment with the KS1 compound (Example 10) (3 μM). Cells were harvested 24 hours later to confirm the level of Klotho protein expression. Figure 7b As shown, it was confirmed that Klotho protein expression in HK-2 cells decreased in the group treated with cisplatin and increased in the group treated with compound KS1 (Example 10).

[0283] Experimental Example 6: Effect Analysis of KS1 Compound (Example 10) in a Unilateral Ureter Obstruction (UUO) Model

[0284] A unilateral ureteral obstruction model was established using 5-week-old male C56BL / 6 mice. To create the model, the right ureter was bound with sutures, and 24 hours later, KS1 compound (20 mg / kg / day) was administered intraperitoneally daily. Mice were then sacrificed on days 7 and 14, and samples were collected for experimental use. Figure 8a ).

[0285] Confirm whether kidney enlargement is present.

[0286] The experimental results showed renal hypertrophy in the unilateral ureteral obstruction model, but no size difference was observed in the kidneys treated with the KS1 compound. Figure 8b ).

[0287] Confirm changes in the nucleus and cytoplasm

[0288] To observe changes in the nucleus and cytoplasm in a unilateral ureteral obstruction model, H&E staining was performed, and the results are shown below. Figure 9 In the 1-week sample of the KS1-untreated unilateral ureteral obstruction model, a significant increase in the number of nuclei was observed. In the 2-week sample, cytoplasmic destruction was observed. However, in the sample treated with KS1, a significant reduction in tissue destruction was observed. Figure 9 ).

[0289] Confirm whether fibrosis has progressed

[0290] Furthermore, Sirius red staining was performed to observe changes in fibrosis progression in the unilateral ureteral obstruction model. In the 1-week tissue samples of the KS1-untreated unilateral ureteral obstruction model, red fibrosis progression was observed, and in the 2-week samples, further progression of fibrosis was shown compared to the 1-week samples. However, in the KS1-treated group, less fibrosis was observed compared to the KS1-untreated unilateral ureteral obstruction model. Figure 10 ).

[0291] Confirm whether cells have undergone apoptosis

[0292] To observe the degree of apoptosis in a unilateral ureteral obstruction model, TUNEL staining was performed. Apoptosis occurred in the 1-week tissue samples of the KS1-untreated unilateral ureteral obstruction model, and increased apoptosis was observed in the 2-week samples compared to the 1-week samples. However, in the KS1-treated group, a significant reduction in apoptosis was observed compared to the KS1-untreated unilateral ureteral obstruction model (Figure 11).

[0293] Confirm Klotho protein expression level

[0294] The results of changes in Klotho protein expression were confirmed in 1-week samples of a unilateral ureteral obstruction model. In the untreated unilateral ureteral obstruction model samples, Klotho protein was reduced, but in the case of treatment with the KS1 compound, Klotho protein expression was increased. Figure 12 ).

[0295] MMP-9 protein expression analysis

[0296] Results confirming changes in MMP-9 protein as an inflammatory marker in a unilateral ureteral obstruction model showed increased MMP-9 expression in 1-week and 2-week samples of the KS1-untreated unilateral ureteral obstruction model, but significantly reduced MMP-9 expression was observed in KS1-treated samples. Figure 13 ).

[0297] Experimental Example 7. Analysis of the effects of compound KS1 in a chronic kidney disease model (Example 10)

[0298] Twenty db / m mice (10 at 5 weeks old and 10 at 6 weeks old) and 50 db / db mice (25 at 5 weeks old and 25 at 6 weeks old) were purchased from Jackson Lab in the United States to serve as chronic kidney disease models. After a one-week acclimatization period, experiments began (mouse model numbers: JAX 000642- BKS.Cg-Dock7m + / + Leprdb / j 5W / M Dock7m wild-type and BKS.Cg-Dock7m + / + Leprdb / j 5W / M Dock7m heterozygous). Due to the large number of individuals in each group, the mice were divided into set 1 and set 2 for the experiment. The 5-week-old mice were designated as set 2, and the experiment was delayed by one week. All mice were adjusted to participate in the experiment from 6 weeks of age. After equalizing the weight of each group, mice were fed a normal diet (ND) and a high-protein diet (HPD). Following three weeks of HPD administration, urine was collected 2 hours after administration via a metabolic cage for analysis. Starting in week 5, urinalysis confirmed an increase in total protein and microalbumin levels in the HPD group, and the drug (KS1) was administered orally daily via gavage at different concentrations (2 mg / kg, 10 mg / kg, 50 mg / kg). After 12 weeks of drug administration, mice were euthanized, and blood and organs were collected for hematologic and tissue analysis. Urine analysis was performed at the SCL healthcare center, and hematologic analysis was conducted using an I-STAT cartridge (CHEM 8+).

[0299] Immunohistochemistry

[0300] After anesthetizing the experimental animals with an anesthetic, they were perfused and fixed in the heart for 8 minutes using a fixative (periodate-lysine-2% paraformaldehyde). Additional fixation was performed for 16 hours in the same fixative at 4°C. After dehydration via an alcohol series, the tissues were embedded in wax and cut into 5 μm sections to prepare tissue sections. The tissues were rehydrated and then heated in a pH 6 citric acid solution to retrivade the proteins fixed in the aldehydes. Then, after blocking endogenous peroxidase by treating with methanol containing 1.7% hydrogen peroxide (H2O2 in methanol) for 30 minutes, to improve antibody permeability, the antibody was treated with phosphate buffer containing 0.5% Triton X-100 (0.5% Triton X-100 in PBS) for 15 minutes. After blocking with normal serum, the primary antibody was treated and incubated overnight. The primary antibody used at this time was Klotho (Abcam, ab181373). The next day, the secondary antibody (vector, immPRESS kit) was washed with phosphate buffer (PBS) and treated with diaminidine (DAB) for staining. After staining with hematoxylin control, the slides were dehydrated and mounted for 100x magnification. Each group used more than 100 photographs and quantitatively analyzed the expressed parts using color image analyzer software (TDI Scope Eye version 3.6 for Windows; Olympus Corporation, Japan). Figure 14 Representative photographs of each stained group are shown below. Figure 15 As shown in the results, the expression of klotho protein was statistically significantly increased (p<0.05) in mice treated with the KS1 compound.

[0301] Urine analysis

[0302] Microalbumin levels were measured using urinary analysis. To correct for differences in muscle mass between individual mice, microalbumin levels were expressed as a proportion of creatinine values. Results showed that mice treated with the KS1 compound exhibited a statistically significant (p<0.05) reduction in microalbumin levels. Figure 16 ).

[0303] Blood analysis

[0304] Results of measurements of blood urea nitrogen (BUN), a characteristic blood marker of chronic kidney disease, showed a statistically significant (p<0.05) reduction in BUN in mice treated with the KS1 compound. Figure 17 ).

[0305] The present invention has now been described with reference to preferred embodiments. It will be understood by those skilled in the art that the invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustratively rather than limitingly. The scope of the invention is not shown in the foregoing description, but rather particularly in the claims, and all differences within the equivalent scope should be interpreted as included in the invention.

Claims

1. Use of a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition for the prevention or treatment of chronic kidney disease. The aforementioned chronic kidney disease is defined as a disease state characterized by kidney damage or decreased kidney function lasting for more than 3 months: Chemical Formula 1: In chemical formula 1, R 1 and R 2 They are -H and C respectively. 1-10 Straight-chain or branched alkyl groups.

2. The use according to claim 1, characterized in that, The compound represented by the above chemical formula 1 is selected from one of the following groups of compounds: 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

3. The use according to claim 1, characterized in that, The above composition increases the expression level of the Klotho gene.

Images