Recombinant nucleoside and derivative producing bacteria, and construction method and application thereof

Abstract

The application discloses recombinant bacteria for producing nucleosides and derivatives thereof, a construction method and application thereof. By weakening the activity of global transcriptional regulator CcpA in the microorganism, the microorganism can efficiently generate guanine, hypoxanthine or adenine nucleoside. Compared with the starting bacteria, the guanosine yield of the mutant strains of bacillus amyloliquefaciens 8344, 8345, 8346 and 8347 is increased from 1.1 g / L to 3.2 g / L, 1.8 g / L, 1.9 g / L and 2.8 g / L. The inosine yield is increased from 0.5 g / L to 1.5 g / L, 1.0 g / L, 1.0 g / L and 1.3 g / L. Compared with the starting bacteria, the adenosine yield of the mutant strains of bacillus subtilis A0004, A0005, A0006 and A0007 is increased from 8.9 g / L to 10.8 g / L, 10.6 g / L, 11.3 g / L and 11.9 g / L, and the application prospect is wide.

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering technology, specifically, it relates to a recombinant bacterium that produces nucleosides and their derivatives, its construction method, and its application. Background Technology

[0002] Nucleosides are a general term for a class of glycosides. They are components of nucleic acids and nucleotides. Nucleosides are formed by the condensation of D-ribose or D2-deoxyribose with pyrimidine or purine bases. Nucleosides are generally colorless crystals, insoluble in common organic solvents, readily soluble in hot water, and have a melting point of 160–240℃. Nucleosides formed from D-ribose are called ribonucleosides, which participate in the composition of RNA; nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleosides, guanine ribonucleosides, cytosine ribonucleosides, thymine ribonucleosides, and uracil ribonucleosides, which are abbreviated as adenosine (A), guanine (G), cytosine (C), thymine (T), and uridine (U), respectively.

[0003] Guanosine and inosine have wide applications in the food and pharmaceutical industries. In the food sector, guanosine and inosine are important precursors to disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as flavor enhancers, widely applied in condiments such as chicken bouillon and soy sauce. In the pharmaceutical sector, guanosine and inosine serve as intermediates for various antiviral drugs, such as acyclic guanosine, triazole nucleoside, and guanosine triphosphate sodium, all of which require guanosine as a raw material for synthesis. Inosine is an important precursor to inosine monophosphate, which in turn serves as a precursor for the synthesis of adenosine monophosphate (AMP) and guanosine monophosphate (GMP). It is suitable for treating various causes of leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, and can also be used to treat central retinitis and optic nerve atrophy.

[0004] Adenosine, or adenosine nucleoside, chemically named 6-amino-9-β-D-furanoribosyl-9-hydropurine, is a product of adenosine nucleotide dephosphorylation and an important nucleotide derivative. Adenosine is an endogenous nucleoside found throughout human cells. It can directly enter the myocardium, where it is phosphorylated to adenosine monophosphate, participating in myocardial energy metabolism and also contributing to coronary artery dilation and increased blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues in the body. Besides being used as a specific drug for treating heart disease, adenosine is also an important intermediate in the synthesis of adenosine triphosphate (ATP), adenine, adenosine monophosphate, and vidarabine, and is widely used in the pharmaceutical and other industries.

[0005] Currently, microbial fermentation is the main method for producing nucleosides, primarily using microorganisms such as Bacillus subtilis, Bacillus amyloliquefaciens, or Bacillus pumilus. In the selection and modification of growth strains, high-yielding nucleosides are selectively bred using ultraviolet mutagenesis and diethyl sulfate mutagenesis; alternatively, based on a thorough understanding of the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, and by using metabolic engineering techniques to purposefully modify the strains, superior traits and high nucleosides can be obtained. However, the fermentation performance of current nucleoside strains remains relatively poor, and the conversion rate of nucleosides is still low, failing to meet the demands of large-scale industrial production. Summary of the Invention

[0006] The purpose of this invention is to provide a recombinant bacterium that produces nucleosides and their derivatives, as well as its construction method and application.

[0007] To achieve the objectives of this invention, in a first aspect, this invention provides a modified microorganism, which, compared to an unmodified microorganism, exhibits reduced or lost activity of the global transcriptional regulator CcpA, and has enhanced nucleoside production capacity compared to an unmodified microorganism.

[0008] In this invention, the reference sequence number of the global transcriptional regulator CcpA on NCBI is BAMF_2774 (Bacillus amyloliquefaciens) or BSU_29740 (Bacillus subtilis).

[0009] Furthermore, the reduction or loss of activity of the global transcriptional regulator CcpA in microorganisms can be achieved by selecting from the following 1)-5), or an optional combination thereof:

[0010] 1) It can be reduced or lost by altering the promoter sequence of the gene encoding the global transcriptional regulator CcpA;

[0011] 2) It can be reduced or lost by altering the ribosome binding site of the gene encoding the global transcriptional regulator CcpA;

[0012] 3) It can be reduced or lost by altering the amino acid sequence of the global transcriptional regulator CcpA;

[0013] 4) It can be reduced or lost by altering the nucleotide sequence encoding the global transcriptional regulator CcpA;

[0014] 5) Lost by knocking out the coding sequence of the global transcriptional regulator CcpA.

[0015] The expression of the gene encoding the global transcriptional regulator CcpA can be reduced or the endogenous gene encoding the global transcriptional regulator CcpA can be knocked out by mutagenesis, site-directed mutagenesis or homologous recombination.

[0016] Preferably, the reduction or loss of activity of the global transcriptional regulator CcpA is achieved through at least one of the following methods (A-D):

[0017] A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M;

[0018] B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K;

[0019] C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P;

[0020] D. The start codon of the gene encoding the global transcriptional regulator CcpA is mutated from gtg or atg to ttg.

[0021] In this invention, the microorganism can be a species of Bacillus or Escherichia, such as Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus pumilus, Escherichia coli, etc.

[0022] Secondly, the present invention provides a method for constructing recombinant bacteria that produce nucleosides and their derivatives, by using genetic engineering techniques to inactivate or weaken the encoding gene of the global transcriptional regulatory factor CcpA in microorganisms with nucleoside production capabilities.

[0023] The weakening can be implemented by selecting from the following 1)-5), or any combination thereof:

[0024] 1) It can be reduced or lost by altering the promoter sequence of the gene encoding the global transcriptional regulator CcpA;

[0025] 2) It can be reduced or lost by altering the ribosome binding site of the gene encoding the global transcriptional regulator CcpA;

[0026] 3) It can be reduced or lost by altering the amino acid sequence of the global transcriptional regulator CcpA;

[0027] 4) It can be reduced or lost by altering the nucleotide sequence encoding the global transcriptional regulator CcpA;

[0028] 5) Lost by knocking out the coding sequence of the global transcriptional regulator CcpA;

[0029] The weakening method can be selected from at least one of mutagenesis, site-directed mutagenesis, and homologous recombination.

[0030] Preferably, the weakening is achieved through at least one of the following methods A to D:

[0031] A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M;

[0032] B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K;

[0033] C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P;

[0034] D. The start codon of the gene encoding the global transcriptional regulator CcpA is mutated from gtg or atg to ttg;

[0035] Thirdly, the present invention provides recombinant bacteria constructed according to the method described herein.

[0036] Fourthly, the present invention provides the application of the modified microorganism or the recombinant bacteria in the fermentation production of nucleosides and their derivatives or in increasing the fermentation yield of nucleosides and their derivatives.

[0037] The nucleosides and their derivatives include, but are not limited to, inosine, guanosine, adenosine, hypoxanthine, inosine acid, guanine, adenine, guanylic acid, riboflavin, diacetylguanylic acid, adenosine acid, vidarabine, etc.

[0038] Fifthly, the present invention provides a method for producing nucleosides, the method comprising the following steps:

[0039] a) Culturing the modified microorganism or the recombinant bacteria to obtain a culture;

[0040] b) Collect the resulting nucleosides from the culture obtained in step a).

[0041] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0042] This invention weakens the activity of the global transcriptional regulator CcpA in microorganisms, enabling them to produce guanine, hypoxanthine, or adenine nucleotides with high efficiency and speed. The mutant strain Ba 8344 (containing CcpA) I95M Point mutation), Ba 8345 (containing ccpA) E150K Point mutation), Ba 8346 (containing ccpA) L205PThe point mutations (B. subtilisA0004 and Ba 8347, which contain a weakened start codon for ccpA) increased guanosine production from 1.1 g / L to 3.2 g / L, 1.8 g / L, 1.9 g / L, and 2.8 g / L, respectively, compared to the original strain. Inosine production increased from 0.5 g / L to 1.5 g / L, 1.0 g / L, 1.0 g / L, and 1.3 g / L, respectively. The mutant strain B. subtilisA0004 (containing ccpA) also showed improved guanosine production compared to the original strain. I95M (mutation), B. subtilis A0005 (containing ccpA) E150K (mutation), B. subtilis A0006 (containing ccpA) L205P Compared with the original strain, the adenosine yield of *B. subtilis* A0007 (with a weakened ccpA start codon) increased from 8.9 g / L to 10.8 g / L, 10.6 g / L, 11.3 g / L, and 11.9 g / L, respectively. This invention provides an effective means for large-scale nucleoside production and has broad application prospects. Detailed Implementation

[0043] This invention provides a method for producing purine nucleosides using microorganisms, and successfully created a new microorganism capable of producing purine nucleosides with high efficiency for use in the method.

[0044] Research has found that by modifying the global transcriptional regulator CcpA (encoded by the ccpA gene) of Bacillus subtilis or Bacillus amyloliquefaciens, the activity of CcpA protein is weakened, enabling the microorganisms to produce guanine or hypoxanthine nucleosides with high efficiency and speed. Furthermore, a new microorganism capable of producing nucleosides with high efficiency has been successfully created, thus completing this invention.

[0045] CcpA is a global transcriptional regulator of both carbon catabolite repression (CCR) and carbon catabolite activation (CCA), ensuring optimal energy use under varying conditions. It interacts with P-Ser-HPr or P-Ser-Crh, resulting in the formation of a DNA-binding complex at the catabolite response element (cre). This DNA binding can activate or repress many different genes and operons.

[0046] Currently, there are no reports on the ability of weakening CcpA expression to improve the nucleoside production capacity of microorganisms. This invention is the first to demonstrate that by mutating this gene in Bacillus amyloliquefaciens to change the amino acid sequence or weaken its start codon, corresponding mutants can be obtained that can efficiently produce nucleosides, and a microorganism capable of efficient nucleoside production has been successfully constructed.

[0047] The present invention adopts the following technical solution:

[0048] This invention provides a Bacillus amyloliquefaciens or Bacillus subtilis strain whose intracellular amino acid sequence encoding the global transcriptional regulator CcpA is altered (e.g., amino acid 95 of the CcpA protein is mutated from I to M and / or amino acid 150 is mutated from E to K and / or amino acid 205 is mutated from L to P), and / or the ccpA start codon is mutated from gtg or atg to ttg, thereby enhancing the ability of the strain to produce nucleosides compared to the unmodified strain.

[0049] The above-mentioned mutation sites can be applied to Bacillus amyloliquefaciens and Bacillus subtilis, but are not limited to these two bacteria. They can also be used to produce nucleosides such as inosine, guanosine, and adenosine, or their corresponding nucleoside derivatives, such as hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, adenine, adenosine, and vidarabine.

[0050] This invention provides sequences of mutant global transcription factor CcpA, as shown in SEQ ID NO:2, 4, 6 and 8 of Bacillus amyloliquefaciens, with their encoding nucleic acid sequences as shown in SEQ ID NO:1, 3, 5 and 7, respectively, and the amino acid sequence of wild-type global transcription factor CcpA as shown in SEQ ID NO:9; mutant sequences of Bacillus subtilis are shown in SEQ ID NO:10, 12, 14 and 16, with their encoding nucleic acid sequences as shown in SEQ ID NO:11, 13, 15 and 17, respectively, and the amino acid sequence of wild-type global transcription factor CcpA as shown in SEQ ID NO:18.

[0051] This invention provides a method to weaken ccpA activity through gene modification. The weakening methods include amino acid mutation, promoter weakening, RBS weakening, and start codon weakening, including but not limited to the above four weakening methods.

[0052] This invention provides a weakened form of ccpA for use in the production of guanosine and guanosine-related derivatives, such as guanine, guanylic acid, riboflavin, diacetylguanylic acid, etc.

[0053] This invention provides a weakened form of ccpA for the production of inosine and inosine-related derivatives, such as inosine acid, guanylic acid, and adenosine acid.

[0054] This invention provides a weakened form of ccpA for use in the production of adenosine and adenosine-related derivatives, such as adenine, adenosine acid, and vidarabine.

[0055] This invention provides the application of weakened ccpA to microorganisms such as Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, and Escherichia coli.

[0056] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0057] The primer names and primer sequences involved in the following examples are shown in Table 1:

[0058] Table 1 Primer names and sequence information

[0059] ccpA95-1r ggtctgaattgcttaacataatatt ccpA95-2f aatattatgttaagcaattcagacc ccpA150-1f acaaaataaggatcctctagagcataatacagtgttccgctc ccpA150-1r gccctgttctttaactgacgcagc ccpA150-2f gctgcgtcagttaaagaacagggc ccpA150-2r gccaagcttgcatgcctgcagctgataaacaccgctgcggca ccpA205-1r cccgcttcttcaggcgcccgtttgt ccpA205-2f acaaacgggcgcctgaagaagcggg ccpA-ttg-1f acaaaataaggatcctctagagcgattgattacattgacgtc ccpA-ttg-1r tatatcgtaatgttgctcaatgaaaccactcct ccpA-ttg-2f aggagtggtttcattgagcaacattacgatata ccpA-ttg-2r gccaagcttgcatgcctgcagcgccgtcggtttccggtcaag BS0004-1f acaaaataaggatcctctagacgtaatggctgaggttcaccctg BS0004-1r gctctttctccatgttttggtcagagttgctcaaCataatatt BS0004-2f atattatGttgagcaactctgaccaaaacatggagaaagagctgca BS0004-2r gccaagcttgcatgcctgcagaacaggtgtaagataatcaaaac BS0005-1r ttcctcctgctcttTtacagaagcggca BS0005-2f tgccgcttctgtaAaagagcaggaggaa BS0006-1r aggttcgcttcttcaGgcgcacgtttg BS0006-2f acaaacgtgcgcCtgaagaagcgaacct BS0007-1f acaaaataaggatcctctagacagaacatatgaaacagcaacg BS0007-1r tagatcgtaatattgctcaAcctaaaaccactccttt BS0007-2f aggagtggttttaggTtgagcaatattacgatctacgat BS0007-2r gccaagcttgcatgcctgcagacgaacgcgatgtctgtatgtcctt

[0060] Example 1: CCPA in Bacillus amyloliquefaciens I95M Construction of point mutant strains

[0061] Using the genome of Ba 836 strain (see CN112574934A) as a template, the upstream and downstream homologous arms of ccpA were amplified using the primer pairs ccpA150-1f / ccpA95-1r and ccpA95-2f / ccpA150-2r with Pfu high-fidelity DNA polymerase. The obtained fragments were then gel-recovered and fused, and ccpA was amplified. I95M The full-length fragment was recovered using a gel (the nucleotide sequence of the corresponding ORF box is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2). The pKSU plasmid (the pKSU plasmid was kindly provided by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production[J], Applied Microbiology and Biotechnology, 2014, 98(21):8963-8973. Zhang W, Gao W, Feng J, et al DOI:10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and recovered using a gel. The linearized plasmid and ccpA were then assembled using an assembly kit. I95M The fragments were assembled and transformed into TransT1 competent cells, and later identified and screened to obtain the recombinant plasmid pKSU-ccpA. I95MTransformed into strain B.a836, transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30°C. The obtained transformants were inoculated into 5 mL LB liquid medium, cultured at 42°C and 200 rpm for 12 h, and passaged for one generation. The transformed transformants were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. The primary recombinants were inoculated into 5 mL LB liquid medium, cultured at 42°C and 200 rpm for 12 h, and passaged for one generation. The primary recombinants were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants. The ccpA point mutant strain was obtained and named Ba 8344.

[0062] Example 2 Bacillus amyloliquefaciens ccpA E150K Construction of point mutant strains

[0063] Using the genome of Ba 836 strain (see CN112574934A) as a template, the upstream and downstream homologous arms of ccpA were amplified using the primer pairs ccpA150-1f / ccpA150-1r and ccpA150-2f / ccpA150-2r with Pfu high-fidelity DNA polymerase. The obtained fragments were then gel-cleaved and fused to amplify the full-length ccpA fragment. E150K The gel was recovered (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:4), and the plasmid pKSU-ccpA was constructed according to the construction method in Example 1. E150K It was then transformed into strain Ba 836, and the resulting strain was named Ba 8345.

[0064] Example 3 Bacillus amyloliquefaciens ccpA L205P Construction of point mutant strains

[0065] Using the genome of Ba 836 strain (see CN112574934A) as a template, the upstream and downstream homologous arms of ccpA were amplified using the primer pairs ccpA150-1f / ccpA205-1r and ccpA205-2f / ccpA150-2r with Pfu high-fidelity DNA polymerase. The obtained fragments were then gel-recovered and fused, and amplified to obtain ccpA. L205P The full-length fragment was recovered using a gel electrophoresis apparatus (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO:5, and the amino acid sequence is shown in SEQ ID NO:6). The plasmid pKSU-ccpA was then constructed according to the construction method described in Example 1. L205P They were then transformed into strain Ba 836, and the resulting strain was named Ba 8346.

[0066] Example 4: Construction of a strain of Bacillus amyloliquefaciens with weakened start codon CCPA

[0067] Using primer pairs ccpA-ttg-1f / ccpA-ttg-1r and ccpA-ttg-2f / ccpA-ttg-2r, and with the B. a8341 strain genome as a template, the left homologous arms ccpA-ttg-L and ccpA-ttg-R fragments were amplified and fused. The full-length ccpA-ttg fragment was obtained (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO:7, and the amino acid sequence is shown in SEQ ID NO:8). The pKSU-ccpA-ttg plasmid was constructed according to the plasmid construction method in Example 1, and transformed into the Ba 8341 strain. A strain with a weakened ccpA start codon was obtained and named Ba 8347.

[0068] Example 5: CCPA in Bacillus subtilis I95M Construction of point mutant strains

[0069] To determine whether the ccpA mutation could increase adenosine production, we introduced the ccpAI95M point mutation into the adenosine-producing strain *B. subtilis* A5 (see CN110257315B for strain *B. subtilis* A5). Using the *B. subtilis* A5 genome as a template, the left and right homologous arms of the mutant fragment were amplified using primer pairs BS0004-1f / 1r and BS0004-2f / 2r. After gel extraction, the fragments were fused to obtain 0004-ccpA. I95M The fragment (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO:10, and the amino acid sequence is shown in SEQ ID NO:11) was used to construct the recombinant plasmid pKSU-0004-ccpA according to the method in Example 1. I95M The mutant strain was transformed into B. subtilis A5 and screened according to the screening method in Example 1. It was named B. subtilis A0004.

[0070] Example 6: CCPA in Bacillus subtilis E150K Construction of point mutant strains

[0071] pKSU-0005-ccpA was constructed according to the method in Example 5. E150K The plasmid was constructed using primer pairs BS0005-1f / 1r and BS0005-2f / 2r. The nucleotide and amino acid sequences of the corresponding ORF frames are shown in SEQ ID NO:12 and SEQ ID NO:13, respectively. The strain obtained was named B. subtilis A0005.

[0072] Example 7: CCPA in Bacillus subtilis L205P Construction of point mutant strains

[0073] pKSU-0006-ccpA was constructed according to the method in Example 5. L205P The plasmid was constructed using primer pairs BS0006-1f / 1r and BS0006-2f / 2r. The nucleotide and amino acid sequences of the corresponding ORF frames are shown in SEQ ID NO:14 and SEQ ID NO:15, respectively. The strain obtained was named B. subtilis A0006.

[0074] Example 8 Construction of strain with weakened ccpA start codon

[0075] pKSU-0007-ccpA was constructed according to the method in Example 5. ttg The plasmid was constructed using primer pairs BS0007-1f / 1r and BS0007-2f / 2r. The nucleotide and amino acid sequences of the corresponding ORF frames are shown in SEQ ID NO:16 and SEQ ID NO:17, respectively. The strain obtained was named B. subtilis A0007.

[0076] Example 9: Verification of Glycoside Production Performance of Mutant Strains

[0077] 1. Incubate the bacterial strain preserved in glycerol at 37°C overnight and cut out single clones.

[0078] 2. Pick a single colony and inoculate it into 30 mL of seed culture medium (20 g / L glucose, 5 g / L yeast powder, 5 g / L corn steep liquor powder, 3 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.02 g / L ferrous sulfate, 0.01 g / L manganese sulfate, pH 7.0-7.2), shake at 110 rpm, and incubate at 37°C for 7-8 h.

[0079] 3. Transfer the inoculum at a rate of 10% v / v to 30 ml of fermentation medium (120 g / L glucose, 3.5 g / L yeast extract, 3 g / L potassium dihydrogen phosphate, 25 g / L ammonium sulfate, 0.01 g / L manganese sulfate, 5 g / L magnesium sulfate, 10 g / L monosodium glutamate, 15 g / L corn steep liquor powder, 25 g / L calcium carbonate, pH 7.0–7.2), and incubate at 35°C for 70 h using a shaker at 130 rpm.

[0080] 4. The glycosides produced in the fermentation broth were detected using liquid chromatography (Table 2).

[0081] Table 2. Evaluation results of guanosine and inosine production by the mutant strain during shake-flask fermentation (mean of three replicates)

[0082]

[0083]

[0084] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> Recombinant bacteria producing nucleosides and their derivatives, their construction methods and applications <130> KHP221113209.1 <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1005 <212> DNA <213> Artificial Sequence <400> 1 gtgagcaaca ttacgatata cgatgtggcc agagaagcaa atgtcagcat ggcgactgtt 60 tcccgcgtcg taaacggcaa tccgaatgta aaaccgacga ccagaaaaaa agtattggaa 120 gccattgacc gcctcggcta ccgcccgaac gcggtggcaa gaggactggc aagcaaaaaa 180 acgactacgg tcggcgtcat catccctgat atctcaagta ttttttacgc ggaacttgcg 240 cggggaattg aagatatcgc gacgatgtac aaatataata ttatgttaag caattcagac 300 caaaatctcg agaaggaact gcacctgtta aatacgatgc tcggtaaaca agtagacggt 360 atcgtattta tgggcggcaa cattacggac gagcatgtcg aagaatttaa gcgctctccc 420 gttccgatcg tattggctgc gtcagttgaa gaacagggcg agacgccttc tgtcgccatt 480 gattatgaac aggcgattta tgatgccgtc aagcttttca ttgataaggg gcatcgcgat 540 atcgcatttg tctccggacc gatggcagag ccgatcaacc gttcgaaaaa actgcaaggg 600 tacaaacggg cgcttgaaga agcgggcatt gcgtttaacg agcagttcgt ggcggaaggc 660 gattacacct atgattccgg gatggaggcg cttcaaagct tgatgggcct tgaccggaaa 720 ccgacggcga tcctttctgc gacggatgaa atggctctcg gcattattca tgcggcccag 780 gatcagggta tgtcgattcc tgacgatctt gacattatcg gttttgacaa tacgagattg 840 agcctgatgg tccgccctca gctttcaaca gtcgtgcagc ctacgtacga tatcggcgcc 900 gtggcgatga gacttttgac aaaactgatg aacaaagagc cggttgaaga gcatatcgtt 960 gaattgcctc accgcatcga attaagacaa tcaaccaagt cataa 1005 <210> 2 <211> 334 <212> PRT <213> Artificial Sequence <400> 2 Val Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Asp Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ala Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Met Leu 85 90 95 Ser Asn Ser Asp Gln Asn Leu Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Glu Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Gly Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Phe Ile Asp Lys 165 170 175 Gly His Arg Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Gly Ile Ala Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Met Glu Ala Leu Gln Ser Leu Met Gly Leu Asp Arg Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Met Ser Ile Pro Asp Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Gln Ser Thr Lys Ser 325 330 <210> 3 <211> 1005 <212> DNA <213> Artificial Sequence <400> 3 gtgagcaaca ttacgatata cgatgtggcc agagaagcaa atgtcagcat ggcgactgtt 60 tcccgcgtcg taaacggcaa tccgaatgta aaaccgacga ccagaaaaaa agtattggaa 120 gccattgacc gcctcggcta ccgcccgaac gcggtggcaa gaggactggc aagcaaaaaa 180 acgactacgg tcggcgtcat catccctgat atctcaagta ttttttacgc ggaacttgcg 240 cggggaattg aagatatcgc gacgatgtac aaatataata ttattttaag caattcagac 300 caaaatctcg agaaggaact gcacctgtta aatacgatgc tcggtaaaca agtagacggt 360 atcgtattta tgggcggcaa cattacggac gagcatgtcg aagaatttaa gcgctctccc 420 gttccgatcg tattggctgc gtcagttaaa gaacagggcg agacgccttc tgtcgccatt 480 gattatgaac aggcgattta tgatgccgtc aagcttttca ttgataaggg gcatcgcgat 540 atcgcatttg tctccggacc gatggcagag ccgatcaacc gttcgaaaaa actgcaaggg 600 tacaaacggg cgcttgaaga agcgggcatt gcgtttaacg agcagttcgt ggcggaaggc 660 gattacacct atgattccgg gatggaggcg cttcaaagct tgatgggcct tgaccggaaa 720 ccgacggcga tcctttctgc gacggatgaa atggctctcg gcattattca tgcggcccag 780 gatcagggta tgtcgattcc tgacgatctt gacattatcg gttttgacaa tacgagattg 840 agcctgatgg tccgccctca gctttcaaca gtcgtgcagc ctacgtacga tatcggcgcc 900 gtggcgatga gacttttgac aaaactgatg aacaaagagc cggttgaaga gcatatcgtt 960 gaattgcctc accgcatcga attaagacaa tcaaccaagt cataa 1005 <210> 4 <211> 334 <212> PRT <213> Artificial Sequence <400> 4 Val Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Asp Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ala Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Leu Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Glu Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Lys Glu Gln Gly Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Phe Ile Asp Lys 165 170 175 Gly His Arg Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Gly Ile Ala Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Met Glu Ala Leu Gln Ser Leu Met Gly Leu Asp Arg Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Met Ser Ile Pro Asp Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Gln Ser Thr Lys Ser 325 330 <210> 5 <211> 1005 <212> DNA <213> Artificial Sequence <400> 5 gtgagcaaca ttacgatata cgatgtggcc agagaagcaa atgtcagcat ggcgactgtt 60 tcccgcgtcg taaacggcaa tccgaatgta aaccgacga ccagaaaaaa agtattggaa 120 gccattgacc gcctcggcta ccgcccgaac gcggtggcaa gaggactggc aagcaaaaaa 180 acgactacgg tcggcgtcat catccctgat atctcaagta tttttacgc ggaacttgcg 240 cggggaattg aagatatcgc gacgatgtac aatataata ttattttag cattcagac 300 caaaatctcg agaggaact gcacctgtta atacgatgc tcggtaaaca agtagacggt 360 atcgtattta tgggcggca cattacggac gagcatgtcg aagaatttaa gcgctctccc 420 gttccgatcg tattggctgc gtcagttgaa gaacaggggcg agacgccttc tgtcgccatt 480 gattatgaac aggcgattta tgatgccgtc aagctttca ttgataaggg gcatcgcgat 540 atcgcattg tctccggacc gatggcagag ccgatcaacc gttcgaaaa actgcaaggg 600 tacaaacgggg cgcctgaaga agcggcatt gcgtttaacg agcagttcgt ggcggaaggc 660 gattacacct atgattccgg gatggaggcg cttcaagct tgatgggcct tgaccggaa 720 ccgacggcga tcctttctgc gacggatgaa atggctctcg gcattattca tgcggcccag 780 gatcagggta tgtcgattcc tgacgatctt gacattatcg gttttgacaa tacgagattg 840 agcctgatgg tccgccctca gctttcaaca gtcgtgcagc ctacgtacga tatcggcgcc 900 gtggcgatga gacttttgac aaaactgatg aacaaagagc cggttgaaga gcatatcgtt 960 gaattgcctc accgcatcga attaagacaa tcaaccaagt cataa 1005 <210> 6 <211> 334 <212> PRT <213> Artificial Sequence <400> 6 Val Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Asp Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ala Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Leu Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Glu Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Gly Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Phe Ile Asp Lys 165 170 175 Gly His Arg Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Pro Glu Glu Ala 195 200 205 Gly Ile Ala Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Met Glu Ala Leu Gln Ser Leu Met Gly Leu Asp Arg Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Met Ser Ile Pro Asp Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Gln Ser Thr Lys Ser 325 330 <210> 7 <211> 1005 <212> DNA <213> Artificial Sequence <400> 7 ttgagcaaca ttacgatata cgatgtggcc agagaagcaa atgtcagcat ggcgactgtt 60 tcccgcgtcg taaacggcaa tccgaatgta aaaccgacga ccagaaaaaa agtattggaa 120 gccattgacc gcctcggcta ccgcccgaac gcggtggcaa gaggactggc aagcaaaaaa 180 acgactacgg tcggcgtcat catccctgat atctcaagta ttttttacgc ggaacttgcg 240 cggggaattg aagatatcgc gacgatgtac aaatataata ttatttaag caattcagac 300 caaaatctcg agaaggaact gcacctgtta aatacgatgc tcggtaaaca agtagacggt 360 atcgtattta tgggcggcaa cattacggac gagcatgtcg aagaatttaa gcgctctccc 420 gttccgatcg tattggctgc gtcagttaaa gaacagggcg agacgcttc tgtcgccatt 480 gattatgaac aggcgattta tgatgccgtc aagcttttca ttgataaggg gcatcgcgat 540 atcgcatttg tctccggacc gatggcagag ccgatcaacc gttcgaaaaa actgcaaggg 600 tacaaacggg cgcttgaaga agcgggcatt gcgtttaacg agcagttcgt ggcggaaggc 660 gattacacct atgattccgg gatggaggcg cttcaaagct tgatgggcct tgaccggaaa 720 ccgacggcga tcctttctgc gacggatgaa atggctctcg gcattattca tgcggcccag 780 gatcaggta tgtcgattcc tgacgatctt gacattatcg gttttgacaa tacgagattg 840 agcctgatgg tccgccctca gctttcaaca gtcgtgcagc ctacgtacga tatcggcgcc 900 gtggcgatga gacttttgac aaaactgatg aacaaagagc cggttgaaga gcatatcgtt 960 gaattgcctc accgcatcga attaagacaa tcaaccaagt cataa 1005 <210> 8 <211> 334 <212> PRT <213> Artificial Sequence <400> 8 Leu Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Asp Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ala Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Leu Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Glu Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Lys Glu Gln Gly Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Phe Ile Asp Lys 165 170 175 Gly His Arg Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Gly Ile Ala Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Met Glu Ala Leu Gln Ser Leu Met Gly Leu Asp Arg Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Met Ser Ile Pro Asp Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Gln Ser Thr Lys Ser 325 330 <210> 9 <211> 334 <212> PRT <213> Bacillus amyloliquefaciens <400> 9 Val Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Asp Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ala Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Leu Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Glu Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Gly Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Phe Ile Asp Lys 165 170 175 Gly His Arg Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Gly Ile Ala Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Met Glu Ala Leu Gln Ser Leu Met Gly Leu Asp Arg Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Met Ser Ile Pro Asp Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Gln Ser Thr Lys Ser 325 330 <210> 10 <211> 1005 <212> DNA <213> Artificial Sequence <400> 10 atgagcaata ttacgatcta cgatgtagcg agagaagcta atgtaagcat ggcaaccgtt 60 tcccgtgtcg tgaacggcaa cccgaatgta aaaccgacaa cgaggaaaaa agtcttggaa 120 gccattgaac gtctcggtta ccgtccaaac gcggtggcaa gagggctggc aagtaaaaaa 180 acaacaactg taggtgtcat cattcccgat atctcaagca ttttctattc agagcttgcg 240 cgcggaattg aagatatcgc gacaatgtat aaatacaata ttatgttgag caactctgac 300 caaaacatgg agaaagagct gcacttgtta aacacaatgc tcggcaaaca agtggacggc 360 atcgtgttta tgggcggaaa cattacggac gagcatgtgg cggaatttaa gcgttctcca 420 gtgccgattg tacttgccgc ttctgtagaa gagcaggagg aaacaccgtc agtcgctatc 480 gattacgaac aggcgattta tgatgccgtg aagctttttgg ttgataaagg acatacagac 540 atcgcgtcg ttccggacc aatggcagaa ccgatcaacc gttcgaaaaa actccaaggc 600 tacaaacgtg cgcttgaaga agcgaacctt ccgtttaatg aacaatttgt agctgaaggg 660 gattacacat atgattccgg actcgaagca ctgcagcatc tgatgagcct ggataaaaaa 720 ccgacagcca ttctttctgc aactgatgaa atggcactcg gcattatcca tgccgctcag 780 gatcagggct tatccattcc ggaggatctc gacattatcg gttttgataa tacaagatta 840 agcctcatgg ttcgtcctca gctttcaaca gttgttcagc cgacatatga tatcggcgcc 900 gttgcgatga gactgctgac gaagctcatg aataaagagc cggttgaaga gcatatcgtc 960 gaactgccgc accgtataga gcttagaaag tcaaccaagt cataa 1005 <210> 11 <211> 334 <212> PRT <213> Artificial Sequence <400> 11 Met Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Glu Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ser Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Met Leu 85 90 95 Ser Asn Ser Asp Gln Asn Met Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Ala Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Glu Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Leu Val Asp Lys 165 170 175 Gly His Thr Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Asn Leu Pro Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Leu Glu Ala Leu Gln His Leu Met Ser Leu Asp Lys Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Leu Ser Ile Pro Glu Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Lys Ser Thr Lys Ser 325 330 <210> 12 <211> 1005 <212> DNA <213> Artificial Sequence <400> 12 atgagcaata ttacgatcta cgatgtagcg agagaagcta atgtaagcat ggcaaccgtt 60 tcccgtgtcg tgaacggcaa cccgaatgta aaaccgacaa cgaggaaaaa agtcttggaa 120 gccattgaac gtctcggtta ccgtccaaac gcggtggcaa gagggctggc aagtaaaaaa 180 acaacaactg taggtgtcat cattcccgat atctcaagca ttttctattc agagcttgcg 240 cgcggaattg aagatatcgc gacaatgtat aaatacaata ttattttgag caactctgac 300 caaaacatgg agaaagagct gcacttgtta aacacaatgc tcggcaaaca agtggacggc 360 atcgtgttta tgggcggaaa cattacggac gagcatgtgg cggaatttaa gcgttctcca 420 gtgccgattg tacttgccgc ttctgtaaaaa gagcaggagg aaacaccgtc agtcgctatc 480 gattacgaac aggcgattta tgatgccgtg aagctttttgg ttgataaagg acatacagac 540 atcgcgtcg ttccggacc aatggcagaa ccgatcaacc gttcgaaaaa actccaaggc 600 tacaaacgtg cgcttgaaga agcgaacctt ccgtttaatg aacaatttgt agctgaaggg 660 gattacacat atgattccgg actcgaagca ctgcagcatc tgatgagcct ggataaaaaa 720 ccgacagcca ttctttctgc aactgatgaa atggcactcg gcattatcca tgccgctcag 780 gatcagggct tatccattcc ggaggatctc gacattatcg gttttgataa tacaagatta 840 agcctcatgg ttcgtcctca gctttcaaca gttgttcagc cgacatatga tatcggcgcc 900 gttgcgatga gactgctgac gaagctcatg aataaagagc cggttgaaga gcatatcgtc 960 gaactgccgc accgtataga gcttagaaag tcaaccaagt cataa 1005 <210> 13 <211> 334 <212> PRT <213> Artificial Sequence <400> 13 Met Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Glu Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ser Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Met Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Ala Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Lys Glu Gln Glu Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Leu Val Asp Lys 165 170 175 Gly His Thr Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Asn Leu Pro Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Leu Glu Ala Leu Gln His Leu Met Ser Leu Asp Lys Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Leu Ser Ile Pro Glu Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Lys Ser Thr Lys Ser 325 330 <210> 14 <211> 1005 <212> DNA <213> Artificial Sequence <400> 14 atgagcaata ttacgatcta cgatgtagcg agagaagcta atgtaagcat ggcaaccgtt 60 tcccgtgtcg tgaacggcaa cccgaatgta aaaccgacaa cgaggaaaaa agtcttggaa 120 gccattgaac gtctcggtta ccgtccaaac gcggtggcaa gagggctggc aagtaaaaaa 180 acaacaactg taggtgtcat cattcccgat atctcaagca ttttctattc agagcttgcg 240 cgcggaattg aagatatcgc gacaatgtat aaatacaata ttattttgag caactctgac 300 caaaacatgg agaaagagct gcacttgtta aacacaatgc tcggcaaaca agtggacggc 360 atcgtgttta tgggcggaaa cattacggac gagcatgtgg cggaatttaa gcgttctcca 420 gtgccgattg tacttgccgc ttctgtagaa gagcaggagg aaacaccgtc agtcgctatc 480 gattacgaac aggcgattta tgatgccgtg aagcttttgg ttgataaagg acatacagac 540 atcgcgttcg tttccggacc aatggcagaa ccgatcaacc gttcgaaaaa actccaaggc 600 tacaaacgtg cgcctgaaga agcgaacctt ccgtttaatg aacaatttgt agctgaaggg 660 gattacacat atgattccgg actcgaagca ctgcagcatc tgatgagcct ggataaaaaa 720 ccgacagcca ttctttctgc aactgatgaa atggcactcg gcattatcca tgccgctcag 780 gatcagggct tatccattcc ggaggatctc gacattatcg gttttgataa tacaagatta 840 agcctcatgg ttcgtcctca gctttcaaca gttgttcagc cgacatatga tatcggcgcc 900 gttgcgatga gactgctgac gaagctcatg aataaagagc cggttgaaga gcatatcgtc 960 gaactgccgc accgtataga gcttagaaag tcaaccaagt cataa 1005 <210> 15 <211> 334 <212> PRT <213> Artificial Sequence <400> 15 Met Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Glu Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ser Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Met Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Ala Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Glu Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Leu Val Asp Lys 165 170 175 Gly His Thr Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Pro Glu Glu Ala 195 200 205 Asn Leu Pro Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Leu Glu Ala Leu Gln His Leu Met Ser Leu Asp Lys Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Leu Ser Ile Pro Glu Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Lys Ser Thr Lys Ser 325 330 <210> 16 <211> 1005 <212> DNA <213> Artificial Sequence <400> 16 ttgagcaata ttacgatcta cgatgtagcg agagaagcta atgtaagcat ggcaaccgtt 60 tcccgtgtcg tgaacggcaa cccgaatgta aaaccgacaa cgaggaaaaa agtcttggaa 120 gccattgaac gtctcggtta ccgtccaaac gcggtggcaa gagggctggc aagtaaaaaa 180 acaacaactg taggtgtcat cattcccgat atctcaagca ttttctattc agagcttgcg 240 cgcggaattg aagatatcgc gacaatgtat aaatacaata ttattttgag caactctgac 300 caaaacatgg agaaagagct gcacttgtta aacacaatgc tcggcaaaca agtggacggc 360 atcgtgttta tgggcggaaa cattacggac gagcatgtgg cggaatttaa gcgttctcca 420 gtgccgattg tacttgccgc ttctgtagaa gagcaggagg aaacaccgtc agtcgctatc 480 gattacgaac aggcgattta tgatgccgtg aagcttttgg ttgataaagg acatacagac 540 atcgcgttcg tttccggacc aatggcagaa ccgatcaacc gttcgaaaaa actccaaggc 600 tacaaacgtg cgcttgaaga agcgaacctt ccgtttaatg aacaatttgt agctgaaggg 660 gattacacat atgattccgg actcgaagca ctgcagcatc tgatgagcct ggataaaaaa 720 ccgacagcca ttctttctgc aactgatgaa atggcactcg gcattatcca tgccgctcag 780 gatcagggct tatccattcc ggaggatctc gacattatcg gttttgataa tacaagatta 840 agcctcatgg ttcgtcctca gctttcaaca gttgttcagc cgacatatga tatcggcgcc 900 gttgcgatga gactgctgac gaagctcatg aataaagagc cggttgaaga gcatatcgtc 960 gaactgccgc accgtataga gcttagaaag tcaaccaagt cataa 1005 <210> 17 <211> 334 <212> PRT <213> Artificial Sequence <400> 17 Leu Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Glu Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ser Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Met Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Ala Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Glu Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Leu Val Asp Lys 165 170 175 Gly His Thr Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Asn Leu Pro Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Leu Glu Ala Leu Gln His Leu Met Ser Leu Asp Lys Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Leu Ser Ile Pro Glu Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Lys Ser Thr Lys Ser 325 330 <210> 18 <211> 334 <212> PRT <213> Bacillus subtilis <400> 18 Met Ser Asn Ile Thr Ile Tyr Asp Val Ala Arg Glu Ala Asn Val Ser 1 5 10 15 Met Ala Thr Val Ser Arg Val Val Asn Gly Asn Pro Asn Val Lys Pro 20 25 30 Thr Thr Arg Lys Lys Val Leu Glu Ala Ile Glu Arg Leu Gly Tyr Arg 35 40 45 Pro Asn Ala Val Ala Arg Gly Leu Ala Ser Lys Lys Thr Thr Thr Val 50 55 60 Gly Val Ile Ile Pro Asp Ile Ser Ser Ile Phe Tyr Ser Glu Leu Ala 65 70 75 80 Arg Gly Ile Glu Asp Ile Ala Thr Met Tyr Lys Tyr Asn Ile Ile Leu 85 90 95 Ser Asn Ser Asp Gln Asn Met Glu Lys Glu Leu His Leu Leu Asn Thr 100 105 110 Met Leu Gly Lys Gln Val Asp Gly Ile Val Phe Met Gly Gly Asn Ile 115 120 125 Thr Asp Glu His Val Ala Glu Phe Lys Arg Ser Pro Val Pro Ile Val 130 135 140 Leu Ala Ala Ser Val Glu Glu Gln Glu Glu Thr Pro Ser Val Ala Ile 145 150 155 160 Asp Tyr Glu Gln Ala Ile Tyr Asp Ala Val Lys Leu Leu Val Asp Lys 165 170 175 Gly His Thr Asp Ile Ala Phe Val Ser Gly Pro Met Ala Glu Pro Ile 180 185 190 Asn Arg Ser Lys Lys Leu Gln Gly Tyr Lys Arg Ala Leu Glu Glu Ala 195 200 205 Asn Leu Pro Phe Asn Glu Gln Phe Val Ala Glu Gly Asp Tyr Thr Tyr 210 215 220 Asp Ser Gly Leu Glu Ala Leu Gln His Leu Met Ser Leu Asp Lys Lys 225 230 235 240 Pro Thr Ala Ile Leu Ser Ala Thr Asp Glu Met Ala Leu Gly Ile Ile 245 250 255 His Ala Ala Gln Asp Gln Gly Leu Ser Ile Pro Glu Asp Leu Asp Ile 260 265 270 Ile Gly Phe Asp Asn Thr Arg Leu Ser Leu Met Val Arg Pro Gln Leu 275 280 285 Ser Thr Val Val Gln Pro Thr Tyr Asp Ile Gly Ala Val Ala Met Arg 290 295 300 Leu Leu Thr Lys Leu Met Asn Lys Glu Pro Val Glu Glu His Ile Val 305 310 315 320 Glu Leu Pro His Arg Ile Glu Leu Arg Lys Ser Thr Lys Ser 325 330

Claims

1. A modified microorganism, characterized in that, Compared to unmodified microorganisms, the modified microorganisms exhibit reduced activity of the global transcriptional regulator CcpA, and also demonstrate enhanced nucleoside production capacity compared to unmodified microorganisms. The unmodified microorganism is Bacillus subtilis (B. subtilis). Bacillus subtilis Bacillus subtilis A5 is disclosed in CN110257315B; The nucleosides are inosine and adenosine; The amino acid sequence of the wild-type global transcriptional regulator CcpA is shown in SEQ ID NO:

18. The reduction of activity of the global transcription factor CcpA is achieved through any of the following mechanisms (A-D): A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M; B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K; C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P; D. The start codon of the gene encoding the global transcriptional regulator CcpA is mutated from atg to ttg.

2. A modified microorganism, characterized in that, Compared to unmodified microorganisms, the modified microorganisms exhibit reduced activity of the global transcriptional regulator CcpA, and also demonstrate enhanced nucleoside production capacity compared to unmodified microorganisms. The unmodified microorganism is Bacillus amyloliquefaciens (BAM). Bacillus amyloliquefaciens ) 836; The Bacillus amyloliquefaciens 836 is disclosed in CN112574934A; The nucleosides are guanosine and inosine; The amino acid sequence of the wild-type global transcriptional regulator CcpA is shown in SEQ ID NO:9; The reduction in the activity of the global transcription factor CcpA is achieved through any of the following mechanisms (A through C): A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M; B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K; C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P.

3. A method for constructing a recombinant nucleoside-producing bacterium, characterized in that, Using genetic engineering techniques, the gene encoding CcpA, a global transcriptional regulator, was weakened in microorganisms capable of nucleoside production. The microorganism is Bacillus subtilis ( Bacillus subtilis Bacillus subtilis A5 is disclosed in CN110257315B; The nucleosides are inosine and adenosine; The weakening is achieved through any of the following methods A through D: A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M; B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K; C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P; D. The start codon of the gene encoding the global transcriptional regulator CcpA is mutated from atg to ttg; The amino acid sequence of the wild-type global transcriptional regulator CcpA is shown in SEQ ID NO:

18.

4. A method for constructing a recombinant nucleoside-producing bacterium, characterized in that, Using genetic engineering techniques, the gene encoding CcpA, a global transcriptional regulator, was weakened in microorganisms capable of nucleoside production. The microorganism is Bacillus amyloliquefaciens (Bacillus amyloliquefaciens). Bacillus amyloliquefaciens ) 836; The Bacillus amyloliquefaciens 836 is disclosed in CN112574934A; The nucleosides are guanosine and inosine; The weakening is achieved through any of the following methods A through C: A. The 95th amino acid of the global transcriptional regulator CcpA is mutated from I to M; B. The 150th amino acid of the global transcriptional regulator CcpA is mutated from E to K; C. The 205th amino acid of the global transcriptional regulator CcpA is mutated from L to P; The amino acid sequence of the wild-type global transcriptional regulator CcpA is shown in SEQ ID NO:

9.

5. The recombinant bacteria constructed according to the method of claim 3.

6. The recombinant bacteria constructed according to the method of claim 4.

7. The application of the modified microorganism of claim 1 or the recombinant bacteria of claim 5 in the fermentation production of nucleosides or in increasing the fermentation yield of nucleosides; The nucleosides are inosine and adenosine.

8. The application of the modified microorganism of claim 2 or the recombinant bacteria of claim 6 in the fermentation production of nucleosides or in increasing the fermentation yield of nucleosides; The nucleosides are guanosine and inosine.

9. A method for producing nucleosides, characterized in that, The method includes the following steps: a) Cultivate the modified microorganism of claim 1 or the recombinant bacteria of claim 5 to obtain a culture; b) Collect the resulting nucleosides from the culture obtained in step a); The nucleosides are inosine and adenosine.

10. A method for producing nucleosides, characterized in that, The method includes the following steps: a) Cultivate the modified microorganism of claim 2 or the recombinant bacteria of claim 6 to obtain a culture; b) Collect the resulting nucleosides from the culture obtained in step a); The nucleosides are guanosine and inosine.

Images