A molecular marker for identifying xinyang no. 10 tea tree, a primer and application thereof
By using SSR molecular marker technology and specific primers to perform PCR amplification and electrophoresis detection of the genomic location of the Xinyang No. 10 tea variety, the problems of accuracy and efficiency in tea variety identification were solved, and rapid and accurate identification was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XINYANG NORMAL UNIVERSITY
- Filing Date
- 2023-08-29
- Publication Date
- 2026-08-04
AI Technical Summary
Existing technologies make it difficult to accurately identify the superior tea variety Xinyang No. 10. The phenotypic and physicochemical properties of tea trees are easily affected by the environment, resulting in large identification errors and long cycles.
Simple sequence repeat (SSR) molecular marker technology was used to design specific primer pairs for PCR amplification of the genomic location Chr3:10960343-10960380 of Xinyang No. 10 tea variety, and the electrophoretic bands were detected by polyacrylamide gel electrophoresis.
It enables rapid and accurate identification of the Xinyang No. 10 tea tree variety, improving identification efficiency and accuracy.
Smart Images

Figure CN117165705B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and in particular to a molecular marker, primer, and their application for identifying the Xinyang No. 10 tea variety. Background Technology
[0002] Tea plant phenotypic and physicochemical traits are mostly quantitative traits, easily influenced by the environment, making it difficult to identify tea plant germplasm based solely on phenotypic and physicochemical traits. DNA molecular markers, based on DNA sequence variations, offer advantages such as a large number of markers, independence from developmental influences, and simple and rapid detection methods. They overcome the disadvantages of identification based on phenotypic and physicochemical components, including large errors, small differences in tea plant phenotypic traits, and long identification cycles. Simple sequence repeat (SSR) molecular marker technology has been widely applied in tea germplasm resource identification, genetic diversity analysis, genetic map construction, quantitative trait locus (QTL) localization, and DNA fingerprinting.
[0003] Xinyang No. 10 (XY10) is a superior tea variety bred in 1976 by the Xinyang Tea Experiment Station from the Xinyang tea population through a single-plant selection system. This variety is a shrub type, medium-leaf, mid-growing species with a semi-spreading growth habit. It boasts high quality, high yield, and strong resistance, making it suitable for cultivation in Henan Province. It is a core germplasm resource for tea production and tea germplasm genetic improvement in Henan. Effective identification of the XY10 superior variety is crucial for tea germplasm innovation and the effective protection of the "XY10" superior variety. Therefore, a method for accurately identifying the Xinyang No. 10 tea variety is urgently needed in this field. Summary of the Invention
[0004] The purpose of this invention is to provide a molecular marker, primer, and its application that can accurately identify the Xinyang No. 10 tea variety.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides a molecular marker for identifying the superior variety of Xinyang No. 10 tea tree. The molecular marker is located at Chr3: 10960343-10960380 of the Shuchazao genome, and the sequence of the molecular marker is shown in SEQ ID NO. 2.
[0007] The present invention provides primers for amplifying the molecular marker, the forward primer sequence being shown in SEQ ID NO.3 and the reverse primer sequence being shown in SEQ ID NO.4.
[0008] This invention provides a kit for identifying the superior variety of Xinyang No. 10 tea tree, which contains the aforementioned primers.
[0009] This invention provides the application of the described molecular marker, primer, or kit in identifying the Xinyang No. 10 tea variety.
[0010] This invention also provides a method for identifying the superior variety of Xinyang No. 10 tea tree, comprising the following steps:
[0011] (1) Extract genomic DNA from tea plants as a template;
[0012] (2) The template was amplified by PCR using the primers described above to obtain the amplification product;
[0013] (3) The amplification product is subjected to polyacrylamide gel electrophoresis to obtain electrophoretic bands. If the band pattern of the electrophoretic band is consistent with that of Xinyang 10, the germplasm is identified as Xinyang 10.
[0014] Preferably, the method for extracting tea plant genomic DNA in step (1) is the modified CTAB method.
[0015] Preferably, the PCR amplification system comprises: 4.41–5.39 μL ddH2O, 0.90–1.10 μL 10×Buffer, 0.18–0.22 μL 10 mM dNTP, 0.36–0.44 μL 10 μM forward primer, 0.36–0.44 μL 10 μM reverse primer, 2.70–3.30 μL 30 ng / μL template, and 0.09–0.11 μL 5 U / μL Taq enzyme, with a total reaction volume of 10 μL.
[0016] The PCR amplification reaction program is as follows: pre-denaturation at 94℃ for 5 min; then enter the cycle, denaturation at 94℃ for 30 s, annealing at 55-65℃ for 45 s, extension at 72℃ for 1 min in each cycle, for a total of 29 cycles, and finally extension at 72℃ for 5 min.
[0017] Preferably, the voltage for the polyacrylamide gel electrophoresis is 155-160V, and the time is 2.5-3.5h.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] This invention uses an SSR molecular marker and primers to detect tea germplasm DNA samples to determine whether the germplasm is Xinyang 10, which is convenient, fast and efficient. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0021] Figure 1 The results are from the electrophoresis detection in Example 1;
[0022] Figure 2 The results are from the electrophoresis detection in Example 1;
[0023] Figure 3 The results are from the electrophoresis detection in Example 1;
[0024] Figure 4 The results are the electrophoresis detection results in Example 1. The bands YLC\XMTC\ZYQC\YLTC are the results of PCR amplification after mixing the DNA of four tea germplasm samples YLC, XMTC, ZYQC, and YLTC. The bands JGZSDYC\XPC\YJC are the results of PCR amplification after mixing the DNA of three tea germplasm samples JGZSDYC, XPC, and YJC. Detailed Implementation
[0025] This invention provides a molecular marker for identifying the superior variety of Xinyang No. 10 tea tree. The molecular marker is located at Chr3: 10960343-10960380 of the Shuchazao genome, and the sequence of the molecular marker is shown in SEQ ID NO. 2.
[0026] The present invention provides primers for amplifying the molecular marker, the forward primer sequence being shown in SEQ ID NO.3 and the reverse primer sequence being shown in SEQ ID NO.4.
[0027] This invention provides a kit for identifying the superior variety of Xinyang No. 10 tea tree, which contains the aforementioned primers.
[0028] This invention provides the application of the described molecular marker, primer, or kit in identifying the Xinyang No. 10 tea variety.
[0029] This invention also provides a method for identifying the superior variety of Xinyang No. 10 tea tree, comprising the following steps:
[0030] (1) Extract genomic DNA from tea plants as a template;
[0031] (2) The template was amplified by PCR using the primers described above to obtain the amplification product;
[0032] (3) The amplification product is subjected to polyacrylamide gel electrophoresis to obtain electrophoretic bands. If the band pattern of the electrophoretic band is consistent with that of Xinyang 10, the germplasm is identified as Xinyang 10.
[0033] Preferably, the method for extracting tea plant genomic DNA in step (1) is the modified CTAB method.
[0034] In this invention, the PCR amplification system comprises: 4.41–5.39 μL ddH2O, 0.90–1.10 μL 10×Buffer, 0.18–0.22 μL 10 mM dNTPs, 0.36–0.44 μL 10 μM forward primer, 0.36–0.44 μL 10 μM reverse primer, 2.70–3.30 μL 30 ng / μL template, and 0.09–0.11 μL 5 U / μL Taq enzyme, with a total reaction volume of 10 μL. The preferred PCR amplification system comprises: 4.90 μL ddH2O, 1.00 μL 10×Buffer, 0.2 μL 10 mM dNTPs, 0.4 μL 10 μM forward primer, 0.4 μL 10 μM reverse primer, 3.00 μL 30 ng / μL template, and 5 U / μL Taq enzyme. Taq enzyme 0.10 μL, total reaction volume 10 μL.
[0035] In this invention, the PCR amplification reaction program is as follows: pre-denaturation at 94℃ for 5 min; then entering the cycle, each cycle denaturation at 94℃ for 30 s, annealing at 55-65℃ for 45 s, extension at 72℃ for 1 min, for a total of 29 cycles, and finally extension at 72℃ for 5 min.
[0036] This invention uses 10% or 12% polyacrylamide gel for electrophoretic detection.
[0037] In this invention, the voltage of the polyacrylamide gel electrophoresis is 155-160V, preferably 158-160V, more preferably 160V, and the time is 2.5-3.5h, preferably 2.8-3.2h, more preferably 3h.
[0038] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0039] Example 1
[0040] 1) Experimental materials
[0041] In this embodiment, 189 tea germplasm accessions were selected as experimental materials, as shown in Tables 1 and 2. Among them, accessions 1-90 (90 in total) came from the Guohe Germplasm Resource Nursery of Anhui Agricultural University; accessions 91-160 (70 in total) came from the tea resource nursery of Xiangyun Tea Co., Ltd. in Xinyang City, Henan Province; accessions 161-176 (16 in total) came from Yunnan Province; accessions 177-183 (7 in total) came from Xinyang Academy of Agricultural Sciences in Henan Province; and accessions 184-189 (6 in total) came from Shihe District, Xinyang City, Henan Province.
[0042] Table 1. Tea Tree Germplasm Samples - 1
[0043]
[0044]
[0045] Table 2 Tea Tree Germplasm Samples - 2
[0046]
[0047]
[0048] 2) Experimental methods
[0049] 1. Development of SSR molecular markers and screening of SSR primers
[0050] Using the *Shuchazao* (SCZ) genome as a reference genome (https: / / doi.org / 10.1016 / j.molp.2020.04.010), SSRs in the SCZ genome were detected using MISA software (https: / / webblast.ipk-gatersleben.de / misa / ), and primers were designed using Primer3 software. A total of 1,604,517 SSRs were detected in the SCZ genome using MISA software, and 1,264,509 pairs of SSR marker primers were designed. Chromosome chr3 was randomly selected from the SCZ genome, and 672 pairs of SSR marker primers were randomly selected based on chromosome chr3. Primers were synthesized at General Biosystems (Anhui) Co., Ltd. ePCR amplification was performed on the SZC genome using 672 pairs of SSR primers. After removing SSR marker primers with many annealing sites and difficult genotyping, ePCR amplification was performed on the SCZ, Longjing 43 and DASZ genomes using the selected SSR primers. A total of 76 pairs of polymorphic SSR marker primers were screened in the three genomes.
[0051] Genotyping was performed on eight randomly selected tea germplasms [Anhui No. 1 (AH1), Baihaozao (BHZ), Fu'an Dabaicha (FADBC), Longjing Changye (LJCY), Nanjiang No. 1 (NJ1), Shangmeizhou (SMZ), Mingshan Baihao 131 (MSBH131), and Zaobaijian (ZBJ)] using 76 primer pairs selected from the screening. One pair of SSR primers with polymorphism and clear amplification bands was selected and named primer SCZSSR03.
[0052] The gene sequence at position Chr3: 10960193-10960530 in the SCZ genome is as SEQ ID Shown in NO.1 (GGACCTGAGCATTGACAAATCTGAAACCATGAAGGCTCTTGATGATGTTGGTGAGTTCTTGATGATCAATTCCACGTTCGGAAGCAAACTCACCTGAGTCTGAGATCTCATCATTCTTCTCGAGGAAGCCCAGTACAACTTCCTCCGCCATCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCCAAACCCTCTTATCCCCTTTCCACTAGGGTTTTGTAGTCTTAGATCAAAGCCCAAACACGTCGTTGATGATTTGGGTCGAAACCTGTAAACAGGGTTTGATGAGAACACTAAAACCGTAAGAATCAATACATTTGCCCCGTTTGGTAGAG). The molecular marker corresponding to the SCZSSR03 primer is located in Chr3:10960343-10960380 in the SCZ genome. The SSR repeat unit type is TC, repeated 19 times, and the SSR molecular marker size is 38 bp. The gene sequence of the SSR molecular marker is shown in SEQ ID NO.2 (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC). The forward primer sequence of the SCZSSR03 primer is shown in SEQ ID NO.3 (5'→3'ATCAATTCCACGTTCGGAAG), and the reverse primer sequence is shown in SEQ ID NO.4 (5'→3'CGGGGCAAATGTATTGATTC).
[0053] DNA was extracted from 189 tea germplasms in Table 1 and used as templates; the template DNA was amplified by PCR using SCZSSR03 primers to obtain amplification products; the amplification products were detected by polyacrylamide (12%) electrophoresis to obtain electrophoretic bands. The PCR amplification system consisted of: 4.90 μL ddH2O, 1.00 μL 10×Buffer, 0.2 μL 10 mM dNTP, 0.4 μL 10 μM forward primer, 0.4 μL 10 μM reverse primer, 3.00 μL 30 ng / μL template, and 0.10 μL 5 U / μL Taq enzyme, for a total reaction volume of 10 μL. The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min; followed by cycling, with each cycle consisting of denaturation at 94℃ for 30 s, annealing at 60℃ for 45 s, and extension at 72℃ for 1 min, for a total of 29 cycles, and a final extension at 72℃ for 5 min. Electrophoresis was performed at 160 V for 3 h.
[0054] Electrophoresis results as follows Figure 1-4 As shown. From Figure 1-4 It can be seen that the DNA banding pattern of Xinyang No. 10 is significantly different from that of the other 188 tea germplasms; except for 11 tea germplasms including SCZ(XY), XY10, ZBJ, XBL2, SBZ, TLC, JGQC, GKQC, CYSH, DPH, and XX21-3, which all have DNA band 1, the DNA banding patterns of the other 178 tea germplasms do not have DNA band 1. Except for BH, NZ2, GLC, and XPTC, the other 174 tea germplasms did not have DNA band 5. Among the 11 tea germplasms with DNA band 1, 6 germplasms (ZBJ, TLC, GKQC, GYSH, DPH, and XX21-3) did not have DNA band 4; 4 germplasms (SCZ(XY), XBL2, SBZ, and JGQT) did not have the DNA band pattern consisting of DNA bands 2 and 3. Therefore, the DNA of the tea germplasms was amplified using primers SCZSSR03, and based on... Figure 1 The five DNA bands marked with red arrows (1-5) can be used to identify and distinguish the Xinyang No. 10 tea variety from tea germplasm.
[0055] As can be seen from the above embodiments, the present invention provides a molecular marker, primer and its application for identifying the superior variety of tea tree Xinyang No. 10. It is convenient, fast and efficient to use a single molecular marker and primer to detect the DNA sample of tea germplasm.
[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of a primer pair for detecting molecular markers in identifying the superior tea variety Xinyang No. 10, characterized in that, The sequence of the molecular marker is shown in SEQ ID NO.2; The application includes the following steps: (1) Extract genomic DNA from the tea plant to be tested as a template; (2) The template was amplified by PCR using the primer pair to obtain the amplification product; (3) The amplification product is subjected to polyacrylamide gel electrophoresis to obtain electrophoretic bands. If the band pattern of the electrophoretic band is consistent with that of Xinyang No. 10, the tea tree to be tested is identified as Xinyang No.
10.
2. The application as described in claim 1, characterized in that, The forward primer sequence of the primer pair is shown in SEQ ID NO.3, and the reverse primer sequence of the primer pair is shown in SEQ ID NO.
4.
3. The application of a reagent kit for detecting molecular markers in identifying the superior tea variety Xinyang No. 10, characterized in that, The sequence of the molecular marker is shown in SEQ ID NO.2; the kit contains the primer pair as described in claim 2; The application includes the following steps: (1) Extract genomic DNA from the tea plant to be tested as a template; (2) The template was amplified by PCR using the primer pair to obtain the amplification product; (3) The amplification product is subjected to polyacrylamide gel electrophoresis to obtain electrophoretic bands. If the band pattern of the electrophoretic band is consistent with that of Xinyang No. 10, the tea tree to be tested is identified as Xinyang No.
10.
4. A method for identifying the superior variety of Xinyang No. 10 tea tree, characterized in that, Includes the following steps: (1) Extract genomic DNA from the tea plant to be tested as a template; (2) The template was amplified by PCR using the primer pair described in claim 2 to obtain the amplification product; (3) The amplification product is subjected to polyacrylamide gel electrophoresis to obtain electrophoretic bands. If the band pattern of the electrophoretic band is consistent with that of Xinyang No. 10, the tea tree to be tested is identified as Xinyang No.
10.
5. The method as described in claim 4, characterized in that, The method for extracting genomic DNA from the tea plant in step (1) is the modified CTAB method.
6. The method as described in claim 5, characterized in that, The PCR amplification system consisted of: 4.41–5.39 µL ddH2O, 0.90–1.10 µL 10×Buffer, 0.18–0.22 µL 10 mM dNTPs, 0.36–0.44 µL 10 μM forward primer, 0.36–0.44 µL 10 μM reverse primer, 2.70–3.30 µL 30 ng / µL template, and 0.09–0.11 µL 5 U / µL Taq enzyme, with a total reaction volume of 10 µL. The PCR amplification reaction program is as follows: pre-denaturation at 94℃ for 5 min; then enter the cycle, denaturation at 94℃ for 30 s, annealing at 55~65℃ for 45 s, extension at 72℃ for 1 min in each cycle, for a total of 29 cycles, and finally extension at 72℃ for 5 min.
7. The method as described in claim 6, characterized in that, The polyacrylamide gel electrophoresis was performed at a voltage of 155-160V for 2.5-3.5 hours.