A method for preparing cationic liposomes based on molecular beacons, products and uses thereof

Abstract

This invention discloses a method for preparing cationic liposomes based on molecular beacons, as well as the product and its applications. The preparation method includes the following steps: mixing a mixed solution containing 1,2-bis(octadecenoxy-3-methylammonium propane) (chloride), cholesterol, and distearate phosphatidylacetamide-polyethylene glycol with a molecular beacon solution, followed by sonication and dialysis purification. The resulting cationic liposomes exhibit uniform particle size, high encapsulation efficiency, and good particle size stability. This invention also explores relevant conditions for promoting liposome fusion. This invention applies the cationic liposome fusion-based method to the detection of microRNA (miRNA) in exosomes of acute myocardial infarction, providing a new approach for the detection of miRNA biomarkers in acute myocardial infarction and offering valuable reference for establishing new methods for the early diagnosis of acute myocardial infarction.

Description

Technical Field

[0001] This invention relates to a method for preparing molecular beacon-based cationic liposomes, as well as the products and applications thereof, belonging to the field of in vitro diagnostics. Background Technology

[0002] Acute myocardial infarction (AMI) is a serious disease that severely threatens human life and health. It is characterized by its rapid onset, rapid progression, high risk of complications, and high mortality rate, potentially leading to sudden death in some patients. Therefore, early diagnosis of AMI is crucial for saving lives, reducing mortality, and improving treatment outcomes. Electrocardiography (ECG) is currently the most widely used, intuitive, and effective tool for diagnosing AMI. However, ECG diagnosis itself has limitations and is often insufficient to diagnose acute myocardial ischemia or infarction. Clinically, it needs to be used in conjunction with the detection of cardiac markers in the patient's blood sample to ensure diagnostic accuracy. Traditional cardiac markers, such as cardiac troponin I (cTnI), have good specificity for AMI, but their release is delayed, starting 3–6 hours and peaking at 10–24 hours. This delayed release presents limitations in the time-sensitive nature of clinical diagnosis and treatment. Therefore, finding cardiac markers that release earlier, can be detected more quickly, are more accurate, have higher throughput, and are cost-effective is of great value for the early diagnosis of AMI.

[0003] Compared with traditional diagnostic methods such as electrocardiogram (ECG) and cTnI biomarkers, the exosome miRNA biomarker (miR-208a) can be detected earlier and has superior myocardial specificity. miR-208a is encoded by an intron of the α-myosin heavy chain (MHC) gene (MYH6) and is expressed only by cardiomyocytes. miR-208a significantly increases to detectable levels within 1–3 hours in the early stages of acute myocardial infarction (AMI), and its level is closely correlated with the levels of cTnI and CK-MB released in the infarcted area. However, miRNA detection often requires complex and cumbersome steps such as exosome extraction and lysis, followed by miRNA purification, reverse transcription, and amplification, which are time-consuming and labor-intensive, hindering rapid miRNA detection.

[0004] In recent years, liposome fusion technology has been applied to the detection of exosome contents. Liposomes possess high biocompatibility, are non-cytotoxic, non-immunogenic, and can effectively protect sensitive drugs from degradation during delivery. Surface modification of liposomes can achieve targeted delivery, increasing circulation time in the bloodstream and thus effectively improving drug metabolism kinetics. The delivery function is largely based on the membrane fusion of liposomes with target cells or exosomes. Currently, methods to promote the fusion of liposomes with other membrane materials mainly include freeze-thaw methods, extrusion methods, electrostatic interactions on membrane surfaces, and chemically mediated methods. Among these methods, electrostatic interactions on membrane surfaces and chemically mediated methods are simple to operate and do not damage the liposome membrane structure. Therefore, exploring effective fusion promoters and fusion methods is key to achieving rapid miRNA detection. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for preparing cationic liposomes based on molecular beacons, as well as a product with uniform size, positive surface charge, high encapsulation efficiency and good stability, and its application in the preparation of reagents for detecting acute myocardial infarction.

[0006] Technical Solution: To solve the above-mentioned technical problems, this invention provides a method for preparing cationic liposomes based on molecular beacons, comprising the following steps: mixing a mixed solution containing 1,2-bisoctadecenoxy-3-methylammonium propane (chloride), cholesterol, and distearate phosphatidylacetamide-polyethylene glycol with a molecular beacon solution, sonicating, and dialysis purification to obtain the cationic liposomes; the mixed solution is an ethanol mixture; the molecular beacon has a hairpin structure, the hairpin structure including a loop region specifically binding to the target molecule and two stem regions; the length of the loop region is 15-30 bases; the two stem regions are a quencher group modified at the 3' end and a fluorescent group modified at the 5' end, respectively.

[0007] The quenching group modified at the 3' end includes 6-carboxyfluorescein; the fluorescent group modified at the 5' end includes 4-((4-(dimethylamino)phenyl)azo)benzoic acid.

[0008] The molecular beacon is MB-208a, and its structure is as follows:

[0009] 5'(6-Carboxyfluorescein)-CGCGTAC ACAAGCTTTTTGCTCGTCTTAT GTACGCG-(4-((4-(dimethylamino)phenyl)azo)benzoic acid)3'.

[0010] The molar ratio of 1,2-bisoctadecenoxy-3-methylammonium propane (chloride), cholesterol, and distearylphosphatidylacetamide-polyethylene glycol is 49:49:2; the mass ratio of the sum of 1,2-bisoctadecenoxy-3-methylammonium propane (chloride), cholesterol, and distearylphosphatidylacetamide-polyethylene glycol to the MB-208a molecular beacon is 200:1.

[0011] The concentration of the molecular beacon solution was 100 μM.

[0012] The power of the ultrasound is 1.6 to 40 W; the duration of the ultrasound is 0 to 5 min.

[0013] The present invention also provides a molecular beacon-based cationic liposome prepared by the method described above.

[0014] The present invention also provides a detection reagent containing the aforementioned molecular beacon-based cationic liposomes.

[0015] It also contains DSN enzyme solution and PEG solution.

[0016] The molecular weight of the PEG is 6000 to 20000.

[0017] Preferably, the molecular weight of the PEG is 6000-10000, which can effectively promote the fusion of molecular beacons and target molecules.

[0018] Preferably, the molecular weight of the PEG is 8000 to 10000.

[0019] The mass concentration of the PEG solution is 10% w / v to 50% w / v.

[0020] Preferably, the mass concentration of the PEG solution is 30% w / v to 50% w / v.

[0021] The concentration of the DSN enzyme solution is 2 U / μL.

[0022] The present invention also provides the application of the aforementioned molecular beacon-based cationic liposomes or the aforementioned detection reagent in the preparation of a reagent for detecting acute myocardial infarction.

[0023] In this process, the molecular beacon-based cationic liposomes, DSN enzyme solution, and PEG solution are mixed and incubated with the test serum and normal human serum, respectively, and the fluorescence signal intensity at 518 nm is detected. When the fluorescence signal intensity of the test solution is higher than that of the normal human serum, it indicates that the person providing the test serum has acute myocardial infarction; when the fluorescence signal intensity of the test solution is not higher than that of the normal human serum, it indicates that the person providing the test serum does not have acute myocardial infarction.

[0024] The incubation temperature is 35℃~51℃; the incubation time is 0~60min.

[0025] The present invention also provides an anionic liposome encapsulating a target molecule, wherein the target molecule is ssDNA-208a, and the anionic liposome is composed of linoleic acid, 1,2-dioleoyl-SN-glycerol-3-phosphorylethanolamine and 1,2-dimyristicoyl-rac-glycerol-3-methoxy-polyethylene glycol.

[0026] The concentration of ssDNA-208a ranged from 3.76 to 150.32 nM.

[0027] The present invention also provides a liposome fusion method, comprising the following steps: using a PEG solution as a fusion accelerator, incubating the molecular beacon-based cationic liposomes with anionic liposomes carrying target molecules to obtain fused liposomes.

[0028] The molecular weight of the PEG is 6000 to 20000.

[0029] Preferably, the molecular weight of the PEG is 6000-10000, which can effectively promote the fusion of molecular beacons and target molecules.

[0030] Preferably, the molecular weight of the PEG is 8000 to 10000.

[0031] The mass concentration of the PEG solution is 10% w / v to 50% w / v.

[0032] Preferably, the mass concentration of the PEG solution is 30% w / v to 50% w / v.

[0033] The incubation temperature is 35℃~51℃; the incubation time is 0~60min.

[0034] Reaction mechanism: such as Figure 8 As shown, exosomes carry a negative charge on their surface, enabling them to fuse with cationic liposomes through electrostatic interactions. PEG acts as a fusion accelerator, helping to remove bound water from the membrane surface, bringing the membranes closer together to promote fusion. A double-stranded specific nuclease (DSN) is added to amplify the signal. After the cationic liposomes fuse with the exosomes, MB-208a and miR-208a form a double-stranded structure through complementary base pairing. The DSN enzyme specifically cleaves the DNA in the heteroduplex, releasing miR-208a and triggering the next round of the target cycle reaction, thus amplifying the signal.

[0035] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention uses the ethanol injection method to prepare cationic liposomes. By controlling various reaction conditions such as ultrasonic power, ultrasonic time, injection speed, and buffer solution salt concentration, cationic liposomes with uniform size, positive surface charge, high encapsulation efficiency, and good stability are obtained; 2. A cationic liposome detection system based on molecular beacons is constructed; 3. By fusing cationic liposomes with exosomes, complex and cumbersome operations such as centrifugation extraction, lysis, purification, and reverse transcription amplification of miRNA in exosomes are eliminated, and miR-208a in exosomes can be detected by the fluorescence signal intensity of molecular beacons. Attached Figure Description

[0036] Figure 1 Exploration of liposome fusion conditions: Figure 1 A represents the effect of PEG molecular weight on liposome fusion; Figure 1 B represents the effect of mass concentration on liposome fusion; Figure 1 C represents the effect of temperature on liposome fusion; Figure 1 D represents the effect of time on liposome fusion;

[0037] Figure 2 Hydrodynamic size and zeta potential characterization of MB / LP, ssDNA / LP, and FLP: Figure 2 A represents the quantity distribution of hydrodynamic dimensions of MB / LP, ssDNA / LP, and FLP; Figure 2 B represents the MB / LP, ssDNA / LP, and FLPZeta potentials.

[0038] Figure 3 Transmission electron microscopy images (scale bar 100 nm) of MB / LP, ssDNA / LP, and FLP: Figure 3 A is a transmission electron microscope image of MB / LP; Figure 3 B is a transmission electron microscope image of ssDNA / LP; Figure 3 C is a transmission electron microscope image of the FLP;

[0039] Figure 4 For the detection limit and standard curve of the MB / LP method: Figure 4 A represents the detection limit of the MB / LP method; Figure 4 B is the standard curve for the MB / LP method;

[0040] Figure 5 This is due to the signal amplification effect of the DSN enzyme;

[0041] Figure 6 The results of the MB / LP method for detecting HC and AMI groups;

[0042] Figure 7The receiver operating characteristic curve for the MB / LP method;

[0043] Figure 8 This is a basic schematic diagram of the present invention. Detailed Implementation

[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0045] Raw materials: 1,2-bis(octadecenoxy-3-methylammonium propane) (chloride) (DOTMA): purchased from Aivito Shanghai Pharmaceutical Technology Co., Ltd., item number: 002007; Cholesterol: purchased from Aivito Shanghai Pharmaceutical Technology Co., Ltd., item number: 002003; Distearylphosphatidylacetamide-polyethylene glycol (DSPE-PEG2000): purchased from Xi'an Ruixi Biotechnology Co., Ltd., item number: R-1028-2K; MB-208a: 5'(6-carboxyfluorescein-CGCGTACACAAGCTTTTTGCTCGTCTTATGTACGCG-(4-((4-(dimethylamino)phenyl)azo)benzoic acid)3', purchased from Beijing Saibaisheng Gene Technology Limited Company, Product No.: 0509-511; Linoleic acid (LA): purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., Product No.: L100446; 1,2-Dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE): purchased from Beijing Jinming Biotechnology Co., Ltd., Product No.: D10339; 1,2-Dimyristoyl-rac-glycerol-3-methoxy-polyethylene glycol (DMG-PEG2000): purchased from Aivit Shanghai Pharmaceutical Technology Co., Ltd., Product No.: 002005; ssDNA-208a: purchased from Beijing Saibaisheng Gene Technology Co., Ltd., Product No.: 0509-513; PEG: purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., Product No.: P103731.

[0046] Example 1: Preparation of MB / LP

[0047] Take 100 μL of a cationic lipid mixture containing DOTMA, Chol, and DSPE-PEG2000 (molar ratio of DOTMA:Chol:DSPE-PEG2000 is 49:49:2) (total concentration of the three cationic lipids is 10 mg / mL, prepared with anhydrous ethanol) and mix it with 4 μL of MB-208a solution (100 μM, prepared with ultrapure water). Use a disposable syringe to quickly inject the mixture into 1896 μL of PBS buffer solution (10 nM, pH 7.4, containing 0.1 nM NaCl). Set the sonication power to 80% of the maximum power (40 W), sonicate for 5 min, remove the solution, dialyze for purification for 8 h, and then store it in a 4℃ refrigerator for later use.

[0048] Example 2: Preparation of ssDNA / LP

[0049] Take 100 μL of anionic lipid mixture containing LA, DOPE, and DMG-PEG2000 (LA:DOPE:DMG-PEG2000 molar ratio of 49:49:2, prepared with anhydrous ethanol) and mix it with 4 μL of ssDNA-208a solution (100 μM, prepared with ultrapure water). Quickly inject this mixture into 1896 μL of PBS buffer (10 nM, pH 7.4) using a disposable syringe. Set the sonication power to 80% of maximum and sonicate for 5 min. After dialysis purification for 8 h, store the prepared ssDNA / LP solution at 4°C for later use.

[0050] Example 3: Exploration of Liposome Fusion Conditions

[0051] Add 50 μL of PEG solution (20% w / v) with molecular weights of 6000, 8000, 10000, and 20000 to each of four centrifuge tubes, respectively. Then add 100 μL each of purified MB / LP and ssDNA / LP. Incubate at room temperature for 10 min, and detect the fluorescence signal at 518 nm for each group using a fluorescence spectrometer. Figure 1 As shown in Figure A, when the molecular weight of PEG is 10,000, it can effectively promote the fusion of MB / LP and ssDNA / LP.

[0052] Different mass concentrations (10%, 20%, 30%, 40%, 50%) of PEG solutions with a molecular weight of 10000 were prepared. 50 μL of each PEG solution, 100 μL of purified MB / LP, and 100 μL of purified ssDNA / LP were added to centrifuge tubes, respectively. A control group without PEG solution was also included. All groups were incubated at room temperature for 10 min, and the fluorescence signal at 518 nm was detected using a fluorescence spectrometer. Figure 1 As shown in B, increasing the concentration of the PEG solution is beneficial for promoting the fusion of liposomes. However, considering that a mass concentration of more than 50% w / v is not easy to prepare and that an excessively high concentration will lead to increased solution viscosity, which will increase the difficulty of detection, a 50% w / v PEG solution (molecular weight of 10000) was finally used as the fusion promoter.

[0053] Multiple centrifuge tubes were filled with 25 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v), 50 μL of purified MB / LP (165.14 nM), and 50 μL of purified ssDNA / LP (150.32 nM). The centrifuge tubes were incubated at 35℃, 37℃, 39℃, 42℃, 45℃, 47℃, 49℃, and 51℃ for 10 min, respectively, and the fluorescence signal intensity of each group was detected. A control group was set up: Multiple centrifuge tubes were filled with 25 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v), 50 μL of purified MB / LP (165.14 nM), and 50 μL of PBS buffer solution, respectively. The centrifuge tubes were incubated at 35℃, 37℃, 39℃, 42℃, 45℃, 47℃, 49℃, and 51℃ for 10 min, respectively. The fluorescence signal intensity at 518 nm was measured for each group to analyze the effect of temperature on the molecular beacon background signal. Figure 1 As shown in Figure C, the relative increase in fluorescence signal intensity is most significant when the fusion temperature is 45℃.

[0054] Multiple centrifuge tubes were filled with 25 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v), 50 μL of purified MB / LP (165.14 nM), and 50 μL of purified ssDNA / LP (150.32 nM), respectively. The centrifuge tubes were incubated at 45 °C for 0 min, 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 40 min, 50 min, and 60 min, respectively. The fluorescence signal intensity at 518 nm was measured for each group to analyze the effect of fusion time on liposome fusion. Figure 1 As shown in D, a relatively high fluorescence signal value can be achieved at 15 minutes. This time is relatively short and meets the requirements for rapid detection.

[0055] Example 4: Characterization of MB / LP, ssDNA / LP, and fusion liposomes (FLP)

[0056] To demonstrate the occurrence of liposome fusion and the formation of fused liposomes, the hydrodynamic size, zeta potential, and transmission electron microscopy were used to characterize MB / LP, ssDNA / LP, and their fused liposome (FLP, 50% w / v PEG (molecular weight 10000), fusion temperature 45℃, and fusion time 15 min).

[0057] Figure 2 The image shows the DLS characterization of three types of liposomes. Figure 2A shows the number distribution of the hydrodynamic size of MB / LP, ssDNA / LP, and FLP. The peak value of the MB / LP number distribution is around 106 nm; the peak value of the ssDNA / LP number distribution is around 91.3 nm; and the peak value of the FLP number distribution is approximately 255 nm. Therefore, the increase in the particle size of the fusion liposomes proves the formation of fusion liposomes. Figure 2 B represents the Zeta potential of the three liposomes. The Zeta potential of MB / LP was 8.29 ± 0.18 mV; the Zeta potential of ssDNA / LP was -16.73 ± 0.90 mV; and the Zeta potential of FLP was -0.64 ± 0.07 mV. The changes in the Zeta potential of the liposomes after fusion also demonstrate the occurrence of fusion behavior.

[0058] Figure 3 Transmission electron microscopy characterization of three types of liposomes. The figure shows that MB / LP ( Figure 3 A) and ssDNA / LP ( Figure 3 B) exhibited good dispersion, without any aggregation, fusion, or breakage. Figure 3 C showed obvious liposome fusion, which indicates the formation of fused liposomes and proves the feasibility of detecting miRNA in exosomes using liposome fusion. The molecular beacon (MB-208a) in MB / LP is encapsulated inside cationic liposomes (DOTMA, Chol, DSPE-PEG2000).

[0059] Example 5: Performance Evaluation Based on MB / LP Detection Method

[0060] 25 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v) was selected as the fusion accelerator. At 45℃, 50 μL of purified MB / LP (165.14 nM) was incubated with 50 μL of PBS solution without ssDNA / LP for 15 min. Fluorescence signal was detected at 518 nm. The assay was repeated 20 times, and the mean (M) and standard deviation (SD) of the maximum fluorescence signal were obtained. M+2SD was calculated. Then, a two-point regression was performed based on the fluorescence signal intensity between the blank group and the adjacent concentration (3 nM) sample to obtain a linear equation: Y = 0.02032X + 0.5567, where X represents the concentration of ssDNA-208a and Y represents the fluorescence intensity. Substituting the result of M+2SD into this equation, the corresponding concentration value of ssDNA-208a was calculated, which is the lowest detection concentration, or the detection limit of this method. Figure 4 The minimum detection concentration, i.e. the detection limit, obtained by this method is 1.84 nM.

[0061] ssDNA / LP was diluted to different concentration gradients (3.76 nM, 7.52 nM, 15.03 nM, 30.06 nM, 45.09 nM, 60.12 nM, 75.16 nM, 90.19 nM, 105.22 nM, 120.25 nM, 135.28 nM, 150.32 nM). 100 μL of different concentrations of ssDNA / LP, 100 μL of purified MB / LP (165.14 nM), and 50 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v) were added to each centrifuge tube. The tubes were incubated at 45 °C for 15 min, and the fluorescence signal intensity of each group was detected. Each concentration of ssDNA / LP sample was tested three times. Scatter plots of ssDNA concentration values ​​versus fluorescence signal values ​​were plotted and fitted to analyze the linear range of the method. Figure 4 The standard curve obtained by plotting B shows good linearity when the ssDNA-208a concentration is 3.76–150.32 nM. Therefore, this concentration range can be considered the linear interval for detecting the target molecule ssDNA-208a based on the MB / LP method.

[0062] To evaluate repeatability and in-laboratory precision, the experimental protocol was designed according to national standards as follows: Testing was conducted for 15 days (not necessarily consecutively) in the same laboratory, on the same instrument, and by the same operator, with two analytical batches per day, and each batch of reagents measured twice. 30 pairs (60 data points) were obtained, the data were recorded and analyzed, and the results of repeatability and in-laboratory precision were calculated and the coefficients of variation (CV) for both were reported. The reaction system consisted of 20 μL of purified ssDNA / LP (150.32 nM), 80 μL of PBS buffer, 100 μL of purified MB / LP (165.14 nM), and 50 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v), incubated at 45°C for 15 min.

[0063] Table 1

[0064]

[0065] Table 1 reports the precision (reproducibility and in-laboratory precision) of this method. When reporting the precision of this method using the coefficient of variation (CV), the repeatability CV is 1.46%, less than 10%, which meets the national standard requirements; the in-laboratory precision CV is 9.82%, less than 15%, which also meets the national standard requirements.

[0066] Example 6: Preparation and application of MB / LP detection reagent containing DSN enzyme

[0067] Take 400 μL of lipid mixture (DOTMA, Chol, DSPE-PEG2000, molar ratio 49:49:2), 16 μL of MB-208a (100 μM), 50 μL of DSN enzyme (2 U / μL) solution and 50 μL of its reaction buffer (200 nM Tris-HCl (pH 8.3), 60 mM MgCl2), mix well, and quickly inject it into 7484 μL of PBS buffer solution (containing 0.1 M NaCl) using a disposable syringe. Set the sonication power to 80% of the maximum power, sonicate for 5 min, remove, and dialyze to purify for 8 h to obtain MB / LP detection reagent containing DSN enzyme. Store at 4℃ for later use. Figure 5 The amplification effect of DSN enzyme on fluorescence signals was characterized. When DSN enzyme was not added (control group), the fluorescence signals of the healthy HC group and the acute myocardial infarction (AMI) group were (0.60±0.09)×10⁻⁶, respectively. 6 and (0.64±0.15)×10 6 The detected fluorescence signal was close to the background signal of the molecular beacon, making it impossible to distinguish between healthy individuals and patients. After adding DSN enzyme for signal amplification, the fluorescence signals in the HC group and AMI group were (0.70±0.15)×10⁻⁶, respectively. 6 and (1.65±0.43)×10 6 The difference was statistically significant (P = 0.003 < 0.05), demonstrating that the addition of DSN enzyme amplifies the fluorescence signal, which is beneficial for the diagnosis of acute myocardial infarction in a short time.

[0068] 100 μL of serum samples, 100 μL of the MB / LP assay reagent containing DSN enzyme, and 50 μL of PEG solution (molecular weight 10000, mass concentration 50% w / v) were collected from 28 patients with myocardial infarction (AMI) and 25 healthy individuals treated at the Laboratory Medicine Center of the Second Affiliated Hospital of Nanjing Medical University. The reaction was carried out for 15 min, and the fluorescence signal intensity of each group was detected and recorded. miR-208a detection based on the MB / LP system (containing DSN enzyme) was performed on both the AMI group (28 cases) and the HC group (25 cases). The experimental results are as follows: Figure 6 As shown in the figure. The average fluorescence signal values ​​of the HC group and the AMI group were (0.74±0.18)×10⁻⁶, respectively. 6 and (1.82±0.76)×10 6 P = 1.20 × 10 -8 The difference between the two values ​​was <0.01, indicating a highly significant statistical difference. This suggests that MB / LP can detect miR-208a in exosomes in serum samples and can diagnose and differentiate AMI patients from healthy individuals based on the intensity of the fluorescence signal.

[0069] Example 7: Statistical Analysis of the MB / LP-based Detection Method

[0070] This experiment used Microsoft Office Excel to record relevant experimental data, SPSS 26.0 software for statistical analysis, and Graphpad Prime 9 software for graphing. Logistic regression analysis was used to assess the independent predictive ability of miR-208a for acute myocardial infarction (AMI). ROC curve analysis was further used to analyze the diagnostic efficacy of the two indicators for AMI. All data are expressed as mean ± standard deviation. The results are expressed directly as fluorescence intensity values, and P < 0.05 is considered statistically significant.

[0071] The experiment used the receiver operating characteristic curve (ROC curve) to measure the receiver operating characteristic curve (ROC curve). Figure 7 This study investigated the diagnostic value of cTnI, a traditional diagnostic biomarker for acute myocardial infarction (AMI), and miR-208a, a novel diagnostic biomarker. The curve is located near the upper left corner of the coordinate axis, and the area under the curve (AUC) is 0.96 (95% confidence interval CI: 0.92–1.00). The AUC is close to 1, indicating that both the diagnostic method and the biomarker have high diagnostic value.

Claims

1. A detection reagent, characterized in that, The product contains molecular beacon-based cationic liposomes, a DSN enzyme solution, and a PEG solution. The preparation method of the molecular beacon-based cationic liposomes includes the following steps: mixing a mixed solution containing 1,2-bis(octadecenoxy-3-methylammonium propane) (chloride), cholesterol, and distearate phosphatidylacetamide-polyethylene glycol with a molecular beacon solution, followed by sonication and dialysis purification to obtain the cationic liposomes; the mixed solution is an ethanol mixture; the molecular beacon has a hairpin structure, and the structure of the molecular beacon is 5'-(6-carboxyfluorescein)-CGCGTAC. ACAAGCTTTTTG CTCGTCTTAT GTACGCG-(4-((4-(dimethylamino)phenyl)azo)benzoic acid)-3'.

2. The detection reagent according to claim 1, characterized in that, The molecular weight of the PEG is 6000~20000; the mass concentration of the PEG is 10%w / v~50%w / v; and the concentration of the DSN enzyme solution is 2U / µL.

3. The use of the detection reagent according to claim 1 in the preparation of a reagent for detecting acute myocardial infarction.

4. The application according to claim 3, characterized in that, The molecular beacon-based cationic liposomes, DSN enzyme solution, and PEG solution were mixed and incubated with the test serum and normal human serum, respectively, and the fluorescence signal intensity at 518 nm was detected. When the fluorescence signal intensity of the test solution was higher than that of the normal human serum, it indicated that the person who provided the test serum had acute myocardial infarction; when the fluorescence signal intensity of the test solution was not higher than that of the normal human serum, it indicated that the person who provided the test serum did not have acute myocardial infarction.

5. The application according to claim 4, characterized in that, The incubation temperature is 35℃~51℃; the incubation time is 0~60min.

Images