Construction method and application of pru delta pp2a-a of toxoplasma gondii

Abstract

This invention provides a method for constructing and applying the attenuated Toxoplasma gondii strain PruΔpp2a-a, belonging to the field of biomedical technology. This invention obtains an attenuated Toxoplasma gondii strain by knocking out the TgPP2A-A gene in Toxoplasma gondii. After the deletion of TgPP2A-A, a large number of starch granules accumulate between the parasites, and Toxoplasma gondii loses its ability to form cysts. The attenuated Toxoplasma gondii strain PruΔpp2a-a exhibits significantly reduced in vitro proliferation rate and pathogenicity compared to the wild-type strain. Mice infected with the TgPP2A-A gene-deleted strain neither develop the disease nor die, and cysts are undetectable in mouse brain tissue, demonstrating high host safety. Immunization of mice with the TgPP2A-A gene-deleted attenuated Toxoplasma gondii strain significantly increases antibody levels, providing significant immunoprotective efficacy against reinfection with high doses of Toxoplasma gondii RH tachyzoites and Pru cysts, thus preventing reinfection with Toxoplasma gondii.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the construction method and application of the attenuated Toxoplasma gondii strain PruΔpp2a-a. Background Technology

[0002] Toxoplasma gondii is a zoonotic opportunistic pathogen that can infect almost all warm-blooded animals, including humans, and is widely distributed worldwide. As an opportunistic pathogen, Toxoplasma gondii infects humans when they ingest food containing Toxoplasma gondii tissue cysts or oocysts from cat feces. The oocysts or tissue cysts rupture, and the parasite invades the intestinal mucosal cells. The sporozoites released from the oocysts or the bradyzoites released from the tissue cysts transform into tachyzoites, which eventually distribute to various parts of the body, causing infection. In immunocompetent individuals, infection with Toxoplasma gondii may not cause obvious clinical symptoms due to the body's immune system. However, for immunocompromised patients, such as organ transplant recipients and HIV / AIDS patients, Toxoplasma gondii infection carries a high risk and can even lead to death. Current drug treatments only target the tachyzoite stage of the parasite and are largely ineffective against the bradyzoites within the cysts. Furthermore, the use of these drugs has certain toxic side effects.

[0003] In recent years, scholars both domestically and internationally have suggested that developing a vaccine-immune host may be an effective measure for controlling toxoplasmosis. Currently, toxoplasmosis vaccine development mainly focuses on inactivated vaccines, subunit vaccines, and nucleic acid vaccines. However, these vaccines only provide partial immune protection and cannot achieve complete protection, resulting in less than ideal immune efficacy. Attenuated live vaccines have advantages such as good immunogenicity and long-lasting immunity, making them one of the best choices for toxoplasmosis control. However, currently only one strain of S48 Toxoplasma gondii attenuated live vaccine is permitted for use in preventing abortion in goats and sheep, but this vaccine is limited to countries such as New Zealand, and its genetic background is unclear. Therefore, finding novel and effective vaccine candidate antigens for toxoplasmosis vaccine development has become an important task for protecting human health. Summary of the Invention

[0004] In view of this, the present invention provides a method for constructing and applying the attenuated Toxoplasma gondii strain PruΔpp2a-a. By knocking out the TgPP2A-A gene in Toxoplasma gondii, an attenuated Toxoplasma gondii strain with the TgPP2A-A gene missing is finally obtained. It was found that after knocking out TgPP2A-A, a large number of starch granules aggregated between the parasites and Toxoplasma gondii could not form cysts in mice. Immunization of mice with the attenuated Toxoplasma gondii strain PruΔpp2a-a can provide immune protection against both acute and chronic Toxoplasma gondii infection.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-a involves knocking out the TgPP2A-A gene to affect the starch metabolism, virulence, and cyst formation of Toxoplasma gondii. The nucleotide sequence of the TgPP2A-A gene is shown in SEQ ID NO.1.

[0007] Preferably, the TgPP2A-A gene is knocked out using CRISPR-Cas9 technology.

[0008] Preferably, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.2.

[0009] The present invention also provides a Toxoplasma gondii attenuated strain PruΔpp2a-a constructed by the above-mentioned method for constructing the Toxoplasma gondii attenuated strain PruΔpp2a-a.

[0010] The present invention also provides the application of the above-mentioned attenuated Toxoplasma gondii strain PruΔpp2a-a in a drug for the prevention or treatment of Toxoplasma gondii infection.

[0011] The present invention also provides a live attenuated Toxoplasma gondii vaccine, comprising the above-mentioned attenuated Toxoplasma gondii strain PruΔpp2a-a.

[0012] Beneficial Technical Effects: This invention provides a method for constructing and applying the attenuated Toxoplasma gondii strain PruΔpp2a-a. By knocking out the TgPP2A-A gene in Toxoplasma gondii, an attenuated Toxoplasma gondii strain lacking the TgPP2A-A gene is obtained. Compared with the wild-type strain, the attenuated Toxoplasma gondii strain lacking the TgPP2A-A gene exhibits a significantly reduced in vitro proliferation rate and pathogenicity. Mice infected with the TgPP2A-A gene-deficient strain do not develop the disease or die, and no cysts are detected in mouse brain tissue, indicating high host safety. Furthermore, immunization of mice with the attenuated Toxoplasma gondii strain lacking the TgPP2A-A gene produces high levels of IgG antibodies, providing significant immunoprotective efficacy against reinfection with high doses of Toxoplasma gondii RH tachyzoites and Pru cysts. This attenuated live vaccine has significant application value and can be used to prevent Toxoplasma gondii reinfection. Attached Figure Description

[0013] Figure 1 This diagram illustrates the construction of the attenuated Toxoplasma gondii strain PruΔpp2a-a, where A represents the knockout of the TgPP2A-A gene; B shows the PCR identification results of the PruΔpp2a-a strain, where PCR1 and PCR3 represent the 5' and 3' integration of homologous fragments, respectively, and PCR2 represents whether the TgPP2A-A gene was successfully replaced.

[0014] Figure 2Phagocytic plaques of wild-type Pru and PruΔpp2a-a;

[0015] Figure 3 Figure 1 shows the results of staining experiments on starch granules from wild-type Pru and PruΔpp2a-a strains.

[0016] Figure 4 Figure showing the results of the transformation experiment of wild-type Pru and PruΔpp2a-a bradygen;

[0017] Figure 5 Infect mice with 2×10 4 Survival rates of Pru and PruΔpp2a-a attenuated strains;

[0018] Figure 6 Survival rate of mice infected with RH Toxoplasma gondii after immunization;

[0019] Figure 7 The survival rate of mice after oral gavage encapsulation;

[0020] Figure 8 The number of brain cysts in mice 30 days after cyst infection;

[0021] Figure 9 The antibody levels of IgG, IgG1, and IgG2a in the serum of immunized or control mice;

[0022] in, Figures 5-9 In the text, "ns" indicates p > 0.05, meaning the difference is not significant, and "***" indicates p < 0.001, meaning the difference is extremely significant. Detailed Implementation

[0023] This invention provides a method for constructing a Toxoplasma gondii attenuated strain PruΔpp2a-a, which is constructed by knocking out the TgPP2A-A gene to affect the starch metabolism and cyst formation of Toxoplasma gondii; the nucleotide sequence of the TgPP2A-A gene is shown in SEQ ID NO.1.

[0024] In this invention, the method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-a includes the following steps:

[0025] (1) Construction of the knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgPP2A-A, i.e., construct plasmid pSAG1-Cas9-SgTgPP2A-A; construct the homologous fragment DHFR containing TgPP2A-A, and design 5' homologous arm primers and 3' homologous arm primers near the start and stop codons of the TgPP2A-A gene. At the same time, design universal amplification primers pUPRT-DHFR-D and pUC19, and ligate them; finally, amplify the DHFR plasmid that has been successfully sequenced.

[0026] (2) Construction of attenuated Toxoplasma gondii strain: The above-mentioned pSAG1-Cas9-SgTgPP2A-A knockout plasmid and the resistant fragment containing the TgPP2A-A homologous arm were electroporated into Toxoplasma gondii. After screening and identification, attenuated Toxoplasma gondii strain was obtained and denoted as PruΔpp2a-a.

[0027] In this invention, the TgPP2A-A gene is preferably knocked out using CRISPR-Cas9 technology.

[0028] In this invention, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.2.

[0029] The present invention also provides a Toxoplasma gondii attenuated strain PruΔpp2a-a constructed by the above-mentioned method for constructing the Toxoplasma gondii attenuated strain PruΔpp2a-a.

[0030] The present invention also provides the application of the above-mentioned attenuated Toxoplasma gondii strain PruΔpp2a-a in a drug for the prevention or treatment of Toxoplasma gondii infection.

[0031] This invention does not impose any particular limitation on the dosage form of the drug; any medically acceptable dosage form using a weakened strain of Toxoplasma gondii is acceptable. This invention also does not impose any particular limitation on the preparation method of the drug; any preparation method appropriate to the dosage form is acceptable.

[0032] The present invention also provides a live attenuated Toxoplasma gondii vaccine, comprising the above-mentioned attenuated Toxoplasma gondii strain.

[0033] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the embodiments and experimental examples of this invention can be obtained commercially. Unless otherwise specified, the methods used in the embodiments and experimental examples of this invention are conventional methods. The Toxoplasma gondii strain used in this invention is disclosed in (Fox BA, Falla A, Rommereim LM, Tomita T, Gigley JP, Mercier C, Cesbron-Delauw MF, Weiss LM, Bzik DJ. Type II Toxoplasma gondii KU80 knockout strains enable functional analysis of genes required for cyst development and latent infection. Eukaryotes Cell. 2011 Sep; 10(9): 1193-206. doi: 10.1128 / EC.00297-10.).

[0035] Example 1

[0036] Construction of the attenuated Toxoplasma gondii strain PruΔpp2a-a as follows Figure 1 As shown, it includes the following steps:

[0037] (1) Construction of knockout plasmid:

[0038] sgRNA was designed based on the TgPP2A-A gene (TGME49_315670) from the Toxoplasma gondii genome website ToxoDB (https: / / toxodb.org / ), and its nucleotide sequence is shown in SEQ ID NO.2. Using the Q5 site-directed mutagenesis kit, UPRT in pSAG1-Cas9-SgUPRT was replaced with TgPP2A-A, thus constructing the plasmid pSAG1::Cas9::SgTgPP2A-A. For the construction of the TgPP2A-A homologous fragment DHFR, primers for 5' and 3' homologous arms were designed near the start and stop codons of the TgPP2A-A gene. The nucleotide sequence of the upstream primer of the 5' homologous arm is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the 3' homologous arm is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6. TgPP2A-A gene knockout, such as Figure 1 As shown in Figure A.

[0039] Design amplification primers for DHFR and pUC19. The nucleotide sequence of the upstream primer for the universal amplification primer for DHFR from the pUPRT-DHFR-D vector is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8. The nucleotide sequence of the upstream primer for pUC19 is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10.

[0040] according to Connect using the MultiS One Step Cloning Kit, where the connection system is as follows:

[0041]

[0042] The ligation product was then transformed into DH5α competent cells. Finally, the successfully sequenced DHFR plasmid PUC19-TgPP2A-A-DHFR was amplified, i.e., the homologous fragment DHFR was amplified. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.11 above, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12.

[0043] The amplification reaction system is as follows:

[0044]

[0045] The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 30 cycles; and finally 72℃ extension for 8 min.

[0046] The specific nucleotide sequences of SEQ ID NO.2 to SEQ ID NO.12 are shown below:

[0047] SEQ ID NO.2: GCGCAGAGATGAGAGCGCGG;

[0048] SEQ ID NO.3:

[0049] GGTTTTCCCAGTCACGACGTTGCAGCAAGTGAGAAATAACGC;

[0050] SEQ ID NO.4:

[0051] GGATTTACAGCCTGGCGAAGCTTCCTTCAAAACGCCCACAACTC;

[0052] SEQ ID NO.5:

[0053] CTATGCACTTGCAGGATGAATTCGCCCTCCACGGCTTACACGAC;

[0054] SEQ ID NO.6:

[0055] GAGCGGATAACAATTTCACATTCCTACCAGCACAGGCACCC;

[0056] SEQ ID NO.7: AAGCTTCGCCAGGCTGTAAATCC;

[0057] SEQ ID NO.8: GAATTCATCCTGCAAGTGCATAG;

[0058] SEQ ID NO.9: TGTGAAATTGTTATCCGCTC;

[0059] SEQ ID NO.10: AACGTCGTGACTGGGAAAACC;

[0060] SEQ ID NO.11: GCAGCAAGTGAGAAATAACGC;

[0061] SEQ ID NO. 12: TTCCTACCAGCACAGGCACCC.

[0062] (2) Construction of the PruΔpp2a-a strain:

[0063] HFF cells were seeded in 75T cell culture flasks, and 18 mL of DMEM medium containing 10% FBS was added. The cells were cultured in a CO2 incubator at 37°C until fully confluent. The medium was then replaced with 18 mL of DMEM medium containing 2% FBS, and 1 mL of freshly released Pru tachyzoites were added. After 60 h of culture, the tachyzoites were collected and purified for electroporation of *Toxoplasma gondii*. The pSAG1-Cas9-SgTgPP2A-A plasmid and a DHFR resistance fragment containing the TgPP2A-A homologous arm were electroporated into *Toxoplasma gondii*. Monoclonal strains were obtained through limiting dilution with pyrimethamine and 96-well plates. After scale-up culture, genomic DNA was extracted, and the 5' and 3' homologous arms and CDS open reading frame of the TgPP2A-A gene were amplified to verify whether the TgPP2A-A gene was knocked out. The nucleotide sequences of the amplification primers are shown in SEQ ID NO.13–SEQ ID NO.18. SEQ ID NO.13 to SEQ ID NO.14 are the upstream and downstream primers for amplifying the 5' homologous arm, respectively; the reaction system is as follows:

[0064]

[0065] Reaction conditions: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; final extension at 72℃ for 8 min.

[0066] SEQ ID NO.15 to SEQ ID NO.16 are the upstream and downstream primers for amplifying the 3' homologous arm, respectively; the amplification reaction system is as follows:

[0067]

[0068] Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; and finally 72℃ extension for 5 min.

[0069] SEQ ID NO.17 to SEQ ID NO.18 are the upstream and downstream primers for amplifying the PP2A-A open reading frame, respectively. The reaction system is as follows:

[0070]

[0071] Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 30 cycles; final extension at 72℃ for 5 min.

[0072] The specific nucleotide sequences of SEQ ID NO.13 to SEQ ID NO.18 are shown below:

[0073] SEQ ID NO.13: TCCTGGACCGCGCGTCTGTTCCA;

[0074] SEQ ID NO.14: GCCAAGTAGAAAGGAATTAGCAT;

[0075] SEQ ID NO.15: TGACGCAGATGTGCGTGTATCCAC;

[0076] SEQ ID NO.16: CACCCTGATTTTTCGTCGTTCC;

[0077] SEQ ID NO.17: GTGGGGTCGTTGCTTCAGTTG:

[0078] SEQ ID NO.18: ATGCGGACGTGAGACTCTTCG;

[0079] PCR identification results of the PruΔpp2a-a strain are as follows: Figure 1 As shown in B, by Figure 1 As can be seen from B, PCR1 and PCR3 have specific bands, while PCR2 has no specific band, confirming that TgPP2A-A has been knocked out.

[0080] Experimental Example 1:

[0081] (1) Basic phenotypic analysis:

[0082] Plaque assay: A small number of wild-type Pru and PruΔpp2a-a strains that had completely escaped were inoculated from 25T cell flasks, counted, and their final concentration was increased to 2 × 10⁻⁶. 3 250 μL of HFF was added to each well of a 12-well plate, and the plate was gently shaken to ensure even distribution of tachyzoites. The plate was then placed in a cell culture incubator. After 7 days of culture, the supernatant was discarded, and the plate was washed 8 times by gently blowing on the bottom of the well with PBS solution. 1 mL of tissue fixative was added for 20 min of fixation, the supernatant was discarded, and the plate was washed 8 times with PBS solution. 1 mL of 0.25% crystal violet was added to each well for 20 min of staining, the supernatant was discarded, and the plate was washed 8 times with PBS solution. The remaining liquid around the well was blotted with absorbent paper, and the plate was air-dried. The plate was then photographed and the size and number of worm spots were counted.

[0083] Glycogen PAS staining assay: Wild-type Pru and PruΔpp2a-a strains that had completely escaped were inoculated from 25T cell flasks and counted using a hemocytometer, with the final concentration diluted to 10⁻⁶. 4 Cells / mL. Inoculate 1 mL of HFF-coated confocal microplates and culture for 36 h; discard DMEM medium, add 400 μL tissue fixative and fix at room temperature for 20 min; wash the cell culture dishes 5 times with PBS solution, add 600 μL 0.2% Triton X-100 and penetrate at room temperature for 20 min; add 400 μL PAS oxidant and react for 20 min, discard the supernatant, wash the cell culture dishes 8 times with PBS solution, add 400 μL Schiff staining solution and react for 20 min, then wash the cell culture dishes 8 times with PBS solution. Add the prepared primary antibody evenly to each small dish and incubate overnight at 4°C; add rabbit anti-IMC1 primary antibody (1:500); wash 8 times with PBS solution; add the prepared secondary antibody to each small dish and incubate at 37°C in the dark for 1 hour; add Alexa Fluor 488 goat anti-rabbit IgG (H+L) (1:1000) secondary antibody; wash 8 times with PBS solution; observe the culture dish under a laser confocal microscope.

[0084] Toxoplasma gondii bradyzoite transformation assay: Wild-type strains Pru and PruΔpp2a-a, which had completely escaped, were inoculated from 25T cell flasks, counted, and diluted to a final concentration of 1×10⁻⁶. 5100 μL of each sample was collected and added to small dishes containing HFF. After culturing in normal medium for 4 h, uninvaded tachyzoites were washed away with preheated DMEM solution. The medium was then changed to pH 8.2 and cultured for another 4 days (changing the medium daily to maintain high alkalinity). After 4 days of culture, the supernatant was discarded, and tissue fixative was added for 20 min. The samples were washed 4 times with PBS solution. 0.2% Triton X-100 was added for 20 min of penetration. The samples were washed 8 times with PBS solution, and 3% BSA was added for blocking for 1 h. The samples were washed 8 times with PBS solution, and rabbit anti-Toxoplasma gondii IMC1 monoclonal antibody (1:500) was added and incubated overnight at 4°C. The samples were washed 8 times with PBS solution, and Alexa Fluor594 goat anti-rabbit IgG (H+L) (1:1000) and FITC-labeled Dolichos biflorus lectin (DBL) (1:500) were added and incubated at 37°C for 1 h. The samples were washed 8 times with PBS solution, and the proportion of DBL-positive spots was recorded and counted under a fluorescence microscope.

[0085] (2) Preparation of live attenuated vaccines:

[0086] HFF cells were seeded into 75T cell culture flasks, and 18 mL of DMEM medium containing 10% FBS was added. The flasks were incubated at 37°C in a CO2 incubator until the cells reached full confluence. The medium was then replaced with 18 mL of DMEM medium containing 2% FBS, and 1 mL of the PruΔpp2a-a strain was added. The flasks were incubated at 37°C in a CO2 incubator until the parasites escaped from the cells, and the PruΔpp2a-a tachyzoites were collected. The collected parasite suspension was filtered through a 3 μm filter to remove cell debris, and the tachyzoite concentration was adjusted to 10⁻¹⁰ with sterile PBS. 4 PruΔpp2a-a live attenuated vaccine was prepared by using 100 μL of 100 μL of 100 μL.

[0087] (3) Mouse toxicity test:

[0088] Before vaccination, the purchased female Kunming mice were housed for a week to reduce stress. The mice were divided into two groups: an immunization group and an immunization group. Each mouse received an intraperitoneal injection of 200 μL of immunization (approximately 2 × 10⁻⁶). 4 One group of mice received 200 μL (approximately 2 × 10⁶) of PruΔpp2a-a tachyzoites; the other group served as a control group. Each mouse was injected intraperitoneally with 200 μL (approximately 2 × 10⁶) of PruΔpp2a-a tachyzoites. 4 (Number) wild-type Pru tachyzoites were used to evaluate toxicity. Mice were observed for survival, and surviving mice were euthanized after 30 days, with cysts in the brain tissue counted.

[0089] (4) Immunization of mice:

[0090] Mice were divided into two groups: an immunization group and an intraperitoneal injection group of 200 μL (approximately 2 × 10⁶) of immunization per mouse.4 One group of mice received PruΔpp2a-a tachyzoites; the other group served as the control group: each mouse was injected intraperitoneally with 200 μL of sterile PBS.

[0091] Acute Toxoplasma gondii infection test: On day 45 post-immunization, 10 Kunming mice from the PruΔpp2a-a immunization group and the PBS control group were collected. A small amount of wild-type RH tachyzoites that had completely escaped were collected from 25T cell flasks and counted using a hemocytometer. The final concentration was diluted to 1000 cells / 200μL, and 200μL of RH tachyzoites was injected intraperitoneally into the mice. The intraperitoneal injection volume was approximately 10. 3 Each mouse was tested individually, and the day of infection was recorded as day 0. The health status of the mice was observed daily after infection, and their survival time was recorded. On day 30 post-infection, the surviving mice were euthanized.

[0092] Chronic Toxoplasma gondii infection experiment: On day 45 post-immunization, 10 Kunming mice from the PruΔpp2a-a immunization group and the PBS control group were used. Each mouse was infected by gavage with 20 pre-prepared active type II Pru cysts. The health status of the mice was observed daily after the challenge, and their survival time was recorded. On day 30 post-infection with Pru cysts, the surviving mice were euthanized, and the number of cysts in their brain tissue was detected.

[0093] (5) Evaluation of immunization efficacy:

[0094] Antibody monitoring between different groups: Serum from 6 immunized mice and PBS control mice was collected on day 45 after immunization to detect IgG antibody and the levels of IgG1 and IgG2a antibody subclasses.

[0095] result:

[0096] (1) Basic phenotypic analysis

[0097] ① Plaque test: The results of the plaque test are as follows Figure 2 As shown, by Figure 2 It can be seen that the plaques formed by PruΔpp2a-a are significantly smaller and fewer than those formed by Pru (p<0.001), and it is almost impossible for them to form plaques.

[0098] ② Glycogen PAS staining test: The results of the glycogen staining test are as follows Figure 3 As shown, by Figure 3 It can be seen that a large number of starch granules are aggregated inside and between the PruΔpp2a-a worms.

[0099] ③ Toxoplasma gondii bradyzoite transformation test: The results of the Toxoplasma gondii bradyzoite transformation test are as follows: Figure 4 As shown, by Figure 4It can be seen that the absence of TgPP2A-A prevents Toxoplasma gondii from cysting after in vitro alkaline induction.

[0100] (2) Toxoplasma gondii toxicity test: The results of the Toxoplasma gondii toxicity test on wild Pru strain and PruΔpp2a-a strain tachyzoites are as follows: Figure 5 As shown, by Figure 5 It can be seen that mice infected with wild-type Pru strain tachyzoites died within 9 days, with a final survival rate of only 30%, while mice infected with PruΔpp2a-a tachyzoites did not die. The survival time of mice infected with PruΔpp2a-a tachyzoites was significantly different from that of the control group (p < 0.01).

[0101] (3) Immunization mouse experiment:

[0102] ① Acute infection test of Toxoplasma gondii RH strain: The results of the acute infection test of Toxoplasma gondii RH strain are as follows Figure 6 As shown, by Figure 6 It can be seen that all mice in the control group died within 9 days after infection with RH tachyzoites, while the PruΔpp2a-a immunized group died within 10 days. 3 No deaths occurred after RH tachyzoites were infected, and the survival time of the PruΔpp2a-a immunized group was significantly different from that of the control group (p<0.001).

[0103] ② Chronic Toxoplasmosis Infection Test: The results of the chronic toxoplasmosis infection test are as follows: Figure 7 As shown, by Figure 7 It can be seen that the control group mice began to develop the disease and some died 7 days after infection, while the PruΔpp2a-a immunized mice did not develop the disease or die.

[0104] The results of the comparison of the number of cysts in the brain tissue of surviving mice are as follows: Figure 8 As shown, by Figure 8 It can be seen that the number of cysts in the brain tissue of the control group mice was 2149, while the number of cysts in the brain tissue of the immunized group mice was 57. The difference in the number of cysts in the brain tissue of the immunized group mice compared with the control group was extremely significant (p<0.001).

[0105] (4) Evaluation of immunization efficacy:

[0106] Antibody levels in the serum of immunized mice and PBS control mice are as follows: Figure 9 As shown, by Figure 9 It can be seen that the levels of IgG, IgG1, and IgG2a in mice immunized with PruΔpp2a-a were significantly higher than those in the control group (p < 0.001).

[0107] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing the attenuated strain of Toxoplasma gondii PruΔpp2a-a, characterized in that, By knocking TgPP2A-A Genes were used to influence starch metabolism, virulence, and cyst formation in *Toxoplasma gondii* to construct attenuated strains of *Toxoplasma gondii*; TgPP2A-A The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-a according to claim 1, characterized in that, The TgPP2A-A Gene knockout is achieved using CRISPR-Cas9 technology.

3. The method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-a according to claim 2, characterized in that, The nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.

2.

4. A Toxoplasma gondii attenuated strain PruΔpp2a-a constructed by the method described in any one of claims 1 to 3.

5. The use of the attenuated Toxoplasma gondii strain PruΔpp2a-a as described in claim 4 in the preparation of a drug for preventing Toxoplasma gondii infection.

6. A live attenuated Toxoplasma gondii vaccine, characterized in that, Includes the attenuated Toxoplasma gondii strain PruΔpp2a-a as described in claim 4.

Images