Method for improving the growth, sporulation capacity and virulence of the entomopathogenic fungus metarhizium robertsii

CN117187085BActive Publication Date: 2026-08-18SOUTHWEST UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311047123.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-18
Publication Date
2026-08-18
Estimated Expiration
2041-09-18

AI Technical Summary

Technical Problem

破坏酿酒酵母(Saccharomyces cerevisiae)的β-葡聚糖酶基因eng1导致细胞出现分离缺陷

Benefits of technology

[0046] Beneficial effects: The engineered strains of Beauveria bassiana, Metarhizium anisopliae, and Metarhizium tumefaciens of this invention exhibit significantly improved growth rates, increased conidial production, and significantly enhanced virulence. These engineered strains significantly improved productive traits and biocontrol efficiency (virulence).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0004403478460000011
    Figure HDA0004403478460000011
Patent Text Reader

Abstract

The present application relates to a kind of genes for improving the virulence or biocontrol effect of biocontrol fungi Beauveria bassiana and Metarhizium anisopliae, expression vectors and strains obtained using the same, and a fungal insecticide using the strains as active ingredients. By overexpressing the BbEng1 encoded by the beta-glucanase gene of Beauveria bassiana, engineering strains of Beauveria bassiana, Metarhizium robertsii and M. acridum are obtained, as well as engineering strains overexpressing the homologous genes MrEng1 and MaEng1 of Metarhizium robertsii and M. acridum themselves. The engineering strains of Beauveria bassiana, Metarhizium robertsii and M. acridum have the functions of promoting growth, improving sporulation capacity and virulence.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese Patent Application No. 202111109974.X, filed on September 18, 2021. Technical Field

[0002] This invention belongs to the field of genetic engineering and relates to the use of genetic engineering methods to improve fungal traits. Background Technology

[0003] Insect biocontrol fungi are an important class of insect biocontrol microorganisms with abundant strains, and are one of the main factors in controlling pest populations in nature (Roberts et al., 2004, Adv. Appl. Microbiol., 54:1–70). Unlike bacteria and viruses, which infect insect pathogens through the digestive tract, insect pathogenic fungi are the only microorganisms that directly penetrate the body wall to infect insects. They have a unique advantage in controlling piercing-sucking pests such as aphids, leafhoppers, and planthoppers that insert their stylets directly into the phloem of plants to suck sap. Therefore, the development and application of fungal insecticides have received widespread attention both domestically and internationally. Among them, various insect biocontrol fungi, such as those developed with Beauveria bassiana, Metarhizium robertsii, and M. acridum as active ingredients, are widely used in the biological control of agricultural, forestry, and sanitary pests (Fan et al., 2012; Yang et al., 2014). The development and application of fungal insecticides have attracted widespread attention both domestically and internationally. For example, more than 170 biocontrol agents with Beauveria bassiana as the active ingredient have been registered globally (de Faria et al., 2007, Biol Control, 43: 237-256).

[0004] The insecticidal mechanism of entomopathogenic fungi primarily involves their living components penetrating the body wall of target insects, causing infection, disease, and ultimately death. The fungal infection process involves conidia or budding spores attaching to the insect's body wall, germinating to produce germ tubes, and growing horizontally on the insect's surface. The growing hyphae differentiate into infection structures or appressoria in specific areas such as the intersegmental membranes of the insect. These infection structures then differentiate into infection hyphae, which, under mechanical pressure and the synergistic action of a series of hydrolytic enzymes produced by secretion, such as esterases, chitinases, and proteases, penetrate the insect's body wall. Once the hyphae penetrate the body wall and enter the hemocoel, they differentiate into budding spores, known as entomopathogenic bodies, which help the fungi evade the insect's innate immune response (including cellular and humoral immunity). Meanwhile, fungi evade insect immune recognition by "disguising" pathogen-related molecular patterns through specialized cell structures and secreting metabolites such as oosporein (Feng et al., 2015, Proc Natl Acad Sci USA 112: 11365–11370), destruxins (Wang et al., 2012, Proc Natl Acad Sci USA 109: 1287–1292), and effector molecules (Cen et al., 2017, PLoS Pathog 13(9): e1006604) to inhibit the host's immune response. On the other hand, fungi produce a series of hydrolytic enzymes that degrade insect tissues, deprive insects of nutrients, promote the proliferation of pathogens, and cause insect death. The fungi fill the insect's body, forming a "mute insect." Under suitable temperature and humidity conditions, the fungi emerge from the dead mute insect's body wall, grow, and produce sporulations to spread, causing a new infection cycle and achieving the goal of continuous pest control. However, the pathogenic process of fungal infection results in a relatively slow rate of target elimination, which to some extent limits the application scope of biocontrol agents. Analyzing the molecular mechanisms of pathogenic infection by biocontrol fungi and identifying functional genes that enhance fungal infection efficacy are important approaches to improving and enhancing the application effects of biocontrol fungi.

[0005] The growth and reproduction rate, sporulation capacity, and other traits of insect biocontrol fungi are closely related to the production of fungal preparations and are important parameters in the production of fungal biocontrol preparations. Currently, the main methods to increase sporulation in production are through optimizing the culture medium and culture conditions.

[0006] While gene manipulation can promote growth and sporulation, there are few reports on using gene manipulation to promote fungal production and sporulation.

[0007] β-glucanases are a class of enzymes that hydrolyze glucans linked by β-glycosidic bonds, and are widely distributed in tissues such as plants, bacteria, fungi, and viruses (Doxey et al., 2007, Mol Biol Evol 24: 1045-55). Studies have found that β-glucanases participate in biological processes such as fungal cell wall metabolism, development and differentiation, and infection and pathogenesis. Four β-1,3-glucanase encoding genes (ENG2-5) in Aspergillus fumigatus are expressed during conidial dormancy and germination. Disruption of ENG2, 3, 4, or 5 leads to conidial defects, and conidia cannot be separated normally, indicating that endo-β-1,3-glucanases are essential for the correct assembly of conidial cell walls and the separation of conidia in filamentous fungi (Mouyna et al., 2016, Cell Microbiol, 18(9): 1285-1293). Disruption of the β-glucanase gene eng1 in *Saccharomyces cerevisiae* leads to cell segregation defects. Knocking out the eng1 homolog in *Schizosaccharomyces pombe* produces similar traits, but the inability to degrade β-1,3-glucan in the primary cell wall between mother and daughter cells prevents normal segregation (Baladrón et al., 2002, Eukaryot Cell 1: 774-786; Martin-Cuadrado, 2003, J Cell Sci 116: 1689-1698). Glucanase plays a crucial role in the pathogenesis of plant pathogens. During the infection of soybean by *Phytophthora sojae*, the GH12 family glucanase PsXEG1 plays a dual role as both a virulence factor and a pathogen-associated model molecule. Knocking out PsXEG1 significantly reduces the virulence of the pathogen (Ma, et al., 2015, Plant Cell 27: 2057). Similarly, knocking out the xylanase (xynl1A) gene in *Botrytis cinerea* significantly reduces the pathogenicity of the pathogen to grapes and tomatoes (Nélida Brito et al., 2006, Mol Plant MicrobeInteract 19: 25-32). These findings indicate that β-glucanase proteins are closely related to fungal growth, development, and host infection processes.

[0008] In analyzing the surface proteins of the proliferating cells (insect-fungus bodies) of the important insect pathogenic fungus *Beauveria bassiana* after invading the insect hemocoel, it was found that β-glucanase Eng1 was present only on the surface protein profile of the insect-fungus body, but not on the surface protein profile of fungal cells cultured in vitro. Gene expression, secretion characteristics, gene knockout and overexpression, and enzymatic function analyses revealed that BbEng1 gene expression is induced by insect nutrition and can be secreted extracellularly to bind to and degrade nutrients in the insect body wall and hemocoel. Gene knockout led to decreased virulence of the strain, while overexpression promoted strain growth and conidia production, significantly enhancing virulence and improving insecticidal efficacy. Furthermore, the study found that BbEng1 is distributed in the cell wall and on the cell surface. In the cell wall, it participates in cell wall metabolism and cell proliferation; as a surface protein, it "conceals" pathogen-related molecular patterns such as β-1,3-glucan, helping the pathogen evade insect immune recognition. Introducing the BbEng1 gene into *Metarhizium anisopliae* (*M. robertsii*) and *Metarhizium acridum* significantly promoted strain growth and sporulation, and substantially enhanced virulence. Furthermore, introducing the homologous genes MrEng1 and MaEng1 of *Metarhizium anisopliae* and *Metarhizium acridum*, respectively, into their respective strains also significantly promoted strain growth and sporulation, and substantially enhanced virulence. Summary of the Invention

[0009] One object of the present invention is to provide a method for promoting the growth and conidia production of insect biocontrol fungi Beauveria bassiana, Metarhizium anisopliae, and Metarhizium tumefaciens, and increasing their virulence.

[0010] Another object of the present invention is to provide engineered strains of Beauveria bassiana, Metarhizium anisopliae, and Metarhizium lobatitum constructed by genetic engineering methods.

[0011] Another object of the present invention is to provide a class of fungal insecticides.

[0012] This invention also provides the use of the BbEng1, MrEng1, and MaEngl genes in the preparation of fungal insecticides. Specifically, BbEng1 (BBA_04753) is located between 365011 bp and 366984 bp in the NW_007930846.1 region (359177 bp-372868 bp) of the Beauveria bassiana genome sequence. https: / / www.ncbi.nlm.nih.gov / gene / ?term= BBA_04753 MrEng1 (MAA_09026) is located between 37770 bp and 39256 bp in the NW_011942204.1 region (26922 bp-44989 bp) of the Metarhizium anisopliae genome sequence. https: / / www.ncbi.nlm.nih.gov / gene / ?term=MAA_09026MaEng1 (MAC_06610) is located in the NW_006916732.1 region (139846 bp-158861 bp) of the Metarhizium anisopliae genome sequence, between 148024 bp and 149543 bp. https: / / www.ncbi.nlm.nih.gov / gene / ?term=MAC_06610 ) .

[0013] According to one aspect of the present invention, a method for improving the growth, sporulation capacity, and virulence of insect biocontrol fungi is characterized by constructing an engineered strain that overexpresses the secretory glucanase gene Eng1 of insect biocontrol fungi to obtain insect biocontrol fungi that promote growth, increase conidia production, and enhance virulence.

[0014] The insect biocontrol fungus described in this invention is selected from *Beauveria bassiana*, *Metarhizium robertsii*, and *M. acridum*. The secretory glucanase gene Eng1 of the insect biocontrol fungus is selected from one of the following: the secretory glucanase gene BbEng1 from *Beauveria bassiana*, the BbEng1 homolog from *Metarhizium robertsii* MrEng1, and the BbEng1 homolog from *M. acridum* MaEng1.

[0015] In the method described in this invention, the secretory glucanase gene Eng1 of the insect biocontrol fungus is placed under the control of a fungal constitutive promoter to construct an overexpression vector; the fungal genome shaping promoter is selected from PgpdA and PB3.

[0016] The preferred method of this invention is to introduce the constitutive promoter PgpdA to control the target gene BbEng1 into a wild-type strain of Beauveria bassiana, and then screen and verify the obtained BbEng1 overexpression engineered strain by RT-qPCR. The BbEng1 coding region of the engineered strain is transcribed at a high level.

[0017] Specifically, the preferred promoter for overexpressing the GH16 domain encoded by the BbEng1 gene is the fungal genome shaping promoter PgpdA (derived from the Aspergillus nidulans 3-phosphate glyceraldehyde dehydrogenase gene promoter), and an overexpression vector is constructed using the glufosinate resistance gene bar as a marker gene.

[0018] The present invention preferably uses the recombinant expression vector pBARGPE1 for preparing engineered strains of Beauveria bassiana. Figure 1 The carrier structure.

[0019] This invention utilizes a random insertion of the promoter PgpdA to fuse with the coding region of the BbEng1 gene, obtaining an engineered strain that overexpresses BbEng1. In this engineered strain, the coding region of the active domain of BbEng1 is transcribed at a high level, promoting the growth and conidia production of *Beauveria bassiana* and enhancing its virulence. It can be used to prepare fungal insecticides.

[0020] Another preferred method of this invention is to introduce the constitutive promoter PB3 (derived from the promoter of the 3-phosphate glyceraldehyde dehydrogenase gene of Beauveria bassiana, Liao et al., 2008, Current Microbiology 57: 121–126; Lu et al., 2021, Environ Microbiol 23(2): 1256–1274) to control the target gene BbEng1 into wild-type strains of Metarhizium anisopliae and Metarhizium locustii. RT-qPCR screening and verification yielded engineered strains that overexpressed BbEng1, in which the coding region of the BbEng1 domain was highly transcribed.

[0021] Specifically, the preferred method for overexpressing the coding region of the BbEng1 gene is to use the fungal genome shaping promoter PB3 as the promoter for overexpression and the herbicide chlorsulfuron resistance gene sur as the marker gene to construct an overexpression vector.

[0022] According to another aspect of the invention, a method for preparing strains of *Metarhizium anisopliae* and *Metarhizium lobata* that overexpress BbEng1 is provided.

[0023] Includes the following steps:

[0024] 1) The coding region of the BbEng1 gene was amplified using wild-type genomic DNA as a template, and the amplified fragment was cloned into a backbone vector.

[0025] Pk2-Pc-Sur-Tc-PB3 ( Figure 2 ), to obtain overexpression vectors;

[0026] 2) Using the sur gene as a selection marker, the expression vector obtained in step 1) was transformed into wild-type strains of *Metarhizium anisopliae* and *Metarhizium lobatitum* using Agrobacterium-mediated fungal transformation (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898). Transformants were obtained through two rounds of selection using chlorsulfuron-methyl herbicide resistance. The verified transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 ℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for qRT-PCR analysis to screen for overexpression transformants. The obtained engineered strains of *Metarhizium anisopliae* and *Metarhizium lobatitum* exhibited characteristics of promoted growth and conidia production, as well as enhanced virulence.

[0027] Another preferred method of this invention is to introduce the constitutive promoter PB3 to control the target gene MrEng1 into a wild-type strain of Metarhizium anisopliae, and then use RT-qPCR screening to verify the acquisition of an engineered strain that overexpresses BbEng1, in which the coding region of the MrEng1 domain is highly transcribed.

[0028] Specifically, the preferred method for overexpressing the GH16 domain encoded by the MrEng1 gene is to use the fungal genome shaping promoter PB3 as the promoter for overexpression and the herbicide chlorsulfuron resistance gene sur as the marker gene to construct an overexpression vector.

[0029] According to another aspect of the invention, a method for preparing a strain of Metarhizium anisopliae overexpressing MrEng1 includes the following steps:

[0030] 1) The coding region of the MrEng1 gene was amplified using wild-type genomic DNA of Metarhizium anisopliae as a template, and the amplified fragment was cloned into the backbone vector Pk2-Pc-Sur-Tc-PB3. Figure 2 ), to obtain overexpression vectors;

[0031] 2) The expression vector obtained in step 1) was transformed into the wild-type strain of *Metarhizium anisopliae* using the *sur* gene as a selection marker via Agrobacterium-mediated fungal transformation (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898). Transformants were obtained through two rounds of selection using chlorsulfuron-methyl herbicide resistance. The verified transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 ℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for qRT-PCR analysis to screen for overexpression transformants. The obtained engineered *Metarhizium anisopliae* strain exhibited characteristics of promoted growth and conidia production, as well as enhanced virulence.

[0032] Another preferred method of the present invention is to control the target gene MrEng1 by introducing the constitutive promoter PB3 into a wild-type strain of Metarhizium anisopliae, and to obtain an engineered strain that overexpresses MrEng1 by RT-qPCR screening and verification, wherein the coding region of the MrEng1 domain in the engineered strain is transcribed at a high level.

[0033] Specifically, the preferred method for overexpressing the GH16 domain encoded by the MrEng1 gene is to use the fungal genome shaping promoter PB3 as the promoter for overexpression and the herbicide chlorsulfuron resistance gene sur as the marker gene to construct an overexpression vector.

[0034] According to another aspect of the invention, a method for preparing a strain of *Metarhizium anisopliae* overexpressing MaEng1 includes the following steps:

[0035] 1) The coding region of the MaEng1 gene was amplified using wild-type genomic DNA of *Metarhizium anisopliae* as a template, and the amplified fragment was cloned into the backbone vector Pk2-Pc-Sur-Tc-PB3. Figure 2 ), to obtain overexpression vectors;

[0036] 2) Using the sur gene as a selection marker, the expression vector obtained in step 1) was subjected to Agrobacterium-mediated fungal genetic transformation.

[0037] The wild-type strain of *Metarhizium anisopliae* was transformed using a chemical method (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898). Transformants were obtained through two screenings using chlorsulfuron-methyl herbicide resistance. The verified transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 °C and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for qRT-PCR analysis to screen for excess transformants.

[0038] Transformants were expressed. The obtained engineered strains of *Metarhizium anisopliae* exhibited characteristics of promoting growth and conidia production, as well as enhanced virulence.

[0039] The present invention preferably uses the expression vector Pk2-Pc-Sur-Tc-PB3 for preparing Metarhizium anisopliae and Metarhizium lobata. Figure 2 The carrier structure.

[0040] The experimental results showed that *Beauveria bassiana*, *Metarhizium anisopliae*, and *Metarhizium lobatitum* strains overexpressing *BbEng1*, *Metarhizium anisopliae* overexpressing *MrEng1*, and *Metarhizium lobatitum* overexpressing *MaEng1* exhibited significantly faster growth rates than their parental strains on both basal and nutrient-rich media, and their conidia production was significantly increased. Bioassays indicated that the virulence of these engineered strains was significantly higher than that of their parental strains.

[0041] According to another aspect of the present invention, an engineered strain of insect biocontrol fungus is provided, wherein the engineered strain has an overexpression of the secretory dextranase gene Eng1.

[0042] The insect biocontrol fungus is selected from Beauveria bassiana, Metarhizium anisopliae, and Metarhizium tumefaciens; the secretory glucanase gene Eng1 of the insect biocontrol fungus is selected from one of the following: the secretory glucanase gene BbEng1 from Beauveria bassiana, the BbEng1 homolog from Metarhizium anisopliae MrEng1, and the BbEng1 homolog from Metarhizium tumefaciens MaEng1.

[0043] According to another aspect of the present invention, a fungal insecticide is provided, comprising the engineered strain of insect biocontrol fungi described in the present invention.

[0044] The insecticide formulation is selected from powder, emulsion, oil, microcapsule, mixture and dried mycelium, wherein the powder is preferably raw powder and wettable powder.

[0045] According to another aspect of the present invention, the use of the secretory glucanase gene Eng1 of insect biocontrol fungi in the preparation of fungal insecticides is provided, wherein the secretory glucanase gene Eng1 of insect biocontrol fungi is selected from one of the following: the secretory glucanase gene BbEng1 derived from Beauveria bassiana, the BbEng1 homologous gene MrEng1 derived from Metarhizium anisopliae Roberts, and the BbEng1 homologous gene MaEng1 derived from Metarhizium anisopliae locust.

[0046] Beneficial effects: The engineered strains of Beauveria bassiana, Metarhizium anisopliae, and Metarhizium tumefaciens of this invention exhibit significantly improved growth rates, increased conidial production, and significantly enhanced virulence. These engineered strains significantly improved productive traits and biocontrol efficiency (virulence). Attached Figure Description

[0047] Figure 1 Map of the overexpression backbone vector pBARGPE1.

[0048] Among them, gpdA is the promoter of the 3-phosphate glyceraldehyde dehydrogenase gene from Aspergillus nidulans, a constitutive promoter in fungi; PtrpC and TtrpC are the promoter and terminator of the tryptophan synthase gene from Aspergillus nidulans; bar is the glufosinate N-acetyltransferase gene, a fungal transformation selection marker, controlled by PtrpC; Amp r This is an ampicillin resistance gene used as a screening marker for E. coli transformation.

[0049] Figure 2 Map of the overexpression backbone vector Pk2-Pc-Sur-Tc-PB3.

[0050] PC and TC are derived from the promoter and terminator of the tryptophan synthase gene from Aspergillus nidulans; Sur is the herbicide chlorine.

[0051] Sulfonamide resistance gene; PB3 is the promoter of the glyceraldehyde-3-phosphate dehydrogenase gene from Beauveria bassiana (Luet al., 2021, Environ Microbiol 23(2): 1256–1274); Kan is the kanamycin resistance gene, used as a marker for transformation and selection in Escherichia coli.

[0052] Figure 3 Schematic diagram of the BbEng1 protein structure.

[0053] In the diagram, the red region represents the signal peptide, and the blue region represents the GH16_fungal_Lam16A_glucanase (GH16) domain. △ and ▲ represent the catalytic site and N-glycosylation site, respectively.

[0054] Figure 4 pBARGPE1-GFP vector map

[0055] Among them, gpdA is the promoter of the glyceraldehyde-3-phosphate dehydrogenase gene gpdA in Aspergillus nidulans, which is a constitutive promoter in fungi; GFP is the green fluorescent protein encoding gene, which is under the control of gpdA; TrpC promoter is the promoter of tryptophan synthase in Aspergillus nidulans, which is a constitutive promoter in fungi; bar is the herbicide glufosinate N-acetyltransferase gene, which is a fungal transformation selection marker and is under the control of TrpC promoter; Amp is the ampicillin resistance gene, which is used as a transformation selection marker for Escherichia coli.

[0056] Figure 5 Map of the BbEng1::GFP fusion expression vector

[0057] This vector encodes the BbEng1 fusion GFP protein, which is the BbEng1 gene (4168 bp, including a 2194 bp promoter sequence with the stop codon removed) cloned into the NdeI and EcoRV restriction sites of the pBARGPE1-GFP vector.

[0058] Figure 6 Results of BbEng1 gene expression pattern

[0059] A represents the transcriptional level of BbEng1 in different morphological cells of Beauveria bassiana; B represents the GFP fluorescence observation of BbEng1::GFP strain in different morphological cells. AHY, CO, LHY, BL, and HB represent aerial hyphae, conidia, liquefied hyphae, budding spores, and worm-celled mycelia, respectively; C represents the transcriptional pattern of BbEng1 under different carbon source nutritional conditions analyzed by RT-qPCR. Different carbon source conditions were used, including basal medium (CZB), nutrient-rich medium (1 / 4 SDB), medium in which sucrose in Czapek's medium was replaced with glucose, trehalose, chitin, and dextran, 0.167 mg / ml insect cuticle, and 0.5 ml / l insect hemolymph, all with an induction time of 6 h. D shows the GFP fluorescence observation of BbEng1::eGFP induced by different carbon source media; E shows the transcriptional level of BbEng1 over time under insect hemolymph and cuticle induction conditions analyzed by RT-qPCR; F shows the GFP fluorescence observation of BbEng1::GFP strains induced by insect nutrients (hemolymph and cuticle) at different induction times. bar = 5 μm.

[0060] Figure 7 Cellular distribution and secretion characteristics of BbEng1 in Beauveria bassiana.

[0061] A shows the GFP fluorescence of BbEng1::GFP at different time points in the morphology of Beauveria bassiana mycelium; B shows the GFP fluorescence distribution on the surface of BbEng1::GFP mycelium outside the cell membrane stained with FM4-64; C shows the detection of BbEng1 secreted by wild-type Beauveria bassiana (WT) strains in the supernatant induced by insect hemolymph and in vitro insect nutrients (cuticle or hemolymph) by Western blotting. The primary antibody was BbEng1 polyclonal rabbit anti-antibody, and the secondary antibody was goat anti-rabbit anti-antibody; Bar = 10 μm.

[0062] Figure 8 BbEng1 gene knockout, reverse complementation, and overexpression strategies and molecular validation.

[0063] A is a diagram illustrating the BbEng1 gene knockout vector construction strategy. Crossover events marked "X" indicate homologous recombination, where a specific region of BbEng1 is replaced by the bar gene. B shows the overexpression and reversal complementation vector construction strategies. Using pBARGPE1 as the backbone vector, the BbEng1 coding frame was placed downstream of the constitutive promoter gpdA to construct the overexpression vector. C shows the reversal complementation vector pCB-BbEng1 using sur as a selection marker. D shows PCR amplification using S1 / S2 as selection primers to screen and verify knockout and reversal strains. E shows RT-PCR verification of knockout and reversal strains. F shows Real-time RT-PCR detection of BbEng1 transcription levels in WT and BbEng1 overexpression transformants. G shows Southern blot detection of ΔBbEng1 and Comp strains. Genomes were digested using Hind III; ΔBbEng1 used a bar probe, and Comp used a sur probe.

[0064] Figure 9 Pk2-Gus vector map

[0065] Among them, PtrpC and TtrpC are the promoter and terminator of the tryptophan synthase gene from Aspergillus nidulans; Gus is the β-glucuronidase gene, used for random insertion screening.

[0066] Figure 10 Pk2-PtrpC-Sur-Ttrpc vector map

[0067] Among them, PtrpC and TtrpC are the promoter and terminator of the tryptophan synthase gene from Aspergillus nidulans; Sur is the herbicide chlorimuron resistance gene, used as a marker for fungal transformation screening.

[0068] Figure 11 Validation and enzymatic characteristics of BbEng1 expression in Pichia pastoris

[0069] A shows the SDS-PAGE analysis of purified BbEng1; B shows the Western blot detection of BbEng1 binding to various insoluble polysaccharides; C shows the immunoblotting quantitative results of BbEng1 binding to insoluble polysaccharides using Image software; D and E show FITC-labeled BbEng1 protein (BbEng1...). FITCFITC fluorescence observation and FITC fluorescence intensity quantification results of the binding of BbEng1 with several insoluble polysaccharides; F is the TLC spectrum of the hydrolysis reaction of BbEng1 with several polysaccharides. G1 ~ G5 are standard sugars: glucose (G1), maltose (G2), maltotriose (G3), maltotetraose (G4), and maltopentose (G5); G is the HPLC analysis of the degradation products of BbEng1 with several polysaccharides. The concentration of BbEng1 protein used in these experiments was 20 µg / ml. Insoluble polysaccharides include: barley β-glucan, Pustulan, sodium carboxymethyl cellulose (CMC-Na), Pachyma, Chitosan, and cuticle (1%, w / v); soluble polysaccharides include: yeast glucan, laminarin, and dextran (1%, w / v).

[0070] Figure 12 HPLC was used to verify the hydrolytic activity of BbEng1 on insect nutrients. High-performance liquid chromatography (HPLC) was used to detect the degradation products of BbEng1 on the insect body wall, hemolymph, and trehalose.

[0071] Figure 13 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE Colony growth, sporulation and morphology, and spore germination rate of the strain.

[0072] A shows the colony morphology on media with different carbon sources; B shows the growth rate on media with different carbon sources; C shows the sporulation structure; D shows the conidium yield on basal medium (CZA) and nutrient-rich medium (1 / 4 SDAY); E shows the conidium morphology; F shows the conidium abundance statistics for different areas; G shows the conidium germination rate curves for each strain.

[0073] Figure 14 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE ) Mycelial morphology of the strain.

[0074] A shows the morphology of hyphae on basal medium (CZA); B shows the fluorescence image of germinating hyphae stained with fluorescent whitening agent (CFW), a cell wall-specific dye; C shows the bidirectional germination rate; D shows the fluorescence image of germinating hyphae stained with fluorescent whitening agent (CFW) and the nuclear-specific dye propidium iodide (PI); E shows the number of septa and nuclei per 50 μm hyphae; bar = 20 μm.

[0075] Figure 15 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE )Strain cell wall structure and composition.

[0076] A shows transmission electron microscopy (TEM) images of the fungal cells of each strain; B shows the thickness of the fungal cell wall; C shows the levels of chitin and dextran in the cell walls of each strain of fungal cells determined by staining with Calcofluor White Stain (CFW) and Aniline blue, based on fluorescence values; D shows the fluorescence intensity of the fluorescence images acquired by the Leica SP8 laser confocal microscope, calculated using Image J; Bar = 5 μm.

[0077] Figure 16 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE ) Bacterial bioassay.

[0078] A is an inoculation via the body wall at a concentration of 3×10⁻¹ ml. 7 Survival trend of test insects after conidia (spores / ml); B represents microinjection of 2 μl at a concentration of 5×10⁻⁶. 6 The survival rate trend of test insects after spore suspension of spores / ml is introduced into the hemocoel of the test insects; C shows the morphology, hyphae penetration and sporulation of *Hemiberlesia lataniae* after body wall inoculation; D shows the morphology, hyphae penetration and sporulation of *Hemiberlesia lataniae* after injection inoculation.

[0079] Figure 17 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE The immune response and proliferation of insects after inoculation with the strain.

[0080] A is an inoculation method using the cell wall, with a concentration of 3×10⁻¹¹ ml. 7 / ml of conidia resulted in a blackening reaction on the surface of the test insect; B was a micro-injection of 2 μl at a concentration of 5 × 10⁻⁶. 6 / ml of conidia were injected into the hemocoel of the test insect, resulting in a blackening reaction on the insect's surface; C is a micro-injection of 2 μl at a concentration of 5 × 10⁻⁶. 6 Microscopic observation of fungal growth, development, and immune response in the hemocoel of insects after conidia of various strains (bar = 20 μm); D represents the quantitative data of insect-bacterial cells 36 h, 48 h, and 60 h after microinjection. qPCR was used.

[0081] Figure 18 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE Humoral immune response of strain )

[0082] A shows the PO activity curves in the hemolymph samples of *Euonymus alatus* after injection inoculation with various bacterial strains; B shows the changes in H2O2 (ROS) levels in the hemolymph of *Euonymus alatus* after micro-injection inoculation with various bacterial strains; C shows the transcription patterns of antimicrobial peptide-related genes and Toll pathway genes in the fat body of *Euonymus alatus* 12 h and 24 h after injection inoculation. Actin from *Euonymus alatus* was used as an internal control. The inoculation amount was 5 × 10⁻⁶. 6 Spores / ml, 2 μl / worm.

[0083] Figure 19 Wild-type Beauveria bassiana (WT), BbEng1 gene knockout (ΔBbEng1), complementation (Comp), and overexpression (BbEng1) were compared between different strains. OE ) Ebacterial and worm epitopes and pathogen-associated molecular models

[0084] A is a fluorescence image of carbohydrate epitopes and β-1,3-glucan levels on the surface of lectin mycelia labeled with Alexa Fluor 488. B is the average fluorescence measured using Image software for at least 100 individual cells.

[0085] Figure 20 Pk2-Pc-Sur-Tc-PB3::BbEng1 vector map

[0086] The coding region of the BbEng1 gene (1767 bp) was cloned into the BamHⅠ and EcoRV sites of Pk2-Pc-Sur-Tc-PB3 and placed under the control of the constitutive promoter PB3 to construct an overexpression vector.

[0087] Figure 21 Schematic diagram of the construction of vectors for overexpressing BbEng1, MrEng1 and MaEng1, and the strategy for constructing overexpression vectors for strain screening.

[0088] A. Using Pk2-Pc-Sur-Tc-PB3 as the backbone vector, the coding frames of BbEng1, MrEng1, and MaEng1 were placed downstream of the constitutive promoter PB3 to construct an overexpression vector. B. Real-time RT-PCR detection of the transcriptional level of BbEng1 in overexpressing BbEng1 transformants of *Metarhizium anisopliae* Roberts; C. Real-time RT-PCR detection of the transcriptional level of BbEng1 in overexpressing BbEng1 transformants of *Metarhizium anisopliae* locust; D. Real-time RT-PCR detection of the transcriptional level of MrEng1 in *Metarhizium anisopliae* WT and overexpressing MrEng1 transformants; E. Real-time RT-PCR detection of the transcriptional level of MaEng1 in *Metarhizium anisopliae* WT and overexpressing MaEng1 transformants.

[0089] Figure 22 Metarhizium anisopliae and Metarhizium locustii strains overexpressing BbEng1, MrEng1, and / or MaEng1 compared to their wild-type strains in terms of growth, sporulation, and spore germination.

[0090] A shows the colony morphology of each strain on basal medium (CZA) and nutrient-rich medium (PDA); B shows the growth status of each strain on liquid medium (1 / 4 SDY); C shows the conidium yield of each strain on basal medium (CZA); D shows the conidium germination rate curve and germination time (GT) of each strain on basal medium (CZA). 50 ).

[0091] Figure 23 Bioassay of *Metarhizium anisopliae* and *Metarhizium locustii* strains overexpressing BbEng1, MrEng1, and / or MaEng1 compared with their wild-type strains.

[0092] A represents the administration of 1 ml of a 3×10⁻⁶ concentration via cell wall inoculation. 7 Spores / ml *Metarhizium anisopliae* wild-type (WT), *Metarhizium anisopliae* strain overexpressing BbEng1 (Mr-BbEng1) OE ) and the Roberts' Metarhizium anisopliae strain (Mr-MrEng1) that overexpresses MrEng1 OE The survival rate trend of *Metarhizium anisopliae* larvae after conidia; B represents the micro-injection of 2 μl of each strain of *Metarhizium anisopliae* at a concentration of 5 × 10⁻⁶. 6 The survival rate trend of test insects after spore suspension at spore / ml was added to the hemocoel of *Hemiberlesia lataniae*; C represents the inoculation of 5 μl of 3×10⁻⁶ spores via dorsal plate dripping. 7 wild-type (WT) Metarhizium anisopliae with spores / ml, and Metarhizium anisopliae overexpressing BbEng1 (Ma-BbEng1) OE) and overexpression of MaEng1 in Metarhizium anisopliae (Ma-MaEng1) OE Survival trend of East Asian migratory locusts after conidia; D represents the micro-injection of 2 μl of each strain of Metarhizium anisopliae at a concentration of 5×10⁻⁶. 6 The survival rate trend of test insects after spore suspension of spores / ml was introduced into the hemocoel of the giant wax moth.

[0093] Figure 24 MrEng1 protein structure diagram

[0094] Figure 25 Expression patterns of MrEng1 and MaEng1 in different cell morphologies

[0095] RT-qPCR was used to analyze the expression pattern of MrEng1 in different morphological cells of Metarhizium anisopliae, with the glyceraldehyde-3-phosphate dehydrogenase gene Mrgpd of Metarhizium anisopliae was used as the reference gene; the expression pattern of MaEng1 in different morphological cells of Metarhizium locust was used with the glyceraldehyde-3-phosphate dehydrogenase gene Magpd of Metarhizium locust was used as the reference gene.

[0096] Figure 26 Pk2-Pc-Sur-Tc-PB3::MrEng1 vector map

[0097] The coding region of the MrEng1 gene (1487 bp) was cloned into the BamHⅠ and EcoRV sites of Pk2-Pc-Sur-Tc-PB3 and placed under the control of the constitutive promoter PB3 to construct an overexpression vector.

[0098] Figure 27 MaEng1 protein structure

[0099] Figure 28 Pk2-Pc-Sur-Tc-PB3::MaEng1 vector map

[0100] The coding region of the MaEng1 gene (1520 bp) was cloned into the BamHⅠ and EcoRV sites of Pk2-Pc-Sur-Tc-PB3 and placed under the control of the constitutive promoter PB3 to construct an overexpression vector.

[0101] Figure 29 Commonalities between BbEng1, MrEng1, and MaEng1

[0102] In this diagram, A is a schematic representation of the structures of BbEng1, MrEng1, and MaEng1, where SP represents the signal peptide, GH16 represents the GH16_fungal_Lam16A_glucanase domain, and ▲ and △ represent the catalytic and active sites, respectively; B shows the amino acid sequence alignment results of the domain regions of BbEng1, MrEng1, and MaEng1 (using the Clustal W method), where SP represents the signal peptide, GH16 represents the GH16_fungal_Lam16A_glucanase domain, and * represents cysteine ​​residues; C shows the transcriptional level of BbEng1 in different morphological cells of *Beauveria bassiana*, with 18S rRNA (Gen-Bank ID: EU334679) as the reference gene; D shows the transcriptional level of MrEng1 in different morphological cells of *Metarhizium anisopliae* using Mrgpd (Gen-Bank ID: 19261961) as the reference gene; E shows the transcriptional level of MrEng1 in different morphological cells of *Metarhizium anisopliae* using Magpd (Gen-Bank ID: 19261961) as the reference gene; and E shows the transcriptional level of MrEng1 in different morphological cells of *Metarhizium anisopliae* using Magpd (Gen-Bank ID: 19261961). (19253895) is the reference gene for detecting the transcription level of MaEng1 in different morphological cells of Metarhizium anisopliae; AHY, CO, LHY, BL and HB represent aerial hyphae, conidia, liquid hyphae, budding spores and insect cells, respectively. Detailed Implementation

[0103] The advantages and features of the present invention can be further understood through the following examples, but should not be construed as limiting the scope of the present invention.

[0104] Unless otherwise specified, all instruments and reagents used in the following examples are commercially available.

[0105] Description of the overexpressed target gene (Eng1, a secretory glucanase gene from insect biocontrol fungi):

[0106] BbEng1 is a specific surface protein library isolated from the endocytic cells (insect-bacterial cells) of *Beauveria bassiana* that invade insects. Its genome annotation is Concanavalin A-like lectin / glucanase (BBA_04753) (Yang et al., 2015, Fungal Genet Biol 99:13-25). The BbEng1 coding region (1974 bp) contains three introns, encoding a protein of 588 amino acid residues (64.4 kDa).

[0107] Using the amino acid sequence of Beauveria bassiana BbEng1 as a probe, the genomes of Metarhizium anisopliae Roberts (GenBank: GCA_000187425.2) and Metarhizium locust (GenBank: GCA_000187405.1) were searched using blastp. The homologous protein encoding genes MrEng1 (MAA_09026, 52.9% similarity) and MaEng1 (MAC_06610, 55.6% similarity) were cloned, respectively. The genomes were annotated as Concanavalin A-like lectin / glucanase and β-1,3-endoglucanase genes, respectively, encoding proteins of 432 (48.1 kDa) and 448 amino acid residues (49.9 kDa), respectively.

[0108] Protein domain analysis using the blastp program from the Uniprot website (https: / / www.uniprot.org / ) revealed that BbEng1, MrEng1, and MaEng1 have similar structures, containing a conserved GH16 (GH16_fungal_Lam16A_glucanase) domain, an N-terminal signal peptide sequence, no transmembrane structure, no GPI anchoring site, multiple glycosylation sites, and multiple cysteine ​​residues that are receptor binding and / or catalytic sites. Figure 29 Expression analysis showed that the three genes BbEng1, MrEng1, and MrEng1 had the same expression pattern and were specifically expressed in the larval cells proliferating within insects.

[0109]

Example 1

[0110] 1. Domain analysis of BbEng1 protein

[0111] BbEng1 was isolated from a library of surface proteins specific to the endocytic cells (insect-bacterial cells) of *Beauveria bassiana* that infect insects. Its genome annotation is *Concanavalin A-like lectin / glucanase* (BBA_04753) (Yang et al., 2015, Fungal Genet Biol 99:13-25). The coding region of BbEng1 (1974 bp) contains three introns, encoding a protein of 588 amino acid residues (64.4 kDa). Using the blastp program from the Uniprot website (https: / / www.uniprot.org / ), protein domain analysis revealed that BbEng1 contains a GH16 (GH16_fungal_Lam16A_glucanase) domain located at amino acid 52 to 293. The N-terminus includes a signal peptide sequence, lacks transmembrane structures and GPI anchoring sites, contains multiple glycosylation sites and multiple cysteine ​​residues, suggesting the presence of disulfide bonds. The five hypothetical active sites are located at amino acids 126-130, 141-146, 155-157, 203, and 277-279, and are receptor binding and / or catalytic sites. Figure 3 ).

[0112] 2. Obtaining fluorescently tagged strain BbEng1::GFP

[0113] Vector construction: Using Beauveria bassiana genomic DNA as a template, the BbEng1 gene (4168 bp, including a 2194 bp promoter sequence with the stop codon removed) was amplified using primer pair LF / LR and cloned into the pBARGPE1-GFP vector. Figure 4 The NdeI and EcoRV restriction sites were replaced with the constitutive promoter PgpdA to construct the BbEng1::GFP fusion gene (SEQ ID NO. 1) expression vector. Figure 5 ).

[0114] The BbEng1 gene amplification system is as follows: 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL each of 5 μmol / L primers LF and LR, and the wild-type gene of Beauveria bassiana.

[0115] Group 20 ng, with water added to a final volume of 25 μl. The amplification program was: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 4 min.

[0116] 35 cycles, 3 min; extension at 72 ℃ for 10 min.

[0117] Genetic transformation and transformant validation: The fluorescent tag vector BbEng1::GFP was transformed into wild-type Beauveria bassiana using PEG-mediated spore transformation (Ying et al., 2006, ApplMicrobiol Biotechnol 72:206–210). Resistant colonies were screened on Czapek-Dox agar plates containing 200 μg / ml glufosinate and 500 μg / ml cefaclor. Transformant hyphae were lysed using lysis buffer, and 3 μl of the lysis buffer was used as a template. The BbEng1::GFP plasmid was used as a positive control, and PCR amplification was performed using primers RT1 and GFP-R for validation.

[0118] LF1: 5'-CGGTATTTCACACCGCATATGTAGCTGATGCTCTCCGCGTC-3' (SEQ ID NO.2)

[0119] LR1: 5'-GCCCTTGCTCACCATGATATCGGCACGGCAGATTTGGTTGG-3' (SEQ ID NO.3)

[0120] RT1: 5'-CTACAAGCCAGAGTCGTCCTC-3' (SEQ ID NO.4)

[0121] GFP-R: 5'-TCTCGTTGGGGTCTTTGCTC-3' (SEQ ID NO.5)

[0122] 3. Expression characteristics of BbEng1

[0123] To investigate the expression pattern of BbEng1, RT-qPCR and fluorescent tagging technology (BbEng1::GFP) were used to analyze its expression characteristics. The collection methods for mycelial samples under different cell morphologies, different carbon source culture media induction conditions, and insect nutrient induction conditions are as follows:

[0124] Aerial hyphae and conidia collection: Prepare a 1×10⁻⁵ Tween-80 solution using 0.05% (v / v). 7A suspension of Beauveria bassiana conidia with a spore count / ml was inoculated at 100 μl onto 1 / 4 SDAY solid medium lined with cellophane using the spread plate method. The medium was incubated upside down at 26°C for 3 days, and aerial mycelia were collected. After 10 days of incubation, the mycelia on the cellophane were collected, thoroughly resuspended in 0.05% (v / v) Tween-80, filtered through four layers of lens paper to remove mycelia, centrifuged the filtrate, and washed twice with sterile ddH2O to obtain the conidia sample.

[0125] Collection of liquefied mycelia and budding spores: Prepare a solution with a concentration of 1×10 7 A suspension of Beauveria bassiana conidia with a spore count / ml was inoculated into 50 ml of 1 / 4 SDY liquid medium at 26 ℃ and 200 rpm for 2 days. The culture medium was then removed, and the solid precipitate was the liquefied mycelium. The same procedure was repeated for another 4 days. The mycelium was removed by filtration through four layers of lens paper. The filtrate was centrifuged and washed twice with sterile ddH2O to obtain the budding spore sample.

[0126] Insect and fungal cell collection: Following the method of Yang et al. (Fungal Genet Biol, 2017, 99: 13–25), a concentration of 1×10⁻⁶ was prepared. 7 A spore / ml conidial suspension was microinjected at 2 μl into third-instar larvae of the large wax moth. The larvae were collected on ice after 2 days of proliferation in the hemocoel. The larvae were washed three times with pre-chilled 0.1 M PBS and centrifuged at 10,000 rpm for 5 min. The larvae were resuspended in pre-chilled 0.1 M PBS (1 mM CaCl2, pH 8.0) for later use. In a 10 ml centrifuge tube, 3 ml of 50% centricoll was slowly added to the bottom. After the surface was level, 3 ml of 25% centricoll separation buffer was slowly added. Finally, 1 ml of cell suspension was gently added on top of the separation buffer. The tube was centrifuged at 4 °C and 10,000 rpm for 5 min, and the precipitate was collected as the larvae.

[0127] Sample collection for induction culture with different carbon sources: 100 μl of 1×10⁻⁶ carbon source was inoculated. 7A suspension of *Beauveria bassiana* BbEng1::GFP conidia with spores / ml was added to 200 ml of 1 / 4 SDY medium and cultured for 3.5 days. The mycelia were removed by filtration through four layers of lens paper. The filtrate was centrifuged, washed twice with sterile ddH2O, and divided into six equal portions. Each portion was placed in 30 ml of induction medium and incubated for 6 hours. The induced cells were then collected. 50 μl of each portion was used for microscopic observation. The induction media included basal medium (CZB), nutrient-rich medium (1 / 4 SDB), a medium in which sucrose in Czapek's medium was replaced with glucose, trehalose, chitin, and dextran, and basal salt medium (BS) containing 0.167 mg / ml insect cuticle and 0.5 ml / l insect hemolymph.

[0128] Samples collected at different times during insect nutrient induction: 50 μl of 1×10⁻⁶ solution was inoculated. 7 A spore / ml suspension of Beauveria bassiana BbEng1::GFP conidia was added to 30 ml 1 / 4 SDY medium and cultured for 3.5 days. The mycelia were removed by filtration through four layers of lens paper. The filtrate was centrifuged, washed twice with sterile ddH2O, and divided into two portions. Each portion was placed in 30 ml of basal salt medium containing 0.167 mg / ml insect cuticle and 0.5 ml / l insect hemolymph. Cells were collected at 0, 4, 8, and 12 h for RNA extraction, and samples were also taken for microscopic observation.

[0129] RNA extraction was performed using the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 1 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl. Using 18S rRNA (Gen-Bank ID: EU334679) as the reference gene, RT-qPCR was used to detect BbEng1 transcription. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃ with a 0.5 ℃ increase every 5 s. The primer pairs for amplifying 18S rRNA and BbEng1 transcripts were 18S rRNA-F / 18S rRNA-R and RT1 / RT2, respectively.

[0130] Transcriptional analysis showed that BbEng1 was transcribed at high levels only in the insect-bacterial morphology, while transcription was extremely low or nonexistent at the cellular level in the saprophytic morphology. Figure 6 A). The fluorescence of GFP was observed using the fluorescently tagged strain BbEng1::GFP, and the transcription and protein expression levels of BbEng1 were detected. This also verified that BbEng1 protein is expressed only in the worm-bacterial morphology. Figure 6 B).

[0131] To clarify the relationship between BbEng1 and carbon source utilization, RT-qPCR was used to detect the expression pattern of BbEng1 under different carbon source conditions. The results showed that BbEng1 was transcribed at low levels after 6 h of induction in basal medium (CZB), medium with different carbon sources replacing sucrose in Czapek's medium (CZB), and nutrient-rich medium (1 / 4 SDB). However, high-level transcription was observed after 6 h of induction in a medium with insect body wall and insect hemolymph as the sole nutrients. Figure 6 C), the GFP fluorescence observation results of the BbEng1::GFP strain were consistent with the RT-qPCR results, and the GFP fluorescence was mainly distributed in the newly grown cell parts. Figure 6 D). When insects were cultured using only their body wall and hemolymph as the sole nutrient source for different time periods, BbEng1 transcription began at 4 hours of nutrient induction, and the transcriptional level significantly increased with prolonged induction time. Figure 6 E). Furthermore, the GFP fluorescence of the BbEng1::GFP strain is mainly distributed in the newly grown cell parts (E). Figure 6 F). It is inferred from this that BbEng1 is related to insect nutrient utilization.

[0132] 18S rRNA-F: 5'- ACGGGTAACGGAGGGTTAGG -3' (SEQ ID NO.6)

[0133] 18S rRNA-R: 5'-AGTACACGCGGTGAGGCGGA -3' (SEQ ID NO.7)

[0134] RT2: 5'-AGGTGCCCTGCTGGAT-3' (SEQ ID NO.8)

[0135] 3. Cell distribution and secretion characteristics of BbEng1 in Beauveria bassiana

[0136] To investigate the distribution and secretion characteristics of BbEng1 in cells, and to observe the morphological distribution of GFP fluorescence in the insect and bacterial cells of BbEng1::GFP, the cell membrane was stained with the fluorescent membrane dye FM4-64 (Thermo). It was found that BbEng1 is distributed extracellularly—on the cell wall and / or cell surface. Figure 7 A and B). Hemolymph from the proliferation of bacteria in the insect hemocoel and supernatant from the in vitro insect-induced culture were collected, respectively. The bacterial cells were filtered off, and proteins were precipitated. Western blotting was performed using BbEng1 polyclonal rabbit anti-antibody as the primary antibody and goat anti-rabbit secondary antibody. Results showed that BbEng1 was detected in both insect hemolymph and the in vitro insect nutrient-induced culture medium. Figure 7 C) indicates that BbEng1 can be secreted into insect hemolymph and insect nutrient culture medium.

[0137] 4. Utilizing homologous recombination to disrupt Beauveria bassiana BbEng1

[0138] The strategy for constructing a homologous recombination expression vector for the BbEng1 coding region of *Beauveria bassiana* is as follows: The expression element (SEQ ID NO. 9) of the bar gene is used to replace a portion of the coding region of BbEng1. Specifically, flanking sequences of BbEng1 are appended to both ends of the bar expression element to construct a homologous recombination expression vector. This vector is then introduced into *Beauveria bassiana* via genetic transformation. The flanking sequences of BbEng1 appended to the vector undergo double exchange with homologous sequences in the *Beauveria bassiana* genome, replacing a portion (349 bp) of the BbEng1 coding region, thus disrupting the target domain coding region. Figure 8 A). The gene sequence in which the bar expression element sequence replaces a portion of the coding region of Beauveria bassiana BbEng1 is shown in SEQ ID NO.10.

[0139] The specific steps are as follows:

[0140] Primer pairs L1 / L2, R1 / R2, and B1 / B2 were designed based on the BbEng1 sequence and the bar expression element sequence of the glufosinate resistance gene. The 5' and 3' end sequences of BbEng1 and the bar gene expression element sequence were amplified, respectively. Overlap PCR was used to fuse these elements, which were then cloned into the pPk2 vector (Fungal Genetics StockCenter; McCluskey, 2003, Adv Appl Microbiol 52: 245–262) containing the gus gene replacing the hygromycin resistance gene hyg. Figure 9 Using Beauveria bassiana genomic DNA as a template, the 5' end (847 bp) and 3' end (988 bp) sequences of BbEng1 were amplified using primer pairs L1 / L2 and R1 / R2, respectively. Using pUC-bar (Fan et al., 2011, J Invertebr Pathol 106:274–279) as a template, the bar element was amplified using primer pair B1 / B2. Then, the fusion element L::bar::R was obtained by overlap PCR. The overlap PCR amplification system was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 200 ng each of the L fragment, bar element, and R fragment, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, and water to a final volume of 25 μl. The amplification program was as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 45 s, 72 ℃ for 2.5 min, 20 cycles; extension at 72 ℃ for 10 min. Then, using 1 μl of the amplification product as a template, the L::bar::R fusion fragment was amplified using primers L1 and R2. The amplification system was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / L primers L1 and R2, 1 μl of the amplification product, and water to a final volume of 25 μl. The amplification program was as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 2.5 min, 35 cycles; extension at 72 ℃ for 10 min. The amplified products were subjected to 1.0% (w / v) agarose gel electrophoresis, and the amplified fragments were recovered and sequenced for verification. The fusion fragment was then digested with EcoRI and BamHI and ligated into PK2-gusT digested with the same enzymes to form the homologous recombinant expression vector pΔBbEng1. Figure 8).

[0141] The expression vector pΔBbEng1 was transformed into Agrobacterium tumefaciens strain AGL-1, following the method of Fang et al. (2004, J Invertebr Pathol 85:18-24). Then, conidia of Beauveria bassiana were transformed using Agrobacterium tumefaciens-mediated transformation (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898). Resistant colonies were screened on Czapek-Dox agar plates containing 200 μg / ml of glufosinate. DNA was extracted from resistant transformants, and gene-disruption mutants were screened using primers S3 / S4. Transformants with random insertion amplified two bands: one containing a partial homologous recombination element (1263 bp) and the other containing a partial wild-type gene fragment (812 bp). Transformants with gene disruption only amplified the partial homologous recombination element fragment (1263 bp), while wild-type strains only showed the wild-type band (812 bp). Based on this protocol, the gene-disruption mutant ΔBbEng1 was screened. Figure 8 D).

[0142] RT-PCR assays confirmed that BbEng1 was not transcribed in the gene knockout mutant strain. The RT-PCR procedure was as follows: using 0.05%...

[0143] (vol / vol) Tween-80 is prepared at a concentration of 1×10⁻⁶. 7Spore / ml conidial suspension was inoculated into third-instar larvae of the large wax moth using a microinjection method, 2 μl / larva, and cultured at 26 ℃ for 48 h. The larvae were then collected, and RNA was extracted. The RNA was then reverse transcribed to synthesize the first strand of cDNA. RT-PCR expression analysis was performed using the same treatment as the wild-type strain (WT) as a control. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 2 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription should be performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). Dilute the synthesized cDNA first strand to 10 ng / μl. Amplify the transcription of the BbEng1 coding region using RT-PCR with 18S rRNA (Gen-Bank ID: EU334679) as the reference gene. The primers for amplifying 18S rRNA and BbEng1 are 18S rRNA-F / 18S rRNA-R and RT1 / RT2, respectively. The amplification system is as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / L primers, 1 μl of diluted cDNA first strand template, and water to a final volume of 25 μl. The amplification program is as follows: 95 ℃ for 5 min; 95 ℃ for 2 min. 30 s, 55 ℃ 30 s, 72 ℃ 30 s, 25 cycles; extension at 72 ℃ for 10 min. The amplified products were analyzed by 1.0% (w / v) agarose gel electrophoresis to detect BbEng1 transcription. The primer pairs for amplifying 18S rRNA and BbEng1 were 18S rRNA-F / 18S rRNA-R and RT1 / RT1, respectively. The results showed that BbEng1 could not be transcribed normally in the knockout mutant. Figure 8 E).

[0144] Genomic DNA was extracted from the gene-damaging mutant, digested with HindIII, and separated by 1.0% agarose gel electrophoresis. The DNA was then transferred to a nylon membrane (Hybond™-N nylon membrane, Amersham Biosciences, USA) using a high-salt transfer method. The bar gene fragment (411 bp) (SEQ ID NO. 11) was amplified using primers B3 / B4. Hybridization was performed using a digoxigenin-labeled probe. Transformants with a single-copy insertion were confirmed as single-copy gene-damaging transformants. Figure 8G). For specific procedures, refer to the DIG-High Prime DNA labeling and detection starter kit (Roche).

[0145] L1: 5'-ACATGATTACGAATTCGGGTGTCTGTTTTGTGTGCG-3' (SEQ ID NO.12)

[0146] L2: 5'-CAATGTCATCTTCTGTCGACCTGTATGGCGTGTGAGGCAA-3' (SEQ ID NO.13)

[0147] R1: 5'-TGCCCGTCACCGAGATCTAAGTACAATTCCGGATCGGCCA-3' (SEQ ID NO.14)

[0148] R2: 5'-CAACACTAGTGGATCCGGTTCTCGGCAACGTACTGA-3' (SEQ ID NO.15)

[0149] B1: 5'-TTGCCTCACACGCCATACAGGTCGACAGAAGATGACATTG-3' (SEQ ID NO.16)

[0150] B2: 5'-TGGCCGATCCGGAATTGTACTTAGATCTCGGTGACGGGCA-3' (SEQ ID NO.17)

[0151] B3: 5'-ACCTTCTTAAGTTCGCCCTT-3' (SEQ ID NO.18)

[0152] B4: 5'-GTAGAGCGTGGAGCCCAGT-3' (SEQ ID NO.19)

[0153] S3: 5'-TGGTAGCACTCTCGCAGTTG-3' (SEQ ID NO.20)

[0154] S4: 5'-CTCAAAGTCCACGCCCAGAT-3' (SEQ ID NO.21)

[0155] 2. Reversal of complementary BbEng1 disruptive mutant

[0156] Using Beauveria bassiana genomic DNA as a template, the BbEng1 gene (including the promoter sequence, coding region, and terminator sequence, totaling 4118 bp) was amplified using primers pRC1 / pRC2 (with BamHI and XbaI restriction sites introduced at the 5' ends of pRC1 and pRC2, respectively; primer sequences are attached below). The amplified fragment was digested with BamHI and XbaI and cloned into the vector Pk2-PtrpC-Sur-TtrpC, which was digested with the same restriction enzymes. Figure 10 On ), the carrier PK2-Sur-BbEng1 is formed. Figure 8 C) The vector carries the chlorimuronethyl resistance gene *sur*. The expression vector PK2-sur-BbEng1 was transformed into *Agrobacterium tumefaciens* strain AGL-1, following the method of Fang et al. (2004, J Invertebr Pathol 85:18-24). Then, *Agrobacterium tumefaciens*-mediated transformation was used to transform conidia of the *Beauveria bassiana* ΔBbEng1 mutant (Ma et al., 2009, ApplMicrobiol Biotechnol 82: 891–898). After transformation, resistant colonies were screened on Czapek-Dox agar containing 4 μg / ml chlorimuronethyl. DNA from the resistant colonies was extracted, and transformants were verified using primers S3 / S4. If BbEng1 is successfully introduced into the ΔBbEng1 mutant, two bands will be amplified: one containing a partial homologous recombination element of the bar gene (1263 bp), and the other containing a partial fragment of the wild-type gene (812 bp). Figure 8 D).

[0157] RT-PCR was used to verify whether BbEng1 in the transformants had resumed normal transcription. The RT-PCR procedure was as follows: 0.05% (vol / vol) Tween-80 was prepared at a concentration of 1×10⁻⁶. 7A spore / ml conidial suspension was microinoculated into third-instar larvae of the large wax moth (2 μl / larva), and cultured at 26℃ for 48 h. The larvae were then collected, and RNA was extracted. The RNA was reverse transcribed to synthesize the first strand of cDNA. RT-PCR expression analysis was performed using the same treatment as the wild-type strain (WT) as a control. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 2 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). Dilute the synthesized cDNA first strand to 10 ng / μl. Using 18S rRNA (Gen-Bank ID: EU334679) as the reference gene, RT-PCR was used to amplify the transcription of the BbEng1 coding region. The primers for amplifying 18S rRNA and BbEng1 were 18S rRNA-F / 18S rRNA-R and RT1 / RT2, respectively. The amplification system was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl of each of 5 μmol / L primers, 1 μl of diluted cDNA first strand template, and water to a final volume of 25 μl. The amplification program was as follows: 95 ℃ for 5 minutes. The amplification process was performed at 95 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 30 s for 25 cycles, followed by a 10-min extension at 72 ℃. The transcription of BbEng1 was detected by 1.0% (w / v) agarose gel electrophoresis. The results showed that BbEng1 was transcribed normally in reversible complementary transformants, with transcription levels consistent with the wild type. Figure 8 ).

[0158] Genomic DNA was extracted from the reciprocal complementary transformants, digested with HindIII, and separated by 1.0% agarose gel electrophoresis. The DNA was then transferred to a nylon membrane (Hybond) using a high-salt transfer method. TM -N nylon membrane, Amersham Biosciences, USA), then the Sur fragment (380 bp) (SEQ ID NO.22) was amplified using primers Sur1 / Sur2 as a probe, and hybridization was performed using digoxigenin labeling. The hybridization result was a single-copy inserted transformant. Figure 8G). For specific procedures, refer to the DIG-High Prime DNA labeling and detection starter kit I (Roche).

[0159] pRC1: 5'-TGCTCTCACGTCGACGGATCCATTGGCAGAGGTTCCCAC-3' (SEQ ID NO.23)

[0160] pRC2: 5'-TGCCTGCAGGTCGACTCTAGATTAGGCACGGCAGATTTGGT-3' (SEQ ID NO.24)

[0161] Sur1: 5'-AGTGTGCTGAGGAGGGCTAT-3' (SEQ ID NO.25)

[0162] Sur2: 5'-ACACGGTCATCGAAGCGGCCA-3' (SEQ ID NO.26)

[0163] 5. Construction of a Beauveria bassiana strain overexpressing BbEng1

[0164] The expression of BbEng1 in Beauveria bassiana was increased using a constitutive promoter.

[0165] The strategy for constructing a Beauveria bassiana strain overexpressing BbEng1 is as follows: The target gene coding region sequence is fused to the constitutive promoter gpdA of Aspergillus nidulans, and then introduced into Beauveria bassiana via genetic transformation. This process increases the expression of the constitutive promoter gpdA.

[0166] BbEng1 expression was detected, and BbEng1 overexpression transformants were obtained by RT-qPCR amplification and screening.

[0167] The specific steps are as follows:

[0168] Using Beauveria bassiana genomic DNA as a template, the coding region of the BbEng1 gene (1974 bp) (SEQ ID NO.29) was amplified using primer pair OE-F1 / OE-R1 and cloned into pBARGPE1 ( Figure 1The BamHI and EcoRI sites of the gene were placed under the control of the constitutive promoter gpdA to construct an overexpression vector, with the bar gene as a selection marker. Using the PEG4000-mediated genetic transformation method for Beauveria bassiana budding spores (Ying et al., 2006, Appl Microbiol Biotechnol 72:206–210), transformants were obtained through two rounds of selection for resistance to glufosinate-ammonia herbicide (200 μg / ml). Validated transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for RT-qPCR analysis to screen for overexpression transformants. The amplification system for the target fragment was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / l primers OE-F1 and OE-R1, 20 ng of wild-type Beauveria bassiana genome, and water to a final volume of 25 μl. The amplification program was: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 2 min, for 35 cycles; extension at 72 ℃ for 10 min. The amplified products were electrophoresed on a 1.0% (w / v) agarose gel, and the amplified fragments were recovered and sequenced for verification. The fusion fragment was then digested with BamHI and EcoRI and ligated into pBARGPE1 digested with the same enzymes to form the overexpression vector pBARGPE1::BbEng1. Figure 8 ).

[0169] The expression vector pBARGPE1::BbEng1 was transformed into wild-type Beauveria bassiana using a PEG4000-mediated budding spore genetic transformation method. Resistant colonies were screened on Czapek-Dox agar plates containing 200 μg / ml glufosinate. DNA was extracted from the resistant transformants, and over-mutants were screened using primers S1 / S2. If the transformant was inserted, partial gpdA and a partial target band (652 bp) were amplified; otherwise, no band was amplified. Following this protocol, several successfully transformed transformants were screened.

[0170] Wild-type strain (WT) and supertransformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26°C for 60 h. Mycelia were collected and RNA was extracted. RNA extraction was performed according to the method of the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 1 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl. Using 18S rRNA (Gen-Bank ID: EU334679) as the reference gene, RT-qPCR was used to detect BbEng1 transcription. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃ with a 0.5 ℃ increase every 5 s. The primer pairs for amplifying 18S rRNA and BbEng1 transcripts were 18SrRNA-F / 18S. rRNA-R and RT1 / RT2. The results showed that the transcriptional level of BbEng1 in the screened transformants was increased by 2.17-235.55 times ( Figure 8 F)

[0171] OE-F1: 5'-CGCGGATCCATGCCGTCACTCATTTCGTG-3' (SEQ ID NO.27)

[0172] OE-R1: 5'-GGAATTCGGCACGGCAGATTTGGTTGG-3' (SEQ ID NO.28)

[0173] S1: 5'-TGAGAAGGTTTTGGGACGCT-3' (SEQ ID NO.30)

[0174] S2: 5'-CGACCATTTGGATTGGACGC-3' (SEQ ID NO.31)

[0175] 6. Yeast expression of BbEng1 and protein purification

[0176] Yeast expression vector construction: Using wild-type Beauveria bassiana cDNA as a template, the coding region cDNA of BbEng1 (1707 bp) (SEQ ID NO. 34) after removing the signal peptide sequence was amplified using Com1 and Com2 primers. EcoRI and NotI restriction sites were introduced at the 5' and 3' ends of the cDNA, respectively, and six tandem His tags were introduced at both ends of the cDNA sequence using primers. The PCR product was obtained by gel extraction. The amplified product was cloned into the pPIC9K vector (Invitrogen, Carlsbad, CA, USA) using the same restriction sites as EcoRI and NotI. After sequencing verification, it was used for yeast genetic transformation.

[0177] Pichia pastoris transformation: Following the Pichia Expression Kit (Invitrogen) instructions, plasmids were introduced into methanol-inducible Pichia pastoris GS115 strain (Invitrogen) using electroporation. The strain was cultured on selective MD medium (containing 1.34% (w / v) YNB (yeast nitrogen base) (Gifco, KS, USA), 40 mg / ml biotin (Invitrogen), 2% (w / v) glucose, and 1.5% (w / v) agar). The resulting recombinant strain was subcultured twice on YPD liquid medium (containing 1% (w / v) yeast extract, 2% (w / v) peptone, and 2% (w / v) glucose). The transformants were then transferred to a medium containing 1.5 mg / ml... Multicopy transformants were screened on YPD medium containing geneticin (G418) (TaKaRa, Dalian, China). The screened transformants were further amplified and verified using primers Com1 and Com2 to obtain positive transformants. Primer sequences are attached.

[0178] Com15'-CCGGAATTCATGCATCATCACCATCACCATAAGTATTCGCTGTCCCAAA-3' (SEQ IDNO.32)

[0179] Com25'-AAGGAAAAAAGCGGCCCGCTTAATGGTGATGGTGATGATGGGCACGGCAGATTTGGTTG-3' (SEQ ID NO.33)

[0180] Protein expression induction and purification: The selected recombinant yeast strain was inoculated into 25 ml BMGY medium (containing 2% (w / v) peptone, 1% (w / v) yeast extract, 100 nmol / L potassium phosphate (pH 6.0), biotin 40 mg / ml and 1% (v / v) glycerol) and cultured in shake flasks at 28 ℃ and 180 rpm for 48 h (OD). 600 ≈2.0), and scaled up the inoculation in 500 ml of BMGY culture with 0.5% (v / v) methanol replacing 1% (v / v) glycerol to induce target protein expression. After 6 days of induction culture, the supernatant was collected after centrifugation at 6000 g to remove the bacterial cells, and then removed through a 0.45 mm filter membrane. The protein was precipitated overnight at 4 ℃ with 80% (NH4)2SO4, and the precipitated protein was collected by centrifugation at 12000 g at 4 ℃ for 30 min. The precipitated protein was dissolved in 5 ml of 0.2 M PBS (pH 7.5), and then desalted in a HiprePTM 26 / 10 desalting column (GE Healthcare Life Sciences). The desalted sample was purified into the target protein using the Magene HisTM protein purification system (Promega). The concentration of purified BbEng1 was normalized using the Bradford method with bovine serum albumin (BSA) as the standard curve. The purified protein was identified using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting. The electrophoresis results showed that the correct BbEng1 (64.4 kDa) protein was obtained. Figure 11 ).

[0181] 7. Enzymatic function of BbEng1

[0182] The binding properties of purified BbEng1 with various insoluble polysaccharides were tested (Cen et al., 2017, PLoS Pathog 13(9): e1006604). After co-incubation with different substrates, unbound proteins (supernatant) and bound proteins (precipitated in polysaccharides) were detected by SDS-PAGE and Western blotting electrophoresis. The results showed that BbEng1 had strong binding ability to barley β-glucan, sodium cellulose (CMC-Na), and insect cuticle, and weak binding ability to Pustulan and Pachyma, but did not bind to chitosan. Figure 11 The BbEng1 protein was labeled with isothiocyanate (FITC). FITC The results of the binding tests with insoluble polysaccharides and insect body wall particles were consistent with the gel imprinting results. Figure 11 ).

[0183] The hydrolytic activity of β-1,3 / 4-glucanase was determined using the dinitrosalicylic acid (DNS) method (Miller, AnalChem, 1959).

[0184] 31:426-426). Details are as follows:

[0185] DNS method for determining reducing sugar content: 90 µl of 50 mM sodium acetate buffer (pH 6.0) containing 10 mM polysaccharide substrate was incubated at 37 °C for 1 h with 10 µl of protease solution (dissolved in 0.02 M PBS, 2 µg). Then, 200 µl of DNS buffer was added, and the mixture was incubated in a boiling water bath for 5 min, followed by an ice bath for 3 min. The absorbance at 540 nm was then measured. Standard curve preparation: 0, 50, 100, 200, 400, 600, and 1000 μg / mL glucose solutions were prepared using 50 mM sodium acetate buffer (pH 6.0) as test samples. After treatment with the DNS method described above, the absorbance at 540 nm (OD) was measured. 540 The absorbance of glucose was plotted, with glucose concentration as the x-axis and OD as the y-axis. 540 A standard curve was constructed with the ordinate as the ordinate. One unit of β-1,3 / 4 glucanase activity was defined as the amount of enzyme required to release 1.0 µmol of reducing sugar (based on glucose) per minute under the above reaction conditions. Triple replicates were performed for each assay.

[0186] Thin-layer chromatography (TLC) was used to detect the hydrolysis products: 10 µl of BbEng1 protein (dissolved in 0.02 M PBS, 2 µg) was added to 90 µl of 50 mM sodium acetate buffer (pH 6.0) containing 10 mM polysaccharide substrate. The mixture was incubated at 37 °C for 1 h, and then the reaction was terminated at 100 °C for 5 min. 10 µl of the sample was dropped five times onto a silica gel plate (Merck, Germany) that had been pre-activated at 110 °C. The plate was placed in a developing chamber using n-butanol-methanol-water (8:4:3, v / v / v) as the solvent. When the sample diffused to 4 / 5 of the plate, the plate was removed and allowed to air dry. A colorimetric solution (5% sulfuric acid, 0.5% vanillin dissolved in anhydrous ethanol) was sprayed onto the silica gel plate, and the plate was then baked at 95 °C for 10 min to visualize the product.

[0187] Substrate specificity was determined by high-performance liquid chromatography (HPLC): 10 µl of protease solution (dissolved in 0.02 M PBS, 2 µg) was added to 90 µl of 50 mM sodium acetate buffer (pH 6.0) containing 10 mM polysaccharide substrate. The mixture was incubated at 37 °C for 1 h, then the reaction was terminated at 100 °C for 5 min. The sample was then filtered through a 0.22 µm filter to obtain the loaded sample. A P230Ⅱ HPLC system with an RI-201H differential refractive index detector and an S3100 autosampler (Elite, Dalian) was used. An Xtimate® Sugar-H column (4.6 mm × 250 mm, 5 m, Yuexu Technology, Shanghai) was used for analysis. The mobile phase was 5 mM H₂SO₄ at a flow rate of 0.6 ml / min, and the loading volume was 20 μl (Xtimate® Sugar-H instruction manual).

[0188] The results showed that barley β-glucan exhibited the highest hydrolytic activity as a substrate, with a specific activity reaching 12300 U / mg. It also showed high hydrolytic activity against yeast glucan and pachyma, while exhibiting lower hydrolytic activity against laminarin and sodium cellulose (CMC-Na). However, it could not hydrolyze pustulan glucan or dextran (Table 1). Thin-layer chromatography (TLC) results indicated that BbEng1 hydrolyzed yeast glucan to produce trisaccharides (…). Figure 11 However, no other polysaccharide hydrolysis products were observed, possibly due to low yield. Further analysis of the hydrolysis products using liquid chromatography revealed that all tested substrates treated with BbEng1 produced new products of the same type. Figure 11This indicates that BbEng1 alters the structural integrity of the tested substrate through the hydrolysis of β-1,3 / 4 glycosidic bonds. Based on the substrate hydrolytic activity of BbEng1, the enzyme is inferred to be β-1,3 / 4-glucanase (EC 3.2.1.6).

[0189] Table 1. Degradation activity of BbEng1 on different polysaccharides

[0190]

[0191] The content of released reducing sugars was determined using the DNS method. Barley β-glucan, with the highest activity, was used as 100%, and the degradation ability of other substrates was used to represent relative activity.

[0192] 8. BbEng1 degrades insect nutrients

[0193] To investigate the relationship between BbEng1 and insect nutrient utilization, purified BbEng1 was used to treat insect body wall, hemocoel components, and the oligosaccharide trehalose within the insect body. The degradation products were detected by HPLC. The specific procedures are as follows:

[0194] Take 90 µl of substrate (10 mg / ml insect body wall, 100 µl / ml hemolymph, and 10 mg / ml trehalose, 50 mM sodium acetate buffer, pH 6.0), add 10 µl of protease solution (dissolved in 0.02 M PBS, 2 µg), incubate at 37 °C for 1 h, then terminate the reaction at 100 °C for 5 min. Finally, filter using a 0.22 µm filter to obtain the sample. The substrate specificity was determined by high-performance liquid chromatography (HPLC), following the same procedure as in [Example 1] 7.

[0195] The results showed that DNS assay revealed the production of new small-molecule reducing sugars after BbEng1 treatment of insect nutrient substrates. Further liquid chromatography analysis indicated that BbEng1 hydrolyzed insect body wall components and produced low-molecular-weight components from 1:10 diluted insect hemolymph, while no new products were produced using trehalose as a substrate. Figure 12 ).

[0196] 9. Overexpression of BbEng1 promotes the colony growth of Beauveria bassiana.

[0197] To elucidate the relationship between BbEng1 and the growth and development of Beauveria bassiana, comparative studies were conducted on wild-type strain (WT), BbEng1 knockout mutant (ΔBbEng1), reversion complement strain (Comp), and overexpression transformant BbEng1 on basal medium (CZA), nutrient-enriched medium (SDAY), and media with different carbon sources. OE -1、BbEng1 OE -2、BbEng1 OE-3 colony growth (expression levels increased by 2.17, 7.25, and 235.55 times, respectively).

[0198] The specific method is as follows: Prepare a solution with a concentration of 1×10 using 0.05% (vol / vol) Tween-80. 7 Spore / ml conidial suspension was inoculated dropwise onto 2 μl to 1 / 4 SDAY (mixed sugar), Czapek-Dox agar, and a medium in which sucrose in Czapek-Dox agar was replaced with equal amounts of dextran, trehalose, glucose, mannoside, mannose, erythrose, galactose, and fructose. The medium was then inverted at 26 ℃ to observe growth. The colony diameter was measured from 3 to 8 days of culture. The colony growth rate was calculated using the Slope function in Excel. Colony images were collected on day 8.

[0199] The results showed that although the growth rate of Beauveria bassiana varied under different culture media or nutrient conditions, BbEng1 OE The growth rates of all strains were significantly higher than those of the wild-type strain (WT), and the growth rate was consistent with the fold change in gene expression. However, the growth of the mutant ΔBbEng1 strain was not significantly different from that of the wild-type strain (WT) and the reverting complement transformant (Comp). Figure 13 ). With BbEng1 OE Taking -2 as an example, on media with mixed sugars, sucrose, dextran, trehalose, glucose, mannoside, mannose, erythrose, galactose, and fructose as the sole carbon source, the growth rate of the overexpressing BbEng1 strain was increased by 0.08, 0.09, 0.06, 0.15, 0.15, 0.36, 0.10, 0.04, and 0.24 times compared to WT, respectively. Figure 13 This indicates that overexpression of BbEng1 accelerates the growth of Beauveria bassiana.

[0200] 9. The relationship between BbEng1 and the production, morphology, and germination of conidia of Beauveria bassiana.

[0201] Conidia yield was determined according to the method described by Zhang et al. (Appl Environ Microbiol 2009, 75: 3787–3795). The specific procedure was as follows: 20 ml of Czapek-Dox agar (Czapek) and a 1:4 dilution of Sabouraud's dextrose agar medium (1 / 4 SDAY) supplemented with 1% (wt / vol) yeast extract were cooled to 45 °C, and 50 μl of 1×10⁻⁶ yeast extract was added to each medium. 7The conidial suspension at spore / ml was thoroughly mixed and poured into 90 mm diameter petri dishes to prepare agar plates. The plates were incubated at 26°C under alternating light and dark conditions of 15 h / 9 h. At 5, 10, and 15 days of incubation, holes were punched in the plates using a 1.0 cm diameter punch, resulting in three mycelial discs per plate. A 10 ml centrifuge tube was placed in each plate, and 6 ml of 0.05% (vol / vol) Tween 80 solution was added. The plates were thoroughly vortexed and then filtered through four layers of lens paper to remove mycelial debris. The conidial concentration was counted under a microscope using a hemocytometer and then converted to the number of conidia produced per unit area of ​​the culture medium. Each strain was tested in triplicate, with each experiment repeated three times.

[0202] Conidium size determination: The long and wide diameters of conidia were determined under a microscope using Image-Pro Plus 6.0 software (Bio-rad, USA), with at least 400 conidia measured for each strain.

[0203] The test results showed that the conidia production of the BbEng1-disrupted strain on CZA medium was not significantly different from that of the wild-type strain, while the overexpression strain (BbEng1) OE The conidia yield of the BbEng1 disrupted strain after 10 and 13 days of culture on CZA medium was significantly higher than that of the wild-type strain (0.36-fold and 0.63-fold increase, respectively). The conidia yield of the BbEng1 disrupted strain on nutrient-rich 1 / 4 SDAY medium was significantly lower than that of the wild-type strain (14.67% decrease). The overexpression strain (BbEng1) OE The conidia yield of the strain cultured on nutrient-rich 1 / 4 SDAY medium was significantly higher than that of the wild-type strain, increasing by 0.43, 0.37, and 0.17 times after 5, 10, and 15 days, respectively. Figure 13 ).

[0204] Molecular spore size assays revealed that the excess strain (BbEng1) OE The conidia are noticeably swollen. Statistical data shows that BbEng1 OE The cross-sectional area of ​​the conidia of this strain is greater than 6 μm. 2 Approximately 34.13% were observed, while WT, ΔBbEng1, and Comp accounted for 5.47%, 3.45%, and 9.53%, respectively. (The last part, "less than 5 μm," appears to be an error and is left untranslated.) 2 Conidia, excessive BbEng1 OE The proportion of enlarged conidia was approximately 35.71%, while WT and ΔBbEng1 strains accounted for 57.85% and 48.26%, respectively. This indicates that the proportion of enlarged conidia in strains overexpressing BbEng1 was significantly higher than in other strains. Figure 13 ).

[0205] 10. Overexpression of BbEng1 increased the germination rate of the strain.

[0206] The conidial germination rate of each strain was determined using the plate method. Conidial cultures were collected at a concentration of 5 × 10⁻⁶. 7 A spore suspension of 100 μl was spread onto CZA and incubated in the dark at 26 ℃ with the spores inverted. Samples were taken every 2 hours after 8 h, stained with lactic acid cotton blue, and observed under a microscope to monitor spore germination and calculate the germination rate. Germination was defined as when the germ tube length was greater than the conidia diameter. At least 100 spores were counted per field of view, and the experiment was repeated three times. Germination curves were plotted using Graphad Prism 8, and germination time (GT) was calculated using Probit analysis in SPSS 17.0. 50 ).

[0207] The test results showed an excessive amount of strain BbEng1. OE The germination rate was significantly higher than that of other strains. Figure 13 On basal salt medium, during the germination of supernumerary strains (GT) 50 = 9.03±0.06 h) compared to the wild-type strain (GT) 50 = 10.11±0.12 h) shortened by 1.07 h (P< 0.01), while the germination rate (GT) of the gene knockout strain was 10.11±0.12 h. 50 =10.34±0.22 h) and the recovery strain (GT) 50 = 10.18±0.11 h) showed no significant difference from the wild type. On nutrient-rich medium (1 / 4 SDAY), BbEng1 OE Germination rate (GT) 50 = 8.59±0.03 h) was also significantly faster than the wild-type strain (GT). 50 = 9.84±0.10 h), while the gene knockout strain (GT) 50 = 10.05±0.12 h) and the recovery strain (GT) 50 = 10.10±0.18 h) was not significantly different from the wild type.

[0208] 11. Overexpression of BbEng1 alters fungal cell wall remodeling

[0209] The cell wall plays a crucial role in maintaining cell shape and controlling cell growth. To clarify the effect of BbEng1 on the fungus itself, a morphological study was conducted on the effect of BbEng1 on the cell wall of *Beauveria bassiana*. Observation of the growth morphology of the strains revealed that the parental strain (WT) had sparser hyphae at the colony edge, shorter hyphal branches, and all hyphae were in an outward-extending growth state. In contrast, the overexpression of the transformant (BbEng1)... OEThe colony edges of the fungus are dense and disordered, with longer and more curved hyphae branches. Figure 14 (). Conidial suspensions were inoculated, and germinating hyphae were collected from 1 / 4 of SDB liquid medium and cultured for 12 h. The morphology of the germinating hyphae, cell wall, septa, and nucleus distribution were observed using cell wall chitin-specific fluorescent whitening dye (CFW) and nuclear dye (PI). Results showed that, compared to the wild-type strain's bipolar growth, the superabundant strain maintained germination and elongation at one end for a longer period. Figure 14 Data analysis revealed that the bipolar growth rate of the superabundant strain was approximately 54.6% lower than that of the wild-type strain. Figure 14 Excess strain (BbEng1) OE The number of hyphal septa was significantly less than that of the wild-type strain, while the number of nuclei remained largely unchanged. Figure 14 ).

[0210] Transmission electron microscopy revealed that the cell walls of the BbEng1 strain were significantly thinner (P < 0.05), while the cell walls of the overexpressing strain were significantly thicker than those of the wild-type strain, increasing by approximately 0.79 times (P < 0.01). Figure 15 BbEng1 OE The cell wall thickness of budding spores and conidia was significantly higher than that of the wild type, while the cell wall thickness of ΔBbEng1 cells was not significantly different from that of the wild type. Figure 15 The chitin and dextran of the mycelial cell walls were stained with the fluorescent whitening agent CFW and the dextran-specific dye aniline blue, respectively, and the average fluorescence value was calculated using ImageJ. The results showed that the superabundant strain (BbEng1) OE The chitin content in the cell wall of the worm was significantly lower than that of the wild-type strain, while the glucan content was significantly higher. The knockout strain (ΔBbEng1) had a significantly higher chitin content than the wild-type strain (P < 0.01), but the glucan content was not significantly different from the wild-type. Figure 15 ).

[0211] CFW staining method: Take 1000 μl of 1×10 7 Centrifuge the cell suspension and discard the supernatant. Resuspend the cells in 1 ml of 0.1 M PBS (pH 7.4), then add 1 μl of CFW staining solution (Fluka). Incubate at 26°C in the dark for 30 min. Wash the cells three times with 0.01 M PBS to remove unbound staining solution. Resuspend the cells in 0.1 M PBS (pH 7.4) and observe them under a laser confocal microscope at Em = 405 nm.

[0212] PI staining method: Take 1000 μl of 1×10 7The cell suspension was centrifuged and the supernatant was discarded. The cells were treated with 200 μl of 75% ethanol for 5 min, washed three times with 1 ml of 0.1 M PBS (pH 7.4), and then 10 μl of PI (propidium iodide) working solution (final concentration 50 μg / ml) was added. The cells were then treated at 26℃ in the dark for 30 min, washed three times with 0.01 M PBS to remove unbound staining, and then resuspended in 0.1 M PBS for observation under a laser confocal microscope at Em = 552 nm.

[0213] Aniline blue staining method: Take 1000 μl of 1×10 7 Centrifuge the cell suspension and discard the supernatant. Then add 200 μl of aniline blue staining solution (final concentration 50 μg / ml, pH 9.5) and incubate at 26℃ in the dark for 30 min. Wash three times with 0.01 M PBS to remove unbound staining solution. Then resuspend the cells in 0.1 M PBS and observe them under a laser confocal microscope at Em = 405 nm.

[0214] Transmission electron microscopy method: Collect WT, ΔBbEng1, and BbEng1. OE Conidia, budding spores, and stromal cells of *Comp* were washed three times with 0.1 M PBS. The samples were then fixed overnight at 4 °C in 0.1 M PBS (pH 7.0) with 2.5% glutaraldehyde (vol / vol). After fixation, the samples were washed three times with 0.1 M PBS at 4 °C for 15 min each time; fixed with 1% (w / v) ethanol solution for 1 h, then washed three times with 0.1 M PBS at 4 °C, and subsequently dehydrated with 30%, 50%, 70%, 80%, and 95% ethanol solutions (vol / vol) successively for 15 min each time, and finally dehydrated once with 100% ethanol solution, followed by treatment with pure acetone for 20 min. After dehydration, the samples were sequentially infiltrated with acetone:Spurr embedding medium at ratios of 1:1, 1:3, and 0:1 (vol / vol) for 2 hours each, followed by overnight infiltration with 100% embedding medium. The samples were then transferred to new centrifuge tubes and heated overnight at 70°C to obtain embedded samples. 75 nm sections were cut using a Leica EMUC7 ultramicrotome and collected on a nickel grid. The samples were stained with uranium acetate for 5 minutes and lead citrate for 3 minutes to obtain samples for transmission electron microscopy (TEM), which were then observed using an HT7800 TEM.

[0215] 12. Overexpression of BbEng1 enhanced the virulence of the strain.

[0216] Using third-instar larvae of the large wax moth as test insects, bioassays were conducted using two methods: "classic" body wall inoculation and micro-injection inoculation.

[0217] The "classic" inoculation procedure is as follows: Collect conidia cultured on 1 / 4 SDAY medium for 10 days, and prepare a solution of 3×10⁻⁶ Tween-80 using 0.05% (v / v) Tween-80. 7 Spores / ml conidia suspension: Take 1 ml of spore suspension and place it in a spray tower. Inoculate 30 *Hemibarbus thunbergii* test insects in the spray tower. Use 0.05% (v / v) Tween-80 as a control. Each treatment is repeated three times. Place the treated test insects in petri dishes and put them in a 26 ℃ artificial climate chamber. Use sterile filter paper to keep the air moist. Add a quantitative amount of sterile water to moisten the filter paper every 12 h. After 48 h of inoculation, count the number of dead insects every 12 h.

[0218] The micro-injection inoculation procedure is as follows: Prepare a suspension of bacterial conidia with a concentration of 5 × 10⁻⁶. 6 Spores / ml were injected via a microinjector into the second pair of abdominal legs of the test insect at a dose of 2 μl / insect. A control was prepared using 0.05% (v / v) Tween-80. Each group consisted of 30 insects, with three replicates. After inoculation, the insects were incubated in a 26 ℃ climate chamber. The number of dead insects was counted every 12 hours after 24 h of inoculation.

[0219] The bioassay was repeated three times. Kaplan-Meyer survival curves were plotted using Graphad Prism 8, and differences between groups were analyzed using the log-rank test. The median lethal time (LT) for insects was calculated using Probit analysis in SPSS 17.0. 50 ).

[0220] Bioassay results showed that, regardless of whether inoculation was performed via cell wall inoculation or microinjection, the overexpression strain (BbEng1) showed the best results. OE The virulence of the wild-type strain (WT) was significantly increased, while the virulence of the knockout strain (ΔBbEng1) was significantly decreased. The median lethal time (LT) of the wild-type strain (WT) treated with the test insects was significantly increased using both the inoculation method and the micro-injection method. 50 The durations were 127.93 ± 3.62 h and 89.28 ± 2.67 h, respectively, for BbEng1. OE LT processing 50 LT processed by WT respectively 50 The LT time was shortened by 17.14 h and 14.16 h (P < 0.01), while the LT time treated with ΔBbEng1 was significantly shorter. 50 Then compared with WT, LT 50 The lag was 19.65 h (P < 0.01) and 11.01 h (P < 0.05). Figure 16 Regardless of whether it is cell wall infiltration or microinjection, WT, ΔBbEng1, and BbEng1 OEBoth Comp hyphae can normally emerge from the mummified insect to grow and produce sporulation. Figure 16 ).

[0221] 13. Overexpression of BbEng1 affects the development and differentiation of worm and fungal cells.

[0222] To reveal the effects of BbEng1 disruption and overexpression on bacterial proliferation and differentiation within the insect, the number of insect cells at different time points after microinjection was determined by qPCR, and the morphology of the insect cells was observed under a microscope.

[0223] Insect biomass determination: Following the method of He et al. (Environmental Microbiology, 2020, 22(7): 2514–2535), the 18S rRNA of the Beauveria bassiana internal reference gene was used as the detection target, and the proliferation of the pathogen in insects was quantitatively detected by qPCR. Standard curve preparation: Wild-type Beauveria bassiana (WT) was inoculated into 1 / 4 SDY liquid medium and cultured at 26℃ and 200 rpm for 4 days. Single-celled budding spores were collected by filtration through 4 layers of filter paper, and the concentration was counted by hemocytometer. The concentration was serially diluted to 1×10⁻⁶. 8 5×10 7 2×10 7 1×10 7 2×10 6 1×10 6 and 2×10 5 Spores / ml, 200 μl of each were centrifuged at 5000 rpm for 5 min at 4℃ to collect budding spores. 8 μl of cell lysis buffer (0.3 M NaOH) was added to lyse the cells. After neutralization with 170 μl of neutralization buffer, amplification template was obtained. Real-time quantitative PCR was performed using 18S rRNA-F / 18S rRNA-R as amplification primers to obtain the relative quantity. A standard curve was plotted with budding spore concentration on the x-axis and relative quantity on the y-axis (Y=0.1636x-0.1338, R2=0.996).

[0224] Insect and fungal cell count determination: Conidia cultured on 1 / 4 SDAY nutrient medium for 10 days were collected and prepared with 0.05% Tween-80 (vol / vol) at a concentration of 5×10⁻⁶. 6Spores / ml suspension were microinjected at 2 μl into the second pair of abdominal legs of *Eriocheir sinensis* larvae. Insect hemolymph was collected at 36 h, 48 h, and 60 h post-inoculation, with 10 larvae selected per group and 20 μl collected from each larva. The procedure was repeated three times on ice. The cells were centrifuged at 5000 rpm for 5 min at 4 °C, and the precipitate was collected. Cells were lysed with 8 μl of cell lysis buffer (0.3 M NaOH), and neutralized with 170 μl of neutralizing buffer to obtain the amplification template. Real-time quantitative PCR was performed using 18S rRNA-F / 18S rRNA-R primers to obtain the relative quantity. The number of insect cells was calculated using the corresponding standard curve. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃ with an increase of 0.5 ℃ / 5 s.

[0225] Observation of morphological development and differentiation of the insect and fungus: Conidia cultured on 1 / 4 SDAY nutrient medium for 10 days were collected and prepared with 0.05% Tween-80 (vol / vol) at a concentration of 5×10⁻⁶. 6 Spores / ml spore suspension was microinjected at 2 μl into the second pair of abdominal legs of third instar larvae of the large wax moth. Insect hemolymph was collected at 12 h, 24 h, 36 h, 48 h, and 60 h, and the morphology of the insects and fungi was observed under a microscope after slide preparation. Five larvae were selected for each group, with three replicates.

[0226] The results show that BbEng1 OE The reproduction rate within the insect body is significantly higher than that of the wild strain. Figure 17 ), 36-60 hours after injection, BbEng1 OE The number of bacteria within the insect body was 50.98%-74.7% higher than that of the wild-type strain (P<0.01). Figure 17 The gene knockout strain (ΔBbEng1) showed no significant difference from the wild-type strain. Microscopic examination revealed that, compared to the wild-type strain, BbEng1 formed short or club-shaped spores within the insect. OE The fungal cells differentiated within the insect body became significantly longer, with some cells differentiating into long, branched mycelia. Figure 17 ).

[0227] 14. Overexpression of BbEng1 affects fungal evasion of host immune response.

[0228] Insect immune responses mainly include humoral immunity and cellular immunity. Cellular immunity involves the phagocytosis and encapsulation of pathogens by hemocytes, while humoral immunity mainly involves the production of melanin through the phenol oxidase cascade reaction to encapsulate and eliminate pathogens, the production of antimicrobial peptides via the Toll pathway, and the release of ROS / RNOS molecules to inhibit the growth and reproduction of pathogens. Therefore, for pathogens to successfully colonize host insects, they need to overcome the insect's immune response, utilize nutrients within the insect's body, rapidly multiply, and ultimately kill the insect. This study investigated the relationship between BbEng1 and insect immune defense by observing melanization in insects and the escape of insect-bacterial cells from hemocyte encapsulation, measuring phenol oxidase (PO) activity and reactive oxygen species (ROS) in the body cavity of *Hemiberlesia lataniae* after injection, and analyzing the expression patterns of antimicrobial peptide-related genes in the body cavity of *Hemiberlesia lataniae* after injection. The specific procedures are as follows:

[0229] The number of melanized nodules on the body surface was counted using two methods: somatic cell wall staining and microinjection into the body cavity. Somatic cell wall staining: Conidia cultured on 1 / 4 SDAY nutrient medium for 10 days were collected and diluted with 0.9% physiological saline to a concentration of 3 × 10⁻⁶. 7 Spores / ml spore suspension: Take 1 ml of the spore suspension and spray it evenly from a spray tower to inoculate third-instar larvae of the large wax moth, 30 larvae per treatment. Microinjection: Collect conidia cultured on 1 / 4 SDAY nutrient medium for 10 days, and prepare a solution with a concentration of 5×10⁻⁶ spores using 0.9% physiological saline. 6 Spores / ml spore suspension was inoculated at 2 μl per microinjection into the second pair of abdominal legs of the large wax moth. Changes in the black nodules on the body surface of the large wax moth during fungal infection were observed at 24 h, 36 h, and 48 h, and photographs were taken and statistical data were collected.

[0230] Melanization reaction in insects and escape of insect-bacterial cells from hemocellular envelopes: collected and cultured on 1 / 4 SDAY nutrient medium for 10 days.

[0231] The conidia were prepared using 0.9% physiological saline to a concentration of 5 × 10⁻⁶. 6 Spores / ml spore suspension, 2 μl was microinjected into the second pair of abdominal legs of the large wax moth. Insect hemolymph was collected at 12 h, 24 h, 36 h, 48 h, and 60 h. The procedure was performed on ice, and the melanization reaction and the escape of insect-bacterial cells from hemolymph cells were observed under a microscope after slide preparation. Ten insects were selected for each group, with three replicates.

[0232] Insect phenol oxidase (PO) activity assay: The assay was performed according to the method of Yang et al. (Appl Environ Microbiol 2014, 78: 5845–5854). Conidia cultured on 1 / 4 SDAY nutrient medium for 10 days were collected and prepared with 0.9% physiological saline to a concentration of 5 × 10⁻⁶. 6Spores / ml spore suspension, 2 μl was microinjected into the second pair of abdominal legs of the large wax moth. Insect hemolymph was collected at 0 h, 4 h, 8 h, 12 h and 24 h after inoculation, and the operation was performed on ice. Ten insects were selected from each group, and 10 μl of each insect was collected into 100 μl Ac buffer (anticoagulant solution (0.14 M NaCl, 0.1 M glucose, 26 mM citric acid, 30 mM trisodium citrate, 10 mM EDTA, pH 4.6) (Wanchoo et al., 2009, Microbiol-SGM, 155: 3121-3133). The mixture was centrifuged at 5000 rpm for 5 min at 4℃, and the supernatant was collected. Prepare a 5 mg / mL dopamine solution using 0.1 M phosphate buffer (pH 6.9) (prepare fresh). Add 100 μL of the supernatant to 300 μL of the dopamine solution and mix thoroughly. Add 100 μL of the mixture to an ELISA plate and measure the OD value at 490 nm wavelength once every 0 min using an ELISA reader. This value is taken as the OD value. 490始 The OD was measured and recorded after 30 minutes of incubation. 490终 Each sample group was repeated three times, with a sampling rate of ΔOD per minute. 490 =0.01 is defined as one unit of PO activity (U), converting OD values ​​to enzyme activity units. Enzyme activity is expressed in activity units U / ml, enzyme activity = (OD) / ml. 490终 -OD 490始 ) / 0.01 / 30 min / volume of worm blood (ml).

[0233] Reactive oxygen species (ROS) determination: The level of reactive oxygen species (ROS) (H2O2) in insect hemolymph was determined using the Hydrogen Peroxide Colorimetric / Fluorometric Assay Kit (BioVision, USA). Specifically, conidia cultured on 1 / 4 SDAY nutrient medium for 10 days were collected, and a solution of 5 × 10⁻⁶ PbS was prepared using 0.9% physiological saline. 6Spores / ml spore suspension were microinjected at 2 μl into the second pair of abdominal legs of the large wax moth. Insect hemolymph was collected at 0 h, 3 h, 6 h, 9 h, and 12 h post-inoculation, and the procedure was performed on ice. Fifteen insects were selected from each group, and 60 μl was collected from each insect, totaling 900 μl. The mixture was centrifuged at 4°C and 5000 rpm for 5 min. 750 μl of the supernatant was mixed with 50 μl of Ac buffer and 200 μl of a 10 mg / ml catalase inhibitor (3-amino-1,2,4-triazole). The mixture was filtered through a 0.22 μm filter and a 10 kDa molecular weight cutoff spin filter (Corning Life Sciences) to remove macromolecular impurities, yielding the test solution. Mix 50 μl of the test solution with 50 μl of hydrogen peroxide reaction working solution, incubate in the dark for 10 min, and detect the fluorescence value at Ex / Em=535 / 587 nm using an ELISA reader. Calculate the concentration of H2O2 in insect hemolymph (pmol / μl) according to the standard curve.

[0234] Determination of expression patterns of antimicrobial peptide-related genes: Prepare 5×10 6Spores / ml spore suspension, 2 μl was micro-injected into the second pair of abdominal legs of *Eriocheir sinensis*. Fat bodies were collected by dissecting the insect on paraffin discs at 12 h and 24 h post-inoculation. RNA was extracted using the EASYspin Plant RNA Rapid Extraction Kit (Beijing Aide Biotechnology Co., Ltd.), and cDNA was obtained by reverse transcription according to the kit instructions (oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). Using this cDNA as a template and the *Eriocheir sinensis* actin gene (Gen-Bank ID: 113519289) as a reference gene, the expression patterns of antimicrobial peptide-related genes and Toll pathway-related genes were detected. Antimicrobial peptide-related genes included one defensin protein (Gal-P [AY528421]), three antifungal proteins (Glo [AF394588.1], Cec ... [XM_026898304.2], AAP[DI105103.1]), 8 defensive peptides (Mor-A [EF564370.1], Mor-B [EF564366.1], Mor-C [EF564365.1], Mor-D [EF564372.1], Mor-E [EF564369.1], Mor-F [EF564368.1], Mor-G [EF564367.1] and Mor-H [AF394588.1]) and 3 antifungal peptides (Gal [AF453824], Prp1 [FJ494919.1] and AP2 [JQ862476.1]). Toll pathway-related genes include β-1,3 glucanrecognition protein gene (BGRP1, The primer sequences are as follows: AM265582.1), Spätzle (XM_031908808), and Dorsal (XM_031907032) genes.

[0235] actin-F: 5'-ATCTGGCATCACACCTTCTACAACG-3' (SEQ ID NO.35)

[0236] actin-R: 5'-GACATACATAGCCGGGGAGTTGAAG-3' (SEQ ID NO.36)

[0237] Cec-F: 5'-ATTTGCCTGCATCGTAGCG-3' (SEQ ID NO.37)

[0238] Cec-R: 5'-CTTGTACTGCTGGACCAGCTTTT-3' (SEQ ID NO.38)

[0239] Gal-PF:5'-GTGGGGTGCGACGAATTACA-3' (SEQ ID NO.39)

[0240] Gal-PR:5'-CAAGAAGCTGCCGCAATGAC-3' (SEQ ID NO.40)

[0241] Mor-AF:5'-TGCCCGTTGGTGCCATAAAA-3' (SEQ ID NO.41)

[0242] Mor-AR:5'-GGCTGTATACTTCGTGCGCT-3' (SEQ ID NO.42)

[0243] Mor-BF:5'-TGGTAAAGCTCTGCGTGGAA-3' (SEQ ID NO.43)

[0244] Mor-BR:5'-TCTTTTTCGGTTTGAACTGGCT-3' (SEQ ID NO.44)

[0245] Mor-CF:5'-AAGCGGCGCCTAAAGTCAAT-3' (SEQ ID NO.45)

[0246] Mor-CR:5'-CTGTACTCGCCGCACTGATT-3' (SEQ ID NO.46)

[0247] Mor-DF:5'-CGCTCTCAAGAAAGGCGGAA-3' (SEQ ID NO.47)

[0248] Mor-DR:5'-CATGCTCGTACACTTGTTGGC-3' (SEQ ID NO.48)

[0249] Mor-EF:5'-TTGGCGCCATCAAGAAAGGT-3' (SEQ ID NO.49)

[0250] Mor-ER:5'-ACGTGGCTGTAAACCTCGTG-3'(SEQ ID NO.50)

[0251] Mor-FF:5'-CTGGTCAAGCCGACCCTAAG-3' (SEQ ID NO.51)

[0252] Mor-F-R:5'-CTGCCTGTTCCTAACGTGGT-3' (SEQ ID NO.52)

[0253] Mor-G-F:5'-GATGCTCGCCCTGTTTGTTG-3' (SEQ ID NO.53)

[0254] Mor-G-R:5'-GCCTGTTCTTGACGTGGCTA-3' (SEQ ID NO.54)

[0255] Mor-H-F:5'-CGTTAGCAAGCAGATGCACG-3' (SEQ ID NO.55)

[0256] Mor-H-R:5'-ATTTCGCCATTTCTGCCGAC-3' (SEQ ID NO.56)

[0257] AP2-F:5'-GTGCAAAATGCCTTTGACTCG-3' (SEQ ID NO.57)

[0258] AP2-R:5'-TTGGCGCTTCTTTCTTCTCTGT-3' (SEQ ID NO.58)

[0259] AAP –F:5'-TCCGTTTTGTTGTTGGTCTGC-3' (SEQ ID NO.59)

[0260] AAP –R:5'-CACACGCACCTCCCTATCAG-3' (SEQ ID NO.60)

[0261] Prp1-F:5'-CTACCGCATCCATGGTCTCC-3' (SEQ ID NO.61)

[0262] Prp1-R:5'-CTTTGCCACGGTTGTGTACG-3' (SEQ ID NO.62)

[0263] Glo–F:5'-CGTTAGCAAGCAGATGCACG-3' (SEQ ID NO.63)

[0264] Glo–R:5'-ATTTCGCCATTTCTGCCGAC-3' (SEQ ID NO.64)

[0265] BGRP1-F: 5'-AGAATGCCGACTGGTGACTG-3' (SEQ ID NO.65)

[0266] BGRP1-R: 5'-GGATATGCCATCAGGCCTCC-3' (SEQ ID NO.66)

[0267] Spätzle-F: 5'-TCTGGGCCAACAACACTAGG-3' (SEQ ID NO.67)

[0268] Spätzle-R: 5'-ACCAGTCAGCGAAGATACCG-3' (SEQ ID NO.68)

[0269] Dorsal-F: 5'-TAAAGCGCGATCGTACGGAG-3' (SEQ ID NO.69)

[0270] Dorsal-R: 5'-CCGTGAAGGGATATGTGCGT-3 (SEQ ID NO.70)

[0271] The results showed that both body wall infection inoculation and micro-injection inoculation revealed that insects treated with gene knockout strains exhibited more pronounced melanization on their surface, while those treated with overexpression strains did not produce significant melanization. Figure 18 Further examination of phenol oxidase activity and ROS levels in the body cavity of *Hemiberlesia lataniae* after injection revealed that the knockout strain treatment showed significantly higher phenol oxidase activity and ROS levels than the wild-type strain treatment, while the over-strain treatment showed significantly higher phenol oxidase activity and ROS levels.

[0272] Treatment with lower concentrations than wild strains ( Figure 18 Analysis of antimicrobial peptide gene expression levels in inoculated insects revealed that at 12 h and 24 h after injection...

[0273] In insects treated with gene knockout strains, the expression of antimicrobial peptide-related genes and Toll pathway-related genes was significantly upregulated, while that of insects treated with overdose strains was significantly upregulated.

[0274] The expression levels of insect antimicrobial peptide-related genes and Toll pathway-related genes in the controlled strain were significantly lower than those in the wild-type strain. Figure 18 C). The above results indicate that BbEng1 is involved in fungal evasion of the host's immune response.

[0275] 15. Overexpression of BbEng1 reduces the distribution of pathogen recognition-related molecular patterns on the surface of fungal cells.

[0276] To clarify whether the mechanism by which BbEng1 affects fungal evasion of insect immunity involves altering the distribution of pathogen recognition-related molecular patterns on the cell surface, we selected three lectins and used immunofluorescence to detect the distribution of carbon source epitopes and β-1,3-glucan on the insect and fungal cell surfaces, i.e., the distribution of pathogen-related molecular patterns. We then used Image J_v1.8.0 software (National Institutes of Health, USA) to statistically analyze the fluorescence values.

[0277] Carbon source epitope detection followed the method of Wannchoo et al. (Microbiology 2009, 155: 3121-3133), and 5×10⁻⁶ samples were prepared. 6 Spores / ml spore suspension, 2 μl was microinjected into *Hemiberlesia lataniae*, and hemolymph was collected after 48 h. The mixture was centrifuged at 4 ℃ and 10000 rpm for 5 min, the supernatant was discarded, and the cells were washed 5 times with 0.1 M PBS buffer. The insect and bacterial cells were collected by centrifugation. Different lectin reaction systems were prepared (Table 2), and insect and bacterial cells were added to a final concentration of 1×10⁻⁶. 7 Cells / ml, incubated overnight at 26°C in the dark. Centrifuge the treated cell culture, wash 5 times with 0.1 M PBS buffer to remove excess staining, and observe and photograph using a laser confocal microscope at an emission wavelength of Em=488 nm.

[0278] Table 2 Preparation of reaction systems for different lectins

[0279]

[0280] Detection of β-1,3-glucan on cell surface: Insect cells were collected according to the above method, fixed with 4% formaldehyde for 30 min, and then washed three times with 0.1 M PBS buffer to remove formaldehyde, obtaining fixed insect cells. The insect cells were resuspended in 0.1 M PBS (pH=7.0) containing 0.1 mg / ml β-1,3-Glucan antibody and 1% Tween-20 (vol / vol), and incubated overnight at 4 ℃ in the dark. After centrifugation at 5000 rpm for 5 min at 4 ℃, the cells were washed three times with pre-cooled 0.1 M PBS. The cells were then resuspended in FITC-labeled secondary antibody diluted in 0.1 M PBS (final concentration 0.1 mg / ml), incubated at room temperature in the dark for 2 h, centrifuged to remove the supernatant, and washed three times again with 0.1 M PBS. The cells were observed and photographed using a laser confocal microscope at an emission wavelength of Em=488 nm.

[0281] The results showed that the fluorescence intensity of the BbEng1 knockout strain's surface reaction with lectins ConA, WGA, and GNL, as well as β-1,3-Glucan antibody, was significantly higher than that of the wild-type strain (WT), while the overexpression strain BbEng1... OE The fluorescence intensity of the worm cell surface was significantly reduced by ConA, WGA, and β-1,3-Glucan, while the fluorescence intensity of GNL was not significantly different from that of the wild-type strain. Figure 19 This indicates that BbEng1 affects fungal cell surface properties, and that overexpression of strain BbEng1... OE The immune recognition and response of easily evading insects are significantly associated with a reduction in the amount of surface pathogen recognition-related molecular patterns β-1,3-Glucan, chitin, and mannan.

[0282]

Example 2

[0283] 1. Construction of a Roberts' Metarhizium anisopliae strain overexpressing BbEng1

[0284] High-level expression of Beauveria bassiana BbEng1 was achieved in Metarhizium anisopliae using the constitutive promoter PB3 (SEQ ID NO.71).

[0285] The strategy for constructing an overexpression vector of Metarhizium anisopliae with BbEng1 is as follows: The promoter PB3 of the Beauveria bassiana 3-phosphate glyceraldehyde dehydrogenase gene is fused with the coding region sequence of the target gene and introduced into Metarhizium anisopliae via genetic transformation. The constitutive promoter PB3 increases the expression of BbEng1, and the Mr-BbEng1 overexpression transformant is obtained by RT-qPCR amplification and screening.

[0286] The specific steps are as follows:

[0287] Using Beauveria bassiana cDNA as a template, the coding region of the BbEng1 gene (1767 bp) was amplified using primer pair OE-F2 / OE-R2 and cloned into Pk2-Pc-Sur-Tc-PB3. Figure 2The BamHI and EcoRV sites of the gene were placed under the control of the constitutive promoter PB3 to construct an overexpression vector. The amplification system for the BbEng1 gene fragment was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / l primers OE-F2 and OE-R2, 20 ng of Beauveria bassiana cDNA, and water to a final volume of 25 μl. The amplification program was: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 2 min, for 35 cycles; extension at 72 ℃ for 10 min. The amplified products were electrophoresed on a 1.0% (w / v) agarose gel, and the amplified fragments were recovered and sequenced for verification. Then, the fragment was ligated into the Pk2-Pc-Sur-Tc-PB3 vector digested with BamHI and EcoRV using a recombination method. Following the instructions of the ClonExpress® II One Step Cloning Kit C112 (Vazyme), the recombination method was used to form the overexpression vector Pk2-Pc-Sur-Tc-PB3::BbEng1 (…). Figure 20 ).

[0288] The expression vector Pk2-Pc-Sur-Tc-PB3::BbEng1 was transformed into wild-type *Metarhizium anisopliae* strains using Agrobacterium-mediated fungal transformation (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898). Transformants were obtained through two screenings using chlorsulfuron-methyl herbicide resistance (4 μg / ml). DNA from the resistant transformant hyphae was obtained by lysing the resistant transformant hyphae with 0.3 M NaOH and used as a template for amplification. Amplification and verification were performed using primers S5 / S6 (530 bp), and several successfully transformed transformants were screened.

[0289] The validated transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for qRT-PCR analysis to screen for overexpression transformants. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 1 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl. Using the *Metarhizium anisopliae* glyceraldehyde-3-phosphate dehydrogenase gene Mrgpd (Gen-Bank ID: 19261961) as a reference gene, RT-qPCR was used to detect the transcription of BbEng1. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃, increasing by 0.5 ℃ / 5 The primer pairs used to amplify the Mrgpd and BbEng1 transcripts were Mrgpd-F / Mrgpd-R and RT1 / RT2, respectively. The results showed that BbEng1 was transcribed at a high level in the transformants, with a relative transcription level of BbEng1 that was 5.11-63.08 times higher than that of the reference gene Mrgpd. Figure 21 )

[0290] OE-F2: 5'-CCCTTTTAATCAATAACAGGATCCATGCCGTCACTCATTTCGTG -3' (SEQ IDNO.72)

[0291] OE-R2: 5'-TCGACGGTATCGATAAGCTTGATATCTTAGGCACGGCAGATTTGGT -3' (SEQ IDNO.73)

[0292] S5: 5'-AATCCGTGCCCACGACTACAA-3' (SEQ ID NO.74)

[0293] S6: 5'-CGACCATTTGGATTGGACGC-3' (SEQ ID NO.75)

[0294] Mrgpd-F: 5'-GACTGCCCGCATTGAGAAG-3' (SEQ ID NO.76)

[0295] Mrgpd-R: 5'-GCTTGACAAAGTTCTTGTTG-3' (SEQ ID NO.77)

[0296] 2. Overexpression of BbEng1 accelerated the growth of Metarhizium anisopliae in Roberts.

[0297] To reveal the effect of BbEng1 overexpression on the growth of Metarhizium anisopliae, the effects of overexpression on the growth of wild-type Metarhizium anisopliae (WT) and the overexpression transformant Mr-BbEng1 were examined. OE Growth rate on solid culture plates and biomass accumulation in liquid culture media. The specific method for determining the growth rate on solid culture plates is as follows: prepare a solution with a concentration of 1×10⁻⁶... 7 A spore suspension of 1 spore / ml was inoculated at a rate of 2 μl onto basal medium (CZA) and nutrient-enriched medium (PDA) using the dropwise method. The culture was incubated at 26 ℃, and the colony diameter was measured from day 3 to day 8. The daily growth rate was calculated using the least squares method. For strain proliferation assay in liquid medium: a concentration of 1×10⁻⁶ was prepared. 7 Spore suspension of 100 μl per ml was inoculated into 30 ml of PDB liquid medium. The culture was carried out at 26 ℃ and 200 rpm. The cells were collected after 2 days and 4 days, dried and weighed, and the biomass accumulation was calculated.

[0298] The results showed that Mr-BbEng1 OE The growth rate of the strain on solid media was significantly faster than that of the wild-type strain (WT), increasing by 0.02-fold and 0.06-fold on basal medium (CZA) and nutrient-enriched medium (PDA), respectively (P<0.01). Figure 22 In liquid culture medium, Mr-BbEng1 OE The proliferation rate was also significantly faster than that of the wild-type strain, with Mr-BbEng1 cultured for 2 days and 4 days. OE Biomass was increased by 4.37 and 1.91 times compared to wild-type WT, respectively (P < 0.01). This indicates that overexpression of BbEng1 accelerated the growth of Metarhizium anisopliae.

[0299] 3. Overexpression of BbEng1 increased the conidium production of Metarhizium anisopliae.

[0300] Conidia yield was determined according to the method described by Zhang et al. (Appl Environ Microbiol 2009, 75: 3787–3795). The specific procedure was as follows: 20 ml of Czapek-Dox agar (Czapek) medium was cooled to 45°C, and 50 μl of 1×10⁻⁶ spores were added. 7The conidial suspension at spore / ml was thoroughly mixed and poured into 90 mm diameter petri dishes to prepare agar plates. The plates were incubated at 26 °C under alternating light and dark conditions of 15 h / 9 h. At 5, 10, and 15 days of incubation, holes were punched in the plates using a 1.0 cm diameter punch, resulting in three mycelial discs per plate. A 10 ml centrifuge tube was placed in each plate, and 6 ml of 0.05% (vol / vol) Tween 80 was added and vortexed thoroughly. The mycelial debris was then removed by filtration through four layers of lens paper. The conidial concentration was counted under a microscope using a hemocytometer and then converted to the number of conidia produced per unit area of ​​the culture medium. Each strain was tested in triplicate, with each experiment repeated three times.

[0301] The test results showed that the strain overexpressed BbEng1 (Mr-BbEng1) OE The conidia yield of the strain cultured on CZA medium for 5, 10, and 15 days was increased by 0.10, 0.29, and 0.34 times, respectively, compared with the wild-type strain (P < 0.01). Figure 22 This indicates that overexpression of BbEng1 promotes the production of conidia in Metarhizium anisopliae.

[0302] 4. Overexpression of BbEng1 increased the germination rate of Metarhizium anisopliae in Roberts.

[0303] The conidial germination rate of each strain was determined using the plate method. Conidial cultures were collected at a concentration of 5 × 10⁻⁶. 7 A spore suspension of 100 μl / ml was spread and inoculated onto CZA cells and incubated in the dark at 26 ℃ with the cells inverted. Samples were taken every 2 hours after 4 h, stained with lactic acid cotton blue, and observed under an inverted microscope to monitor spore germination. The germination rate was recorded until it reached over 95%. Germination was defined as when the germ tube length was greater than the conidia diameter. At least 100 spores were counted per field of view, and the experiment was repeated three times. Germination curves were plotted using Graphad Prism 8, and germination time (GT) was calculated using Probit analysis in SPSS 17.0. 50 ).

[0304] On basal culture medium, an excess of strain (Mr-BbEng1) was observed. OE ) During germination (GT) 50 = 6.33±0.15 h) compared to the wild-type strain (GT) 50 = 7.30±0.42 h) earlier than expected by 0.97 h (P< 0.01) Figure 22 This indicates that overexpression of BbEng1 significantly accelerated the germination rate of Metarhizium anisopliae in Roberts.

[0305] 5. Overexpression of BbEng1 enhanced the virulence of Metarhizium anisopliae.

[0306] Using third-instar larvae of the large wax moth as test insects, bioassays were conducted using two methods: "classic" body wall inoculation and micro-injection inoculation.

[0307] The "classic" inoculation procedure is as follows: Collect conidia cultured on 1 / 4 SDAY medium for 10 days using 0.05% (v / v) Tween-80, and prepare a solution with a concentration of 3×10⁻⁶. 7 Spores / ml conidial suspension: Take 1 ml of spore suspension and inoculate *Hemiberlesia lataniae* test insects in a spray tower. Each treatment contains 90 insects, divided into three groups. A control group was treated with 0.05% (v / v) Tween-80. The treated insects were placed in petri dishes in a 26 ℃ artificial climate chamber, kept moist with sterile filter paper, and the number of dead insects was counted every 12 hours after inoculation for 48 h.

[0308] The micro-injection inoculation procedure is as follows: Prepare a suspension of bacterial conidia with a concentration of 5 × 10⁻⁶. 6 Spores / ml were injected via a microinjector into the second pair of abdominal legs of the test insect at a dose of 2 μl / insect. A control group received the same treatment with 0.05% (v / v) Tween-80. Each group consisted of 30 insects, divided into three groups. After inoculation, the insects were incubated in a 26℃ artificial climate chamber. The number of dead insects was counted every 12 hours after 24 hours.

[0309] The bioassay was repeated three times. Kaplan-Meyer survival curves were plotted using Graphad Prism 8, and differences between groups were analyzed using the log-rank test. The median lethal time (LT) for insects was calculated using Probit analysis in SPSS 17.0. 50 ).

[0310] The results showed that, regardless of whether it was "classic" inoculation or microinjection, the overexpression strain (Mr-BbEng1) was effective. OE The toxicity was significantly increased. Figure 23 Inoculation with the in vivo wall and micro-injection of the overexpressing strain (Mr-BbEng1) OE The half-lethal time (LT) 50 The time to virulence of BbEng1 was shortened by 27.43 h and 4.19 h compared to the wild-type strain (WT), respectively (P < 0.01). This indicates that overexpression of BbEng1 significantly enhances the virulence of Metarhizium anisopliae.

[0311]

Example 3

[0312] 1. Construction of Metarhizium anisopliae strains overexpressing BbEng1

[0313] High-level expression of Beauveria bassiana BbEng1 was achieved in Metarhizium anisopliae using the constitutive promoter PB3.

[0314] The Agrobacterium-mediated fungal genetic transformation method (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898) was used to overexpress BbEng1 in the vector Pk2-Sur-Tc-PB3::BbEng1 constructed in Example 2. Figure 20 Transformers were obtained by two screenings using chlorsulfuron-methyl herbicide resistance (4 μg / ml) after being introduced into the wild-type strain of *Metarhizium anisopliae*. DNA was obtained by lysing the mycelia of the resistant transformants with 0.3 M NaOH and used as a template for amplification. The DNA was then amplified and verified using primers S5 / S6 (530 bp), and several successfully transformed transformants were obtained.

[0315] The validated transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 ℃ and 200 rpm for 3 days. Bacterial cells were then extracted.

[0316] Serine RNA was reverse transcribed into cDNA for qRT-PCR analysis to screen for overexpression transformants. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 1 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl. Using the glyceraldehyde-3-phosphate dehydrogenase gene Magpd (Gen-Bank ID: 19253895) from *Metarhizium anisopliae* as a reference gene, RT-qPCR was used to detect the transcription of BbEng1. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃, increasing by 0.5 ℃ / 5 The primer pairs used to amplify the Magpd and BbEng1 transcripts were Magpd-F / Magpd-R and RT1 / RT2, respectively. The results showed that BbEng1 was transcribed at a high level in the transformants, with the relative transcription level of BbEng1 being significantly lower than that of the reference gene Mrgpd.

[0317] 1.38-73.25 times ( Figure 21 ).

[0318] Magpd-F: 5'-GACTGCCCGCATTGAGAAG-3' (SEQ ID NO.78)

[0319] Magpd-R: 5'-GCTTGACAAAGTTCTTGTTG-3' (SEQ ID NO.79)

[0320] 2. Overexpression of BbEng1 accelerated the growth of Metarhizium anisopliae.

[0321] To reveal the effect of BbEng1 overexpression on the growth and development of Metarhizium anisopliae, the effects of overexpression on the wild-type strain (WT) and the overexpression transformant Ma-BbEng1 were examined. OE Growth rate on solid culture plates and biomass accumulation in liquid culture media. Specifically, the growth rate on solid plates was calculated as follows: [The text abruptly shifts to a different topic] ...to prepare a solution with a concentration of 1×10... 7 Spore suspension at 1 / ml was inoculated dropwise into 2 μl of basal medium (CZA) and nutrient-enriched medium (PDA), and incubated at 26 ℃. Colony diameter was measured from day 3 to day 8. Biomass accumulation was determined using liquid medium: 100 μl of a 1×10⁻⁶ spore suspension was inoculated into the medium. 7 A spore suspension of 1 spore per ml was cultured in 30 ml of PDB liquid medium at 26 ℃ and 200 rpm. The cells were collected after 2 days and 4 days, dried, and weighed.

[0322] The results showed that Ma-BbEng1 OE The growth rate of the strain on solid culture medium was significantly higher than that of the wild-type strain (WT), and the growth rate on CZA and PDA was 0.07-fold and 0.08-fold higher than that of the wild-type group, respectively (P < 0.01). Figure 22 Ma-BbEng1 OE The proliferation in liquid culture medium was also significantly faster than that of the wild-type strain, with biomass accumulation at 2 and 4 days being 1.05 and 0.42 times higher than that of the wild-type WT, respectively (P<0.01). Figure 22 This indicates that overexpression of BbEng1 accelerates the growth of Metarhizium anisopliae.

[0323] 3. Overexpression of BbEng1 increased the conidium production of Metarhizium anisopliae.

[0324] Conidia yield was determined according to the method described by Zhang et al. (Appl Environ Microbiol 2009, 75: 3787–3795). The specific procedure was as follows: 20 ml of Czapek-Dox agar (Czapek) medium was cooled to 45°C, and 50 μl of a 1×10⁻⁶ solution was added. 7The conidial suspension was prepared by mixing spores / ml and pouring it into 90 mm diameter petri dishes to prepare plates. The plates were incubated at 26°C under alternating light and dark conditions of 15 h / 9 h. At 5, 10, and 15 days of incubation, holes were punched in the plates using a 1.0 cm diameter punch, and 10 ml centrifuge tubes were inserted. 6 ml of 0.05% (vol / vol) Tween 80 solution was added, and the plates were vortexed thoroughly. The mycelial debris was then removed by filtering through four layers of lens paper. The conidial concentration was counted under a microscope using a hemocytometer and then converted to the number of conidia produced per unit area of ​​the culture medium. Each strain was tested in triplicate, with each experiment repeated three times.

[0325] The test results showed that the overexpressing strain (Ma-BbEng1) OE The conidium production on CZA medium was significantly higher than that of the wild-type strain, with increases of 0.11, 0.87, and 0.50 times after 5, 10, and 15 days of culture, respectively (P < 0.01). Figure 22 ).

[0326] 4. Overexpression of BbEng1 enhanced the germination rate of *Strombus haematomarginatus*.

[0327] The conidial germination rate was determined using the plate method. 100 μl of a 5×10⁻⁶ concentration was used. 7 A spore suspension of 1 spore / ml was spread and inoculated onto CZA cells and incubated in the dark at 26 ℃ with the cells inverted. Samples were taken every 2 hours after 8 h, stained with lactic acid blue, and observed under an inverted microscope to monitor spore germination. The germination rate was recorded until it reached over 95%. Germination was defined as when the germ tube length was greater than the conidia diameter. At least 100 spores were counted per field of view, and the experiment was repeated three times. Germination curves were plotted using Graphad Prism 8, and germination time (GT) was calculated using Probit analysis in SPSS 17.0. 50 ).

[0328] On basal medium (CZA), the superabundance of strain (Ma-BbEng1) OE ) During germination (GT) 50 = 10.15±0.14 h) compared to the wild-type strain (GT) 50 = 11.46±0.24h) 1.32 h earlier (P< 0.01) Figure 22 This indicates that overexpression of BbEng1 promotes the germination rate of Metarhizium anisopliae.

[0329] 5. Overexpression of BbEng1 enhanced the virulence of Metarhizium anisopliae.

[0330] Using fifth-instar Oriental migratory locust larvae and third-instar large wax moth larvae as test insects, bioassays were performed using two methods: surface staining and microinjection into the body cavity.

[0331] The surface staining procedure is as follows: Collect conidia cultured in 1 / 4 SDAY medium for 10 days, and prepare liquid paraffin at a concentration of 1×10⁻⁶. 7 Spores were collected at a concentration of 1 spore / ml, with liquid paraffin as a blank control. 5 μl of spore suspension was dripped onto the dorsal plate of each locust, with 30 locusts per group. The locusts were fed fresh leaves from grasses, and mortality was recorded every 12 hours (note: locusts turning red and stiff were considered to have died from Metarhizium anisopliae infection) until all locusts had died. Each experiment was repeated at least three times.

[0332] In vivo microinjection: Conidia cultured in 1 / 4 SDAY medium for 10 days were collected and prepared with 0.05% (v / v) Tween-80 at a concentration of 5×10⁻⁶. 6 A spore suspension of 2 μl / ml was injected into the second pair of abdominal legs of third-instar larvae of the large wax moth using a microinjector. A control group was prepared using 0.05% (v / v) Tween-80. Three groups of 30 larvae were prepared. After inoculation, the larvae were incubated in a 26 ℃ artificial climate chamber. Mortality was recorded every 12 hours after 24 h of inoculation.

[0333] The bioassay was repeated three times. Kaplan-Meyer survival curves were plotted using Graphad Prism 8, and differences between groups were analyzed using the log-rank test. The median lethal time (LT) for insects was calculated using Probit analysis in SPSS 17.0. 50 ).

[0334] The results showed that inoculation of the body wall of the fifth-instar Oriental migratory locust resulted in overexpression of strain (Ma-BbEng1). OE The virulence was significantly higher than that of the wild-type parent strain (WT). Figure 23 ), half-lethal time (LT) 50 The inoculation time was shortened by 5.02 h compared to the parent strain. Microinjection of *Hemiberlesia lataniae* larvae showed that inoculation with Ma-BbEng1... OE The lethal rate was significantly faster than that of the parent strain. Figure 23 The half-lethal time was shortened by 6.62 h compared to the parental strain treatment (P < 0.01). This indicates that overexpression of BbEng1 significantly enhanced the virulence of Metarhizium anisopliae.

[0335]

Example 4

[0336] 1. Cloning and sequence analysis of the MrEng1 gene

[0337] Using the amino acid sequence of *Beauveria bassiana* BbEng1 as a probe, the genome of *Metarhizium anisopliae* Roberts (GenBank: GCA_000187405.1) was searched using BLASTP, and the homologous protein-coding gene MrEng1 (MAA_09026, 52.9% similarity) (SEQ ID NO.80) was cloned, with the genome annotation as Concanavalin A-like lectin / glucanase. The coding region of MrEng1 (1487 bp) contains 3 introns, encoding a polypeptide containing 432 amino acid residues (48.1 kDa). Protein domain analysis using the BLASTP program from the Uniprot website (https: / / www.uniprot.org / ) showed that MrEng1 contains a GH16 (GH16_fungal_Lam16A_glucanase) domain located at amino acid 39 to 275. The N-terminus includes a signal peptide sequence, lacks transmembrane structure and GPI anchoring site, contains multiple glycosylation sites and multiple cysteine ​​residues, and is presumed to contain disulfide bonds. Figure 24 ).

[0338] 2. Analysis of MrEng1 expression patterns in different morphological cells of Metarhizium anisopliae (Roberts)

[0339] To investigate the expression pattern of MrEng1, RT-qPCR was used to analyze the transcriptional level of MrEng1 in different morphological cells of Metarhizium anisopliae. The specific procedures are as follows:

[0340] Aerial hyphae and conidia collection: Prepare a solution of 1×10⁻⁵ Tween-80 using 0.05% (v / v) Tween-80. 7 A suspension of wild-type *Metarhizium anisopliae* conidia with spores / ml was inoculated at 100 μl onto PDB solid medium lined with cellophane using the spread plate method. The medium was incubated upside down at 26 ℃ for 3 days, and aerial hyphae were collected. After 10 days of incubation, the mycelium on the cellophane was collected, thoroughly resuspended in 0.05% (v / v) Tween-80, filtered through four layers of lens paper to remove hyphae, and the filtrate was centrifuged and washed twice with sterile ddH2O to obtain the conidia sample.

[0341] Liquid mycelium collection: Prepare a solution with a concentration of 1×10 7 A suspension of conidia of wild-type Metarhizium anisopliae strain with spores / ml was inoculated into 100 μl of PDB liquid medium and cultured at 26°C and 200 rpm for 2 days. The culture medium was then removed, and the solid precipitate was the liquefied mycelium.

[0342] Insect and fungal cell collection: Prepare a concentration of 1×10⁻⁶. 7A suspension of conidial spores / ml of wild-type Metarhizium anisopliae was micro-injected into third-instar larvae of the large wax moth (2 μl), and the test insects were collected after 48 h and flash-frozen in liquid nitrogen.

[0343] RNA extraction was performed according to the method described in the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. 1 μg of RNA was reverse transcribed into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl, and RT-qPCR was used to detect BbEng1 transcription, using 18S rRNA (Gen-Bank ID: EU334679) as the reference gene. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃ with a 0.5 ℃ increase every 5 s.

[0344] Using Mrgpd (GenBank ID: 19261961) as the reference gene, the transcriptional pattern of MrEng1 was detected by RT-qPCR. The primer pairs for amplifying the transcriptional levels of Mrgpd and MrEng1 were Mrgpd-F / Mrgpd-R and RT3 / RT4, respectively. The results showed that MrEng1, similar to BbEng1, only exhibits high-level transcription in the bacterial-insect bacterial cell propagation process within insects, while no transcription occurs in saprophytic cells. Figure 25 ).

[0345] Mrgpd-F: 5'-GACTGCCCGCATTGAGAAG-3' (SEQ ID NO.81)

[0346] Mrgpd-R: 5'-GCTTGACAAAGTTCTTGTTG-3' (SEQ ID NO.82)

[0347] RT3: 5'-CCACATCCCTGACGACAACA-3' (SEQ ID NO.83)

[0348] RT4: 5'- CGCACCATGTCTATGCTTGC-3' (SEQ ID NO.84)

[0349] 3. Construction of Metarhizium anisopliae strain overexpressing MrEng1

[0350] MrEng1 was expressed at high levels in Metarhizium anisopliae using the constitutive promoter PB3.

[0351] The strategy for constructing the Roberts MrEng1 overexpression vector is as follows: The target gene coding sequence is fused to the promoter PB3 of the Beauveria bassiana 3-phosphate glyceraldehyde dehydrogenase gene, and then introduced into Beauveria bassiana Roberts via genetic transformation. The constitutive promoter PB3...

[0352] MrEng1 expression was increased, and Mr-MrEng1 overexpression transformants were obtained by RT-qPCR amplification and screening.

[0353] The specific steps are as follows:

[0354] Using Metarhizium anisopliae genomic DNA as a template, the coding region of the MrEng1 gene (1487 bp) was amplified using primer pair OE-F3 / OE-R3 and cloned into Pk2-Pc-Sur-Tc-PB3. Figure 2 The BamHI and EcoRV sites were placed under the constitutive promoter PB3 to construct an overexpression vector. The target fragment amplification system was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / l primers OE-F3 and OE-R3, 20 ng of Metarhizium anisopliae genomic DNA, and water to a final volume of 25 μl. The amplification program was: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min 30 s, 35 cycles; extension at 72 ℃ for 10 min. The amplified products were electrophoresed on a 1.0% (w / v) agarose gel, and the amplified fragments were recovered and sequenced for verification. Then, the fragment was ligated into Pk2-Pc-Sur-Tc-PB3 digested with BamHI and EcoRV using a recombination method, following the instructions of the ClonExpress® II One Step Cloning Kit C112 (Vazyme) to form the overexpression vector Pk2-Pc-Sur-Tc-PB3::MrEng1. Figure 26 ).

[0355] Using Agrobacterium-mediated fungal transformation (Ma et al., 2009, Appl Microbiol Biotechnol 82: 891–898), the expression vector Pk2-Pc-Sur-Tc-PB3::MrEng1 was transformed into wild-type Metarhizium anisopliae strains. Transformants were obtained through two rounds of selection using chlorsulfuron-methyl herbicide (4 μg / ml). DNA from the resistant transformant hyphae was obtained by lysing the resistant transformant hyphae with 0.3 M NaOH and used as amplification templates. Amplification and verification were performed using primers S7 / S8 (1690 bp), and multiple successfully transformed transformants were screened.

[0356] The validated transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 ℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for RT-qPCR analysis to screen for overexpression transformants. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. Take 1 μg of RNA and reverse transcribe it into cDNA first strand using oligo(dT) primers. Reverse transcription was performed according to the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized cDNA first strand was diluted to 10 ng / μl. Using the *Metarhizium anisopliae* glyceraldehyde-3-phosphate dehydrogenase gene Mrgpd (Gen-Bank ID: 19261961) as a reference gene, RT-qPCR was used to detect the transcription of MrEng1. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃, increasing by 0.5 ℃ / 5 The primer pairs used to amplify the Mrgpd and MrEng1 transcripts were Mrgpd-F / Mrgpd-R and RT3 / RT4, respectively. The results showed that the transcriptional level of the screened transformants MrEng1 was 1.36–15.85 times higher than that of the parental strain. Figure 22 ).

[0357] OE-F3: 5'- CCCTTTTAATCAATAACAGGATCCATGCGCCCCGTAACCGCTTG -3' (SEQ IDNO.85)

[0358] OE-R3: 5'-TCGACGGTATCGATAAGCTTGATATCTTAGATGTGTCGCAAACCAT -3' (SEQ IDNO.86)

[0359] S7: 5'-AATCCGTGCCCACGACTACAA-3' (SEQ ID NO.87)

[0360] S8: 5'-CGCACCATGTCTATGCTTGC-3' (SEQ ID NO.88)

[0361] 4. Overexpression of MrEng1 accelerated the growth of Metarhizium anisopliae in Roberts.

[0362] To reveal the effect of MrEng1 overexpression on the growth of Metarhizium anisopliae, the effects of overexpression on wild-type strain (WT) and the overexpression transformant Mr-MrEng1 were examined. OE Growth rate on solid culture plates and biomass accumulation in liquid culture medium. Specifically, the growth rate on solid culture plates was determined by preparing a solution with a concentration of 1×10⁻⁶. 7 A spore suspension of 1 spore / ml was inoculated at a rate of 2 μl onto both basal medium (CZA) and nutrient-enriched medium (PDA) using the dropwise method. The cultures were incubated at 26 ℃, and colony diameters were measured from day 3 to day 8 to calculate the daily growth rate. For proliferation assays in liquid medium, 100 μl of a 1×10⁻⁶ spore suspension was inoculated. 7 The spore suspension was cultured in 30 ml of PDB liquid medium at 26°C and 200 rpm for 2 days and 4 days. The mycelia were then dried and weighed.

[0363] The results showed that Mr-MrEng1 OE The growth rate of the strain on solid media was significantly higher than that of the wild-type strain (WT), increasing by 0.06-fold and 0.05-fold on CZA and PDA, respectively (P < 0.01). Figure 22 Mr-MrEng1 OE The proliferation rate in liquid culture medium was significantly faster than that of wild-type WT, with biomass increasing by 0.78 and 0.75 times after 2 and 4 days of culture, respectively (P<0.01). Figure 22 This indicates that overexpression of MrEng1 promotes the growth of Metarhizium anisopliae.

[0364] 3. Overexpression of MrEng1 increased the conidium production of Metarhizium anisopliae.

[0365] Conidia yield was determined according to the method described by Zhang et al. (Appl Environ Microbiol 2009, 75: 3787–3795).

[0366] Okay. The specific procedure is as follows: Cool 20 ml of Czapek-Dox agar (Czapek) medium to 45°C, and add 50 μl of a 1×10⁻⁶ solution. 7 The conidial suspension at spore / ml was thoroughly mixed and poured into 90 mm diameter petri dishes to prepare agar plates. The plates were incubated at 26°C under alternating light and dark conditions of 15 h / 9 h. At 5, 10, and 15 days of incubation, mycelial pellets were collected by punching holes in the plates using a 1.0 cm diameter punch and placed into 10 ml centrifuge tubes. 6 ml of 0.05% (vol / vol) Tween 80 was added, and the mixture was vortexed thoroughly. The mycelial debris was then removed by filtering through four layers of lens paper. The conidial concentration was counted under a microscope using a hemocytometer and then converted to the number of conidia produced per unit area of ​​the culture medium. Each strain was tested in triplicate, with each experiment repeated three times.

[0367] The test results showed that the overexpression strain (Mr-MrEng1) OE The conidia yield of the super-type strain after 5 days of culture on CZA medium was significantly lower than that of the wild-type strain by 49.7%. However, the conidia yield of the super-type strain was significantly higher than that of the wild-type strain after 10 and 15 days of culture, increasing by 0.12 and 0.24 times, respectively (P < 0.01). Figure 22 ).

[0368] 5. Overexpression of MrEng1 increased the germination rate of Metarhizium anisopliae in Roberts.

[0369] The conidial germination rate of each strain was detected using the plate method. 100 μl of a 5×10⁻⁶ concentration was used. 7 A spore suspension of 1 spore / ml was spread and inoculated onto CZA cells and incubated in the dark at 26 ℃ with the cells inverted. Samples were taken every 2 hours after 4 h, stained with cotton blue, and observed under an inverted microscope to monitor spore germination. The germination rate was recorded until it reached over 95%. Germination was defined as when the germ tube length was greater than the conidia diameter. At least 100 spores were counted per field of view, and the experiment was repeated three times. Germination curves were plotted using Graphad Prism 8, and germination time (GT) was calculated using Probit analysis in SPSS 17.0. 50 ).

[0370] On basal medium, strain Mr-MrEng1 was overexpressed. OEThe germination rate was significantly faster than that of the wild-type strain, and during germination (GT50 = 6.59 ± 0.25 h) it was significantly faster than that of the wild-type strain (GT... 50 = 7.30±0.42 h) shortened by 0.71 h (P< 0.01)( Figure 22 This indicates that overexpression of MrEng1 promotes the germination of Metarhizium anisopliae spores.

[0371] 6. Overexpression of MrEng1 enhanced the virulence of Metarhizium anisopliae.

[0372] Using third-instar larvae of the wax moth as test insects, bioassays were conducted using two methods: "classic" body wall inoculation and micro-injection inoculation.

[0373] The "classic" inoculation procedure is as follows: Collect conidia cultured on 1 / 4 SDAY medium for 10 days, and prepare a solution with 0.05% (v / v) Tween-80 at a concentration of 3×10⁻⁶. 7 Spores / ml conidial suspension: Take 1 ml of spore suspension and spray it in a spray tower to inoculate *Hemiberlesia lataniae* test insects. Each group contains 30 insects, with three treatment groups. A control group received the same treatment with 0.05% (v / v) Tween-80. The treated insects were placed in petri dishes in a 26℃ artificial climate chamber and kept moist with sterile filter paper. Insect mortality was counted every 12 hours after inoculation, 48 h later.

[0374] The micro-injection inoculation procedure is as follows: Prepare a suspension of bacterial conidia with a concentration of 5 × 10⁻⁶. 6 Spores / ml were injected via a microinjector into the second pair of abdominal legs of the test insect at a dose of 2 μl / insect. A control group received the same treatment with 0.05% (v / v) Tween-80. Three treatment groups were formed with 30 insects per group. After inoculation, the insects were incubated in a 26℃ artificial climate chamber. The number of dead insects was counted every 12 hours after 24 h of inoculation.

[0375] The bioassay was repeated three times. Kaplan-Meyer survival curves were plotted using Graphad Prism 8, and differences between groups were analyzed using the log-rank test. The median lethal time (LT) for insects was calculated using Probit analysis in SPSS 17.0. 50 ).

[0376] The results showed that, regardless of whether it was "classic" inoculation or microinjection, overexpression of MrEng1 significantly enhanced the virulence of the strain. Figure 23 Inoculation with overexpressing strain Mr-MrEng1 OE Least lethal time (LT) 50The time to death was shortened by 33.91 h and 2.30 h, respectively (P < 0.01). This indicates that overexpression of MrEng1 significantly enhances the virulence of Metarhizium anisopliae.

[0377]

Example 5

[0378] 1. Cloning and sequence analysis of the MaEng1 gene

[0379] Using the amino acid sequence of *Beauveria bassiana* BbEng1 as a probe, the genome of *Metarhizium anisopliae* (GenBank: GCA_000187425.2) was searched using BLASTP, yielding the homologous protein MaEng1 (MAC_06610, 55.6% similarity) (SEQ ID NO.89), annotated as β-1,3-endoglucanase. The coding region of MaEng1 (1520 bp) contains three introns, encoding a polypeptide of 448 amino acid residues (49.9 kDa). Protein domain analysis using the BLASTP program from the Uniprot website (https: / / www.uniprot.org / ) revealed that MaEng1 contains a GH16 (GH16_fungal_Lam16A_glucanase) domain located at amino acid positions 39 to 270 from the amino terminus. The N-terminus includes a signal peptide sequence, lacks transmembrane structure and GPI anchoring site, contains multiple glycosylation sites and multiple cysteine ​​residues, and is presumed to contain disulfide bonds. Figure 27 ).

[0380] 2. Expression patterns of MaEng1 in different morphological cells of Metarhizium anisopliae

[0381] To investigate the expression pattern of MrEng1, RT-qPCR was used to analyze the transcriptional level of MrEng1 in different morphological cells of *Metarhizium anisopliae*. Aerial hyphae, conidia, liquefied hyphae, and insect-bacterial cells of wild-type *Metarhizium anisopliae* were collected using the same method as in [Example 4]. RNA was extracted and reverse transcribed into cDNA. Using Magpd (Gen-Bank ID: 19253895) as a reference gene, RT-qPCR was used to detect the transcriptional pattern of MaEng1. The primer pairs for amplifying the transcriptional levels of Magpd and MaEng1 were Magpd-F / Magpd-R and RT5 / RT6, respectively. The results showed that the transcriptional level of MaEng1 was similar to that of BbEng1, exhibiting high transcription levels in the insect-bacterial cell-insect morphology, while the transcriptional level was extremely low or non-transcriptional in saprophytic cells. Figure 25 ).

[0382] Magpd-F: 5'-GACTGCCCGCATTGAGAAG-3' (SEQ ID NO.90)

[0383] Magpd-R: 5'-GCTTGACAAAGTTCTTGTTG-3' (SEQ ID NO.91)

[0384] RT5: 5'- AGGCTCATCAAGCCAACGAA-3' (SEQ ID NO.92)

[0385] RT6: 5'-TGGGTATCCTTTTGGCCGTC-3' (SEQ ID NO.93)

[0386] 3. Construction of Metarhizium anisopliae strains overexpressing MaEng1

[0387] MaEng1 was expressed at high levels in Metarhizium anisopliae using the constitutive promoter PB3.

[0388] The strategy for constructing the overexpression vector of *Metarhizium anisopliae* MaEng1 is as follows: Utilizing the glyceraldehyde-3-phosphate dehydrogenase of *Beauveria bassiana*...

[0389] The promoter PB3 of the target gene was fused with the coding region sequence of the target gene and introduced into Metarhizium anisopliae via genetic transformation. The constitutive promoter PB3 increased the expression of MaEng1, and Ma-MaEng1 overexpression transformants were obtained by RT-qPCR amplification and screening.

[0390] The specific steps are as follows:

[0391] Using Metarhizium anisopliae genomic DNA as a template, the coding region of the MaEng1 gene (1520 bp) was amplified using primer pair OE-F4 / OE-R4 and cloned into Pk2-Pc-Sur-Tc-PB3. Figure 2 The BamHI and EcoRV sites of the target fragment were placed under the constitutive promoter PB3 to construct an overexpression vector. The amplification system for the target fragment was as follows: 12.5 μl of 2×Phanta Max Buffer, 0.5 μl of dNTP Mix, 0.5 μl of Phanta Max Super-Fidelity DNA Polymerase, 1 μl each of 5 μmol / l primers OE-F4 and OE-R4, 20 ng of *Metarhizium anisopliae* genomic DNA, and water to a final volume of 25 μl. The amplification program was: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min 30 s, 35 cycles; extension at 72 ℃ for 10 min. The amplified product was stored at 1.0% (w / v).

[0392] The amplified fragment was recovered and sequenced for verification by agarose gel electrophoresis. Then, the fragment was ligated to a polymer using BamHI and...

[0393] EcoRV-digested Pk2-Pc-Sur-Tc-PB3 vector, recombinant method reference kit (ClonExpress® II One Step)

[0394] Cloning Kit C112 (Vazyme) instructions, forming the overexpression vector Pk2-Pc-Sur-Tc-PB3::MaEng1 ( Figure 28 ).

[0395] Using Agrobacterium-mediated fungal transformation (Ma et al., Appl Microbiol Biotechnol 2009, 82: 891–898), the expression vector Pk2-Pc-Sur-Tc-PB3::MaEng1 was transformed into a wild-type strain of *Metarhizium anisopliae*. Transformants were obtained through two rounds of selection using chlorsulfuron-methyl herbicide (40 μg / ml). DNA was obtained by lysing the mycelia of the resistant transformants with 0.3 M NaOH and used as a template for amplification. Amplification and verification were performed using primers S9 / S10 (1653 bp), and several successfully transformed transformants were screened.

[0396] The validated transformants were inoculated into 1 / 4 SDY liquid medium and cultured at 26 ℃ and 200 rpm for 3 days. Mycelial RNA was extracted and reverse transcribed into cDNA for qRT-PCR analysis to screen for overexpression transformants. RNA extraction was performed according to the EASYspin Plant RNA Rapid Extraction Kit (Beijing AIDE Biotechnology Co., Ltd.). RNA was quantified using a UV spectrophotometer. 1 μg of RNA was reverse transcribed into the first strand of cDNA using oligo(dT) primers, following the instructions of the oligo(dT)-primed cDNA synthesis kit (MBI Fermentas). The synthesized first strand of cDNA was diluted to 10 ng / μl, and the transcription of MaEng1 was detected by RT-qPCR using the *Metarhizium anisopliae* glyceraldehyde-3-phosphate dehydrogenase gene Magpd (Gen-Bank ID: 19253895) as a reference gene. The amplification system was as follows: 5 μl of 2×SYBR Buffer, 1 μl of each of 5 pmol / L primers, and 3 μl of diluted cDNA template. The amplification program was as follows: 95 ℃ for 2 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 39 cycles; 65 ℃ - 95 ℃ with a 0.5 ℃ increase every 5 s. The primer pairs used for amplifying Magpd and MaEng1 transcripts were Magpd-F / Magpd-R and RT5 / RT6, respectively. The results showed that the transcription level of MaEng1 in the screened transformants was 0.25-3.46 times higher than that of the wild-type strain. Figure 21 ).

[0397] OE-F4: 5'-CCCTTTTAATCAATAACAGGATCCATGCGCCCTGTAACCGCTTG-3'

[0398] (SEQ ID NO.94)

[0399] OE-R4: 5'-TCGACGGTATCGATAAGCTTGATATCTTAGATGTGTCGCGCACCAT-3'

[0400] (SEQ ID NO.95)

[0401] S9: 5'-AATCCGTGCCCACGACTACAA-3' (SEQ ID NO.96)

[0402] S10: 5'-TGGGTATCCTTTTGGCCGTC-3' (SEQ ID NO.97)

[0403] 4. Overexpression of MaEng1 promoted the growth of Metarhizium anisopliae.

[0404] To clarify the effect of MaEng1 overexpression on the growth of Metarhizium anisopliae, the effects of overexpression on the wild-type strain (WT) and the overexpression transformant Ma-MaEng1 were measured. OE Growth rate on solid culture plates and biomass accumulation in liquid culture medium. Specifically, the growth rate on solid culture plates was determined by preparing a solution with a concentration of 1×10⁻⁶. 7 A spore suspension of 1 spore / ml was used, and 2 μl was dropwise inoculated onto basal medium (CZA) and nutrient-enriched medium (PDA). The cultures were incubated at 26 ℃, and the colony diameter was measured from day 3 to day 8 to calculate the daily growth rate. For biomass accumulation in liquid culture medium: 100 μl of 1×10⁻⁶ spores was inoculated. 7 A spore suspension of 1 spore / ml was cultured in 30 ml of PDB liquid medium at 26 ℃ and 200 rpm. Mycelia were collected after 2 days and 4 days of culture, dried to constant weight, and the biomass was measured.

[0405] The results showed that overexpression of MaEng1 promoted the biochemical activity of *Metarhizium anisopliae* on solid plates. On CZA and PDA plates, Ma-MaEng1... OE The growth rate of the strain was 0.10-fold and 0.07-fold higher than that of the wild-type strain, respectively (P < 0.01). Figure 22 Mr-MrEng1 in liquid culture medium OE The proliferation rate was also significantly higher than that of the wild-type strain, with biomass accumulation after 2 days and 4 days of culture, respectively.

[0406] The WT was increased by 0.33 and 0.16 times compared to the wild type (P < 0.01). Figure 22 This indicates that overexpression of MaEng1 promotes locust growth.

[0407] Growth of Metarhizium anisopliae.

[0408] 5. Overexpression of MaEng1 increased the conidium production of Metarhizium anisopliae.

[0409] Conidia yield was determined according to the method described by Zhang et al. (Appl Environ Microbiol 2009, 75: 3787–3795).

[0410] Okay. The specific procedure is as follows: Cool 20 ml of Czapek-Dox agar (Czapek) medium to 45 ℃, add 50 μl of 1×10 7The conidial suspension at spore / ml was thoroughly mixed and poured into 90 mm diameter petri dishes to prepare agar plates. The plates were incubated at 26 °C under alternating light and dark conditions of 15 h / 9 h. At 5, 10, and 15 days of incubation, holes were punched in the plates using a 1.0 cm diameter punch. Mycelial pellets were then placed into 10 ml centrifuge tubes, and 6 ml of 0.05% (vol / vol) Tween 80 was added. The mixture was thoroughly vortexed and then filtered through four layers of lens paper to remove mycelial debris. The conidial concentration was counted under a microscope using a hemocytometer and then converted to the number of conidia produced per unit area of ​​the culture medium. Each strain was tested in triplicate, with each experiment repeated three times.

[0411] The test results showed that the overexpression strain (Ma-MaEng1) OE The conidia yield of the strain cultured on CZA medium for 5 days was not significantly different from that of the wild-type strain. However, at 10 and 15 days of culture, the conidia yield was significantly higher than that of the wild-type strain, increasing by 0.94 and 0.34 times, respectively (P < 0.01). Figure 22 ).

[0412] 6. Overexpression of MaEng1 promoted the germination of Metarhizium anisopliae spores.

[0413] The conidial germination rate of each strain was detected using the plate method. 100 μl of a 5×10⁻⁶ concentration was used. 7 A spore suspension of 1 spore / ml was spread and inoculated onto CZA cells and incubated in the dark at 26 ℃ under an inverted microscope. Samples were taken every 2 hours after 8 h, stained with cotton blue, and observed under an inverted microscope to monitor spore germination. The germination rate was recorded until it reached over 95%. Germination was defined as when the germ tube length was greater than the conidia diameter. At least 100 spores were counted per field of view, and the experiment was repeated three times. Germination curves were plotted using Graphad Prism 8, and germination time (GT) was calculated using Probit analysis in SPSS 17.0. 50 ).

[0414] The results showed that overexpression of MaEng1 promoted the germination of *Metarhizium anisopliae* spores, with the overexpressing strain Ma-MaEng1 showing the best results. OE When it sprouts (GT) 50 =36±0.13 h) compared to the wild-type strain (GT) 50 = 11.46±0.24h) shortened by 2.11 h (P< 0.01) Figure 22 ).

[0415] 7. Overexpression of MaEng1 enhanced the virulence of Metarhizium anisopliae.

[0416] The fifth-instar larvae of the Oriental migratory locust and the third-instar larvae of the giant wax moth were used as test insects, and bioassays were performed using two methods: surface infection and microinjection into the body cavity.

[0417] The procedure for surface infection inoculation is as follows: Collect conidia cultured in 1 / 4 SDAY medium for 10 days, and prepare a solution with a concentration of 1×10⁻⁶ using liquid paraffin. 7 A spore suspension of spores / ml was used, with liquid paraffin as a blank control. 5 μl of spore suspension was applied dropwise to the dorsal plate of 30 locust larvae per group, which were fed with fresh grass leaves. Locust mortality was observed and recorded every 12 hours (note: locusts turning red and stiff were considered to have died from Metarhizium anisopliae infection) until all locusts had died. Each experiment was repeated at least three times.

[0418] In vivo microinjection: Conidia cultured in 1 / 4 SDAY medium for 10 days were collected and prepared with 0.05% (v / v) Tween-80 at a concentration of 5×10⁻⁶. 6 A spore suspension at spore density of 2 μl / ml was injected into the second pair of abdominal legs of third-instar larvae of the large wax moth using a microinjector. A control group received the same treatment with 0.05% (v / v) Tween-80. Three groups of 30 larvae were prepared. After inoculation, the larvae were incubated in a 26℃ artificial climate chamber. The number of dead larvae was counted every 12 hours after 24 hours of inoculation.

[0419] The bioassay was repeated three times. Kaplan-Meyer survival curves were plotted using Graphad Prism 8, and differences between groups were analyzed using the log-rank test. The median lethal time (LT) for insects was calculated using Probit analysis in SPSS 17.0. 50 ).

[0420] The results showed that overexpression of MaEng1 significantly enhanced the virulence of the strain. Figure 23 In vivo inoculation results showed that the overexpression strain Ma-MaEng1... OE The median lethal time (LT) for East Asian migratory locust larvae 50 The inoculation time was shortened by 17.14 h compared to the wild-type strain, while after microinjection, Ma-MaEng1... OE The median lethal time (LT) for the larvae of the large wax moth 50 The time was shortened by 6.10 h compared to the wild strain (P < 0.01).

Claims

1. A method of improving the growth, sporulation capacity and virulence of entomopathogenic fungi, characterized in that By constructing an engineered strain that overexpresses the secretory glucanase gene Eng1 of insect biocontrol fungi, an insect biocontrol fungus with growth-promoting, conidial-producing, and virulence-enhancing properties was obtained; wherein the insect biocontrol fungus is *Metarhizium anisopliae*; the secretory glucanase gene Eng1 of the insect biocontrol fungus is derived from *Metarhizium anisopliae* and is the homologous protein encoding gene MrEng1 of the secretory glucanase gene BbEng1 of *Beauveria bassiana*, and the nucleotide sequence of the coding region of the MrEng1 gene is shown in SEQ ID NO.

80.

2. The method according to claim 1, wherein the secretory glucanase gene Eng1 of the insect biocontrol fungus is placed under the control of a fungal constitutive promoter to construct an overexpression vector; the fungal constitutive promoter is PB3.

3. The method according to claim 1 or 2, comprising the following steps: 1) Amplify the coding region of the MrEng1 gene of Metarhizium anisopliae and place it under the fungal constitutive promoter PB3 to obtain an overexpression vector; 2) The expression vector obtained in step 1) was transformed into the wild-type strain of Metarhizium anisopliae, and the overexpression engineered strain was screened by RT-qPCR. The engineered strain has the characteristics of promoting growth, sporulation and enhancing virulence.

4. An engineered strain of entomopathogenic fungi, characterized in that The engineered strain has an overexpressed secretory glucanase gene Eng1; wherein the insect biocontrol fungus is Metarhizium anisopliae; the secretory glucanase gene Eng1 of the insect biocontrol fungus is derived from Metarhizium anisopliae and is the homologous protein encoding gene MrEng1 of the secretory glucanase gene BbEng1 of Beauveria bassiana, and the nucleotide sequence of the coding region of the MrEng1 gene is shown in SEQ ID NO.

80.

5. A fungal insecticide comprising the engineered strain of insect biocontrol fungi as described in claim 4.

6. The fungal pesticide of claim 5, wherein The formulation of the insecticide is selected from powder, emulsion, oil, microcapsule, mixture and dried mycelium.

7. Use of the secretory glucanase gene Eng1 of insect biocontrol fungi in the preparation of fungal insecticides, wherein the fungus in the fungal insecticide is *Metarhizium anisopliae*, the secretory glucanase gene Eng1 of insect biocontrol fungi is derived from *Metarhizium anisopliae*, and is the homologous protein encoding gene MrEng1 of the secretory glucanase gene BbEng1 of *Beauveria bassiana*, the nucleotide sequence of the coding region of the MrEng1 gene is shown in SEQ ID NO. 80, and the MrEng1 gene is overexpressed in the fungus.

Citation Information

Patent Citations

  • Method for improving high-seepage property, oxidative stress resistance and toxicity of beauveria bassiana by utilizing genetic engineering

    CN103173467A