A method for improving cadmium tolerance of white birch callus by lupinol and a method for improving cadmium tolerance of yeast engineering bacteria

CN117187157BActive Publication Date: 2026-09-18NORTHEAST FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311269195.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-28
Publication Date
2026-09-18
Estimated Expiration
2043-09-28

AI Technical Summary

Technical Problem

前期我们的研究发现,Cd处理增加了白桦三萜的含量,增加的三萜是否具有缓解Cd胁迫的作用还不清楚

Benefits of technology

[0006] This invention provides a method for Cd-resistant engineered yeast, the main contents of which are: obtaining engineered yeast strains transgenic with the LUS gene, wherein the LUS gene is the birch lupinol synthase gene; the yeast strains, before transgenic with the LUS gene, do not produce lupinol and are intolerant to cadmium; the cadmium concentration is 10 µmol·L⁻¹. -1 The effects of the above-mentioned technology are as follows: Cd treatment further increased the lupeol content in engineered yeast strains by 30% compared to the control group. Simultaneously, the growth plaques of Cd-treated engineered yeast strains after recovery culture were larger than those of unconverted yeast. These results further verify that birch lupeol has a role in alleviating Cd stress, expands the application range of secondary metabolites in stress tolerance, and provides a theoretical basis and technical support for cadmium-tolerant birch breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117187157B_ABST
    Figure CN117187157B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving the cadmium tolerance of white birch callus and yeast by lupinol and belongs to the technical field of biotechnology. ‑1 The application provides an application method of the lupinol for promoting the growth of white birch callus under cadmium treatment, and the treatment concentration is 100 micromole per liter ‑1 The application also provides a yeast engineering bacterium for biosynthesizing the lupinol, wherein the yeast cannot biosynthesize the lupinol before the LUS gene is transformed; the yeast engineering bacterium biosynthesizes the lupinol; the yeast engineering bacterium has the cadmium tolerance, and the isolation treatment concentration is 10 micromole per liter ‑1 The application coordinates the problems that the cadmium stress and the growth cannot be considered simultaneously, and provides a theoretical basis and technical support for the cadmium tolerance breeding of white birch.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for promoting the growth of birch callus and yeast under cadmium stress using lupeol. Background Technology

[0002] Cadmium (Cd) is a non-essential element in organisms and a highly toxic heavy metal, primarily transferred to plants, animals, and humans through soil and water. Cd stress triggers plant signal transduction pathways, disrupting redox homeostasis and the absorption of water and mineral nutrients, reducing photosynthetic and respiration capacity, altering cellular metabolism, and ultimately leading to growth inhibition, developmental delay, and even death. To cope with Cd stress, plants have evolved various detoxification mechanisms, including limiting Cd uptake, chelation, vacuolar storage, and activating antioxidant defense systems. Exogenous application of plant hormones, signaling molecules, and antioxidants can alleviate Cd-induced plant stress.

[0003] Lupeol is a pentacyclic triterpenoid compound derived from plants and is a precursor to lupeane-type triterpenoids. Lupeol and its derivatives, such as betulinic acid, possess antioxidant, anti-inflammatory, anticancer, antitumor, hypoglycemic, and skin-healing-promoting physiological activities, attracting widespread attention in the pharmaceutical field. The biosynthesis of lupeol begins with two isopentenyl pyrophosphate molecules and one dimethylenyl pyrophosphate molecule. Farnesyl pyrophosphate synthase (FPS) catalyzes this process, promoting the formation of squalene. Squalene is then converted to 2,3-oxidized squalene by squalene epoxidase (SE). Subsequently, lupeol synthase (LUS) catalyzes the cyclization reaction of 2,3-oxidized squalene to generate lupeol.

[0004] Birch (Betula platyphylla Suk.) is a deciduous tree belonging to the genus Betulaceae in the family Betulaceae. It is a pioneer species for secondary forests, rapidly growing on logged wastelands or burned areas, and is mainly distributed on mountain slopes or in forests at altitudes of 400-4100 meters. Birch bark is rich in triterpenoids such as lupeol, betulinol, and betulinic acid, which account for approximately 25% of the bark. Our previous research found that Cd treatment increased the content of betulin triterpenoids, but whether this increased content alleviates Cd stress remains unclear. Therefore, this invention aims to explore the role of lupeol, one of the betulin triterpenoids, under cadmium stress. This invention will provide theoretical and technical support for breeding cadmium-tolerant birch or utilizing secondary metabolites to alleviate heavy metal stress such as cadmium. Summary of the Invention

[0005] This invention provides a method for improving the Cd tolerance of birch callus with lupeol. The main content is that exogenous application of lupeol can alleviate the inhibitory effect of Cd stress on the growth of birch callus. The treatment concentration is 100 µmol·L⁻¹. -1Cadmium and 3 µmol·L -1 Lupinol was treated for 20 days. The effect of the technology was: 100 µmol·L⁻¹ -1 The fresh weight of birch callus treated with Cd and 3 µM lupeol was twice that of Cd-treated callus alone, which effectively reconciled the imbalance between cadmium stress and growth.

[0006] This invention provides a method for Cd-resistant engineered yeast, the main contents of which are: obtaining engineered yeast strains transgenic with the LUS gene, wherein the LUS gene is the birch lupinol synthase gene; the yeast strains, before transgenic with the LUS gene, do not produce lupinol and are intolerant to cadmium; the cadmium concentration is 10 µmol·L⁻¹. -1 The effects of the above-mentioned technology are as follows: Cd treatment further increased the lupeol content in engineered yeast strains by 30% compared to the control group. Simultaneously, the growth plaques of Cd-treated engineered yeast strains after recovery culture were larger than those of unconverted yeast. These results further verify that birch lupeol has a role in alleviating Cd stress, expands the application range of secondary metabolites in stress tolerance, and provides a theoretical basis and technical support for cadmium-tolerant birch breeding. Attached Figure Description

[0007] Appendix Figure 1 Lupinol and Cd treatment of birch callus in the next growth cycle;

[0008] Appendix Figure 2 Fresh weight of birch callus treated with lupeol and Cd for the next growth cycle.

[0009] Appendix Figure 3 Electrophoresis diagram of PCR amplification products of the LUS gene of birch lupin synthase.

[0010] Appendix Figure 4 LUS-pYES2 recombinant vector map;

[0011] Appendix Figure 5 LUS validation electrophoresis image in engineered yeast;

[0012] Appendix Figure 6 Lupinol is produced in engineered yeast strains;

[0013] Appendix Figure 7 Growth curves in engineered yeast strains;

[0014] Appendix Figure 8 Lupeol content in engineered yeast strains treated with Cd;

[0015] Appendix Figure 9 Plaque growth of engineered yeast strains under Cd treatment; Detailed Implementation

[0016] Experimental materials: Birch callus tissue preserved in our laboratory and INVSC1 Saccharomyces cerevisiae purchased from Shanghai Weidi Biotechnology Co., Ltd. The sterile birch seedlings were obtained by first soaking birch seeds in an ethanol solution, then in a sodium hypochlorite solution, and finally rinsing with sterile distilled water.

[0017] Extraction and determination of lupeol: Lupeol was extracted with n-hexane using extraction method. The content of lupeol was determined using a Waters 600-717-2487 chromatographic system with a Waters C18 column (250 mm × 4.6 mm), acetonitrile as the mobile phase, a flow rate of 1 mL / min, a detection wavelength of 206 nm, a column temperature of 25℃, a sensitivity of 16 AUFS, and an injection volume of 20 μL.

[0018] Example 1: Effect of lupeol on the growth of birch callus under Cd treatment

[0019] The specific implementation of Example 1 is as follows:

[0020] 1) Select birch callus tissue with uniform growth and inoculate it with a solution containing 0.6 mg·L⁻¹ -1 Thiabenzodime, 0.3 mg·L -1 6-Benzyladenine, 0.45 mg·L -1 Proliferation culture on B5 medium of 2,4-dichlorophenoxyacetic acid, i.e., callus proliferation;

[0021] 2) Weigh out 1 gram of the expanded callus tissue and inoculate it into a solution containing 100 µmol·L⁻¹ -1 Cd, 1 µmol·L -1 Lupeol, 3 µmol·L -1 Lupeol, 100 µmol·L -1 Cd+1 µM lupeol, 100 µmol·L -1 Cd + 3 µmol·L -1 Lupinol was cultured on a medium for 20 days. Photos were taken after the culture period, and the results are as follows: Figure 1 As shown, analysis of the callus morphology revealed that lupeol could alleviate the inhibition of birch callus growth by Cd treatment.

[0022] 3) After cultivation, callus tissues under different treatments were harvested, and the fresh weight was measured after blotting with filter paper. The fresh weight results are as follows: Figure 2 As shown, 100 µmol·L -1 The combined treatment with Cd and 3 µM lupeol showed the best results, increasing the fresh weight of callus (control group) by 2 times compared to Cd-only treatment. It was also found that 1 µmol·L⁻¹… -1and 3µmol·L -1 The fresh weight of callus treated with lupeol was not significantly different from that of the control.

[0023] Example 2: Obtaining engineered yeast

[0024] The specific implementation of Example 2 is as follows:

[0025] 1) Cloning of the birch lupin alcohol synthase LUS gene: The birch LUS gene was cloned using PCR. The primer sequences required for cloning were: LUS-F ATGTGGAAGTTGAAGATAGCGGAAGGAGG and LUS1-R TCATGCAAATAGAACTCGCCTCCGATATTCTC; the electrophoresis image of the LUS gene PCR amplification product is shown below. Figure 3 As shown, lane 0 represents a 5000 bp marker, and lane 1 represents the LUS gene amplification band. The accession number for this gene obtained from NCBI is OP810572.

[0026] 2) Obtaining engineered yeast strains: While *Saccharomyces cerevisiae* INVSC1 does not produce lupeol, it contains squalene 2,3-oxide, a precursor to lupeol production. Therefore, this invention employs an enzymatic ligation method to recombinant the *Lupeol synthase* LUS gene into the yeast vector pYES2 to obtain the pYES2-LUS recombinant, as shown below. Figure 4 As shown; subsequently, the pYES2-LUS recombinant was transformed into INVSC1 Saccharomyces cerevisiae using the lithium chloride method to obtain LUS-transgenic yeast engineered strains, as shown. Figure 5 As shown in the electrophoresis diagram, lane 0 is the 2000 bp marker, lanes 1-8 are the LUS gene validation bands, and lane 9 is the negative control; the engineered yeast can produce lupeol, as shown in the results. Figure 6 As shown.

[0027] The yeast culture medium described in Example 2 is SC-Ura medium supplemented with 2% glucose.

[0028] Example 3: Growth of engineered yeast and lupeol content under Cd stress

[0029] 1) Over one growth cycle, the growth curves of INVSC1 Saccharomyces cerevisiae and engineered yeast were basically in agreement, as shown in the following results. Figure 7 As shown, the pYES2-LUS recombinant does not affect the growth of INVSC1 Saccharomyces cerevisiae.

[0030] 2) Compared with engineered yeast, 10 µmol·L -1 Cd treatment for 18 hours further increased the lupeol content in engineered yeast by 30% compared to the control, as shown in the results. Figure 8 As shown.

[0031] 3) 10 µmol·L -1 After treating INVSC1 Saccharomyces cerevisiae and engineered yeast with Cd for 18 hours, the cultures were diluted at different concentrations and then subjected to 3-day recovery culture. The results are as follows: Figure 9 As shown, the growth plaques of engineered yeast under Cd treatment were larger than those of INVSC1 Saccharomyces cerevisiae, especially at a dilution of 10. 4 and 10 5 The effect is obvious.

[0032] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

[0033] The terms “including,” “having,” “containing,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

Claims

1. A method for improving the cadmium resistance of birch callus with lupeol, characterized in that, Birch callus was inoculated onto a culture medium containing cadmium and lupeol and cultured.

2. The method according to claim 1, characterized in that, Birch callus was inoculated with 100 µmol·L⁻¹ solution -1 Cadmium and 3 µmol·L -1 Lupinol was cultured on B5 medium.

3. The method according to claim 2, characterized in that, The culture was carried out under light for 20 days.

4. The method as described in claim 2, characterized in that, The birch callus tissue was derived from the stem segments of sterile birch seedlings.

5. The method according to claim 4, characterized in that, The sterile birch seedlings are obtained by first soaking birch seeds in an ethanol solution, then in a sodium hypochlorite solution, and finally rinsing them with sterile distilled water.

6. A method for cultivating cadmium-tolerant yeast, characterized in that, The engineered yeast strain improves cadmium resistance through the biosynthesis of lupeol, and the steps to obtain it include: (1) Cloning of the birch lupin alcohol synthase (LUS) gene; (2) Recombination of LUS gene with yeast vector; (3) Obtaining engineered yeast strains; (4) The engineered yeast strain is cultured in a cadmium-containing medium.

7. The method according to claim 6, characterized in that, The yeast mentioned is INVSC1 Saccharomyces cerevisiae.

8. The method according to claim 7, characterized in that, The INVSC1 brewer's yeast itself does not biosynthesize lupeol.

9. The method according to claim 6, characterized in that, The engineered yeast strains biosynthesize lupeol.

10. The method according to claim 6, characterized in that, The cadmium treatment concentration for engineered yeast was 10 µmol·L⁻¹. -1 .