Cold-tolerant cellulase mutants

CN117187218BActive Publication Date: 2026-08-21QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311344960.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-11-13
Publication Date
2026-08-21
Estimated Expiration
2039-11-13

AI Technical Summary

Benefits of technology

[0017]The cellulase mutants provided by this invention exhibit higher tolerance and enzyme activity under low-temperature conditions. Compared with the wild type, the cellulase mutants containing single-point mutations of H120Q, V130F, V130L, and D179S, respectively, generally showed a 10.0%-56.7% increase in relative enzyme activity at 40℃. Among them, the V130L single-point mutant achieved a relative enzyme activity as high as 94% at 40℃, achieving unexpected technical results.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to the technical fields of genetic engineering and protein modification, and particularly relates to a low-temperature-resistant cellulase mutant and application thereof. The mutant provided by the present application comprises substitution of amino acids at at least one position selected from the group consisting of 120, 130 and 179. The relative enzyme activity of the mutant at 40 DEG C is significantly improved, thereby facilitating the wide application of cellulase in the textile field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein modification technology, specifically to a low-temperature resistant cellulase mutant and its applications. Background Technology

[0002] Cellulase is a collective term for a group of enzymes that catalyze the hydrolysis of cellulose to produce glucose and low-polymerization cellulose. It comprises three main components: endoglucanase, exoglucanase, and cellobiase. Cellulase is not a single enzyme but a multi-component enzyme system that works synergistically. Cellulase is widely found in organisms in nature; bacteria, fungi, and animals can all produce it. Cellulase used in industrial production is generally derived from fungi, with Trichoderma, Aspergillus, and Penicillium being typical examples. Cellulase is one of the most widely used enzymes in industry, finding broad applications in textiles, detergents, pulp and paper, feed, and food industries. It also has significant potential markets in oil extraction and pharmaceuticals.

[0003] Cellulases can be classified into various glycosyl hydrolases according to their primary sequence. For example, glycosyl hydrolases families 5, 7, 12, and 45 contain endoglucanases. Most textile acid cellulases belong to family 5, while most textile neutral cellulases belong to families 12 or 45.

[0004] Currently, in the textile industry, cellulase is widely used for bio-treatment, or enzymatic degradation treatment, of cellulose fabrics. The treated fabrics are fluffy, full, soft, smooth, with a clear surface, good drape, strong moisture absorption, and a certain "silky" effect. Neutral cellulase has a gentle abrasive effect on fabrics, with minimal loss of fabric strength and color staining. It results in a fuller hand feel, and satisfactory finishing effects can be achieved with a cellulase dosage of 0.5%–3%, offering advantages such as environmental friendliness, energy saving, and high efficiency. However, most industrial cellulases typically achieve high catalytic efficiency at temperatures above 50°C. In the textile field, to save on heating or cooling costs and to improve colorfastness and reduce shrinkage, treatment is generally carried out at low temperatures of 30°C–40°C. Therefore, there is an urgent need to develop cellulases that maintain high enzyme activity at low temperatures. Summary of the Invention

[0005] The purpose of this invention is to provide a low-temperature cellulase mutant and its applications. This invention obtains a mutant protein by protein engineering the cellulase. Compared to the wild type, the mutant maintains higher enzyme activity under low-temperature conditions, thus ensuring effective hair removal and washing, and is more suitable for treating textiles under low-temperature conditions.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention relates to a cellulase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and having an amino acid substitution at at least one of positions 120, 130, and 179 compared to SEQ ID NO:1.

[0007] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0008] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0009] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: H120Q, V130F / L, D179S.

[0010] In some embodiments of the present invention, the mutant comprises the following substitutions or combinations thereof: H120Q, V130F, V130L, D179S, H120Q / V130F, H120Q / V130L, H120Q / D179S, V130F / D179S, V130F / D179S, H120Q / V130F / D179S, or H120Q / V130L / D179S.

[0011] The present invention also relates to DNA molecules encoding the above-mentioned cellulase mutants.

[0012] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0013] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0014] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0015] The recombinant expression vector was transformed into Trichoderma reesei host cells for recombinant expression, and the resulting cellulase mutant had higher enzyme activity under low temperature conditions.

[0016] The present invention also relates to the application of the above-mentioned cellulase mutant in the textile field.

[0017] The cellulase mutants provided by this invention exhibit higher tolerance and enzyme activity under low-temperature conditions. Compared with the wild type, the cellulase mutants containing single-point mutations of H120Q, V130F, V130L, and D179S, respectively, generally showed a 10.0%-56.7% increase in relative enzyme activity at 40℃. Among them, the V130L single-point mutant achieved a relative enzyme activity as high as 94% at 40℃, achieving unexpected technical results.

[0018] Furthermore, the cellulase mutants provided by this invention, comprising any two or three mutation sites from H120Q, V130F / L, and D179S, such as the two-point mutants H120Q / V130F, H120Q / V130L, H120Q / D179S, V130F / D179S, and V130F / D179S, and the three-point mutants H120Q / V130F / D179S and H120Q / V130L / D179S, generally exhibit a 10.0%-78.2% increase in relative enzyme activity compared to wild-type cellulase NT45 at 40°C. Therefore, the cellulase mutants described in this invention are more suitable for application in the textile industry than the wild type, significantly reducing the amount of cellulase used, saving labor and energy, and lowering production costs. Detailed Implementation

[0019] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, this invention is not limited to any specific methods, experimental protocols, and reagents described.

[0020] The present invention will now be described in detail with reference to specific embodiments.

[0021] Example 1 Screening of cellulase mutants To improve the enzyme activity of wild-type cellulase NT45 (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2) under low-temperature conditions, the applicant screened for a large number of mutations in amino acids near the active site of the enzyme using directed evolution technology.

[0022] The PCR primers NtE-F1 and NtE-R1 were designed as follows: NtE-F1: GGC GAATTCATGCGCTCCT CCACCATTC (underlined characters represent restriction endonucleases) Eco RI identification site); NtE-R1: ATA GCGGCCGC TTAGGCGCACTGGTGGTAGTAGTC (underlined characters represent restriction endonucleases) Not I. Identification site).

[0023] Using the wild-type cellulase NT45 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Stratagene). The PCR products were recovered from the gel. Eco RI Not After enzyme digestion, I was ligated with the pET21a vector that had been digested with the same enzyme, and transformed into E. coli BL21(DE3). The transformed cells were plated on LB+Amp plates and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plates were incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break up the cell walls, thus obtaining E. coli cell lysate containing cellulase.

[0024] 50 μL of lysis buffer was transferred to two new 96-well plates, and the cellulase activity was measured at 40℃ and 50℃, respectively. The activity at 50℃ was taken as 100%, and the relative activity at 40℃ was calculated. The results showed that compared with wild-type cellulase NT45, some mutants showed no change in relative activity at 40℃, some mutants even showed a decrease in relative activity, and some mutations, although increasing the relative activity at 40℃, significantly altered the enzymatic properties of the cellulase, all of which did not meet the requirements. Ultimately, the applicant obtained mutation sites that significantly increased the relative activity of cellulase at 40℃ without affecting the original enzymatic properties: H120Q, V130F, V130L, and D179S.

[0025] Based on cellulase NT45, this invention provides cellulase mutants containing single-point mutations in H120Q, V130F, V130L, and D179S, respectively. It also provides cellulase mutants containing any two or three mutation sites from H120Q, V130F / L, and D179S, such as two-point mutants (H120Q / V130F, H120Q / V130L, H120Q / D179S, V130F / D179S, V130F / D179S) and three-point mutants (H120Q / V130F / D179S, H120Q / V130L / D179S). Example 2 Expression of cellulase mutant in Trichoderma reesei 2.1 Gene Synthesis and Plasmid Construction The applicant optimized the synthesis of the coding nucleotide sequence of the wild-type cellulase (SEQ ID NO: 2) and the coding nucleotide sequence of the mutant described in Example 1, based on the codon preference of *Trichoderma reesei*, and added two restriction enzyme sites, KpnI and XbaI, to the 5' and 3' ends of the synthesized sequences, respectively. The gene synthesis was performed by Shanghai Sangon Biotech Co., Ltd.

[0026] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and XbaI, respectively; simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI (Fermentas) and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). The sequencing results showed that the sequencing results of multiple clones were consistent.

[0027] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).

[0028] 2.2 Protoplast Preparation A suspension of U4 spores from the cellulase gene-deficient host fungus *Trichoderma reesei* was inoculated onto a PDA plate and incubated at 30°C. After 6 days, once the mycelium has produced abundant spores, cut colonies of approximately 1 cm × 1 cm and place them in a liquid culture medium containing 120 mL of YEG+U (0.5% yeast extract, 1% glucose, 0.1% uridine). Incubate at 30°C and 220 rpm for 14–16 h with shaking. Collect the mycelium by filtration through sterile gauze and wash it once with sterile water. Place the mycelium in an Erlenmeyer flask containing 20 mL of 10 mg / mL lysin solution (Sigma L1412) and incubate at 30°C and 90 rpm for 1–2 h. Observe and detect the progress of protoplast transformation under a microscope.

[0029] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (pcs / mL).

[0030] 2.3 Expression vector transformation and strain validation All the following operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Finally, 4 mL of PEG solution was added... 1.2M sorbitol, gently mixed, is poured into the melted upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) and gently mixed. It is then spread on the prepared lower medium (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar) and incubated at 30℃ for 5–7 days until transformants appear. Transformants were picked and transferred to the lower culture medium plate and cultured at 30℃ for 2 days. An appropriate amount of mycelium was placed in a 2mL centrifuge tube, and 100mg of sterile quartz sand and 400μL of extraction buffer (100mM Tris-HCl, 100mM EDTA, 250mM NaCl, 1% SDS) were added. The mixture was shaken vigorously for 2min. After incubating in a 65℃ water bath for 20min, 200μL of 10M NH4AC was added, and the mixture was incubated on ice for 10min. The mixture was centrifuged at 13000rpm for 10min. The supernatant was collected, and 2 volumes of anhydrous ethanol were added. The mixture was placed at -20℃ for 30min. The mixture was centrifuged at 13000rpm for 10min, and the supernatant was discarded. The mixture was washed twice with 70% ethanol. The mixture was dried, dissolved in water, and stored at -20℃.

[0031] Using the extracted transformant genomic DNA as a template, PCR amplification was performed using primers M6-F and M6-R for verification.

[0032] M6-F: ATGCGCTCCT CCACCATTC; M6-R: TTAGGCGCACTGGTGGTAGTAGTC.

[0033] PCR amplification conditions were 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis, and an engineered Trichoderma reesei containing the cellulase gene was constructed.

[0034] 2.4 Fermentation Verification The above-mentioned engineered Trichoderma reesei strains were inoculated onto PDA plates and cultured at 30℃ for 6 days. After the spores were abundant, two mycelial blocks with a diameter of 1 cm were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were cultured at 30℃ for 48 hours, and then at 25℃ for 48 hours. The fermentation broth was then used for enzyme activity determination and enzymatic property detection.

[0035] Example 3 Enzyme activity assay and enzymatic property analysis 3.1 Method for determining cellulase activity Under conditions of 50°C and pH 6.0, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a 5 mg / ml sodium carboxymethyl cellulose solution is defined as one enzyme activity unit (U), where the reducing sugar is in equal amounts to glucose.

[0036] Add 0.5 mL of CMC substrate to each of three test tubes and preheat them together with the enzyme solution at 50°C for 5 min. Add 0.5 mL of the test solution to each of the first and second test tubes and start the reaction at 50°C for 15 min. After the reaction is complete, add 1.5 mL of DNS reagent to each of the three test tubes, and add 0.5 mL of the enzyme solution to the third test tube. Remove and shake the three test tubes well, and react them in a boiling water bath for 5 min. Quickly cool to room temperature and dilute to 5.0 mL with water. Using the solution in the third test tube as a control, measure the absorbance of the solutions in the first and second test tubes at a wavelength of 540 nm. The absorbance should be between 0.25 and 0.35. The absolute value of the difference between the absorbance of the enzyme solution and the absorbance of the control enzyme solution should not exceed 0.015.

[0037] Enzyme activity X = (equivalent amount of glucose / 180 / 15 / 0.5) × n Where: X—enzyme activity unit, IU / g (mL); 180 — Glucose converted from micrograms to micromoles; 15 — Reaction time between the test solution and the substrate; 0.5 — The amount of the enzyme solution to be tested added to the reaction; n – dilution factor.

[0038] 3.2 Enzyme activity assay Enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the recombinant wild-type cellulase NT45 and its mutant Trichoderma reesei obtained in Example 2 of this invention was 50-200 U / mL.

[0039] 3.3 Analysis of Low Temperature Resistance The enzyme activity of the fermentation supernatant of the above-mentioned recombinant wild-type cellulase NT45 and its mutant was measured at 40℃, 50℃ and pH 6.0 respectively. The relative enzyme activity of wild-type cellulase NT45 and its mutant at 40℃ was calculated as 100% of the enzyme activity at 50℃. The results are shown in Table 1.

[0040] Relative enzyme activity = enzyme activity at 40℃ / enzyme activity at 50℃ × 100%.

[0041] Table 1. Relative enzyme activity of cellulase at 40℃ Wild type NT45 60% H120Q single-point mutant 66% V130F single-point mutant 88% V130L single-point mutant 94% D179S single-point mutant 67% As can be seen from the data in Table 1, compared with wild-type cellulase NT45, the single-point mutant provided by this invention generally showed a 10.0%-56.7% increase in relative enzyme activity at 40℃, indicating that the enzyme activity level of the single-point mutant provided by this invention was significantly improved at the low temperature of 40℃. Among them, the V130L single-point mutant achieved a relative enzyme activity as high as 94% at 40℃, achieving an unexpected technical effect.

[0042] Furthermore, the cellulase mutants provided by this invention, which contain any combination of two or three mutation sites among H120Q, V130F / L, and D179S, such as the two-point mutants H120Q / V130F, H120Q / V130L, H120Q / D179S, V130F / D179S, and V130F / D179S, and the three-point mutants H120Q / V130F / D179S and H120Q / V130L / D179S, generally exhibit a 10.0%-78.2% increase in relative enzyme activity compared to wild-type cellulase NT45 at 40°C, achieving unexpected technical results.

[0043] In summary, the cellulase mutant provided by this invention exhibits higher enzyme activity under low-temperature conditions, making it more suitable for application in the textile industry and showing great promise.

[0044] Example 4: Application of cellulase mutants in the textile industry 4.1 One-bath process for depilation and dyeing of knitted and woven fabrics The application temperature is 35-55℃; Processing time is 30-150 minutes; The pH range is 4.0-8.5; The above process conditions are particularly suitable for dyeing in the same bath; the applicable bath ratio range is 1:5-1:30, and the equipment types used are overflow dyeing machines, roll dyeing machines, washing machines, etc. The amount of cellulase mutant is 300-900 U / L.

[0045] The cellulase mutant provided by this invention removes hair cleanly with minimal loss of fabric strength, and can achieve dyeing and hair removal processes in one bath.

[0046] 4.2 Application of pattern raising and depilation in denim fabrics The application temperature is 35-55℃; Processing time is 10-60 minutes; The pH range is 4.0-8.5; The above process conditions can be applied to desizing and dehairing / flowering processes under separate stone washing conditions; the applicable liquor ratio range is 1:5-1:30, the equipment type used is industrial washing machine, etc., and the dosage of cellulase mutant is 300-900U / L.

[0047] The cellulase mutant provided by this invention removes hair cleanly, produces uniform fluff with small fluff spots, and causes minimal loss of fabric strength.

[0048] The above experimental results show that the low-temperature cellulase mutant of the present invention can be widely used in the textile processing field. It can be used directly under low temperature conditions of 35-55℃ and pH range of 4.0-8.5 without acid adjustment, and the effect is good. It removes hair cleanly with little loss of fabric strength. When washing denim, it results in less fuzzing, smaller fuzz spots, and stable batch differences. It has good salt resistance and can be used directly in the polishing and dyeing one-bath process after neutralization and deoxygenation, which can greatly save time and reduce production costs.

[0049] Moreover, compared with wild-type cellulase NT45, the amount of cellulase mutant required to achieve the same treatment effect is reduced by 18.5-43.4%, which significantly reduces the enzyme cost in the processing and is conducive to further reducing production costs.

Claims

1. A cellulase mutant, characterized in that, The mutant is a cellulase with the amino acid sequence SEQ ID NO:1 having a substitution at amino acid position 130, wherein the substitution is V130F or V130L.

2. A cellulase mutant, characterized in that, The mutant is a cellulase with the amino acid sequence SEQ ID NO:1 containing only H120Q / V130F or H120Q / V130L substitutions.

3. A DNA molecule encoding the cellulase mutant of claim 1 or 2.

4. A vector having the DNA molecule of claim 3.

5. A host cell comprising the vector of claim 4.

6. The host cell as described in claim 5, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

7. The application of the cellulase mutant according to claim 1 or 2 in the textile field.

Citation Information

Patent Citations

  • Polypeptides having endoglucanase activity and polynucleotides encoding same

    CN105518142A

  • Cellulase variants and polynucleotides encoding same

    CN108463552A