A DNA sequence for down-regulating expression of GmSST1 gene, a vector, a strain and application thereof in cultivating salt-tolerant plants

Abstract

The application provides a DNA sequence for down-regulating expression of a GmSST1 gene, a vector, a strain and application of the DNA sequence in cultivating salt-tolerant plants, and belongs to the technical field of molecular biology; the application provides application of the GmSST1 gene in cultivating salt-tolerant plants, and the salt-tolerance of plants can be improved by down-regulating expression or silencing the GmSST1 gene; the recombinant strain into which the DNA sequence for down-regulating expression or silencing the GmSST1 gene is transferred is used to infect plants, so that the GmSST1 gene can be down-regulated in plants, and the salt-tolerance of plants is improved, which has great significance for improving the yield of plants on salinized land.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a DNA sequence, vector, strain for downregulating the expression of the GmSST1 gene and its application in cultivating salt-tolerant plants. Background Technology

[0002] Soybeans are an important grain and oilseed crop, and a major source of plant protein. However, China's current soybean production accounts for only a small portion of the world's total, far from meeting domestic consumer demand. China has approximately 3.69 × 10⁻⁶ m³ of saline-alkali soil. 7 hm 2 (Foyer CH, Noctor G. Oxygen processing in photosynthesis: regulation and signalling. New Phytol, 2000, 146(3):367-421.). With the gradual reduction of arable land, improving crop salt tolerance has become very important. Cultivated soybeans are moderately salt-tolerant plants; under salt stress, soybean nodulation, growth, agronomic traits, seed quality, and quantity are significantly affected. If salt-tolerant soybean varieties can be developed and this portion of arable land utilized, my country's soybean production can be greatly increased, alleviating the country's dependence on imported soybeans.

[0003] Analyzing the mechanism regulating salt tolerance in soybean at the molecular level lays an important foundation for the more rational and efficient utilization of saline-alkali soil in production. Although previous studies have reported that genes such as GmCHX1, ​​GmCDF1, and GsERD15B are involved in regulating the salt tolerance of soybean (Qi, X., et al., Identification of a novel salt tolerance gene in wildsoybean by whole-genome sequencing. Nat Commun, 2014.5: p.4340.; Zhang, W., et al., A cation diffusion facilitator, GmCDF1, negatively regulates salt tolerance in soybean. PLoS Genet, 2019.15(1): p.e1007798.; Jin, T., et al., Natural variation in the promoter of GsERD15B affects salt tolerance in soybean). Biotechnol J, 2021.19(6):p.1155-1169.), but it is still necessary to vigorously explore more elements or functional genes related to soybean salt tolerance, so as to provide data support for making fuller use of saline soil in production.

[0004] Understanding the physiological, metabolic, and biochemical responses of plants to salt stress, and exploring the genetic resources related to salt tolerance in nature, is extremely important for breeding salt-tolerant crops. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a DNA sequence, vector, strain for downregulating or silencing the GmSST1 gene and its application in cultivating salt-tolerant plants.

[0006] This invention provides the application of the GmSST1 gene in the cultivation of salt-tolerant plants by downregulating or silencing the GmSST1 gene in plants.

[0007] This invention provides the application of the GmSST1 gene in increasing plant fresh weight and plant height by downregulating or silencing the GmSST1 gene in plants.

[0008] Preferably, the nucleotide sequence of the GmSST1 gene is shown in SEQ ID NO: 1.

[0009] The present invention provides a DNA fragment for downregulating or silencing the GmSST1 gene, the nucleotide sequence of which is shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0010] The present invention provides a recombinant vector for downregulating or silencing the GmSST1 gene, the recombinant vector comprising an initial vector and the DNA fragment for downregulating the GmSST1 gene.

[0011] Preferably, the initial vector comprises a pEGAD expression vector, wherein the DNA fragment that downregulates GmSST1 gene expression is ligated between the Sma I and BamHI restriction sites of the initial vector.

[0012] The present invention provides a recombinant strain that downregulates or silences the GmSST1 gene, wherein the recombinant strain is transformed into the recombinant vector in the original strain.

[0013] Preferably, the original strain is Agrobacterium plantarum.

[0014] This invention provides a method for cultivating salt-tolerant plants, comprising the following steps:

[0015] 1) Explants were obtained by infecting plant cotyledons with the recombinant strain described above;

[0016] 2) After culturing the explants in a culture medium for 2-4 days, transfer them to a new culture medium to induce hairy roots;

[0017] 3) Once the hairy roots reach 7-8 cm in length and true leaves emerge, transplant the hairy root composite seedlings into the substrate for cultivation to obtain salt-tolerant plants.

[0018] Preferably, the infection time in step 1) is 20–50 min; the OD of the recombinant bacterial culture... 600 It ranges from 0.5 to 0.8.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The present invention is the first to discover the relationship between the GmSST1 gene and the salt tolerance of plants, and provides the application of the GmSST1 gene in the cultivation of salt-tolerant plants. Downregulating or silencing the GmSST1 gene can significantly improve the salt tolerance of plants.

[0020] This invention designs a DNA fragment that can downregulate or silence the GmSST1 gene; the DNA fragment can significantly downregulate or silence the GmSST1 gene.

[0021] This invention constructs a recombinant vector for downregulating or silencing the GmSST1 gene and a recombinant bacterial strain. Infecting plants with the recombinant strain can downregulate or silence the GmSST1 gene in plants, thereby improving the salt tolerance of plants, increasing plant height and fresh leaf weight; this is of great significance for improving plant yield. Attached Figure Description

[0022] Figure 1 To analyze the phenotypic effect of downregulating or silencing the GmSST1 gene on salt tolerance in soybean, the following comparisons were made: a) Comparison of growth morphology between transgenic plants with downregulated or silenced GmSST1 expression and those transformed with empty vector (EV) under 0 mM NaCl treatment; b) Comparison of growth morphology between transgenic plants with downregulated or silenced GmSST1 expression and those transformed with empty vector (EV) under 120 mM NaCl treatment; c) Comparison of plant height between transgenic plants with downregulated or silenced GmSST1 expression and those transformed with empty vector under 0 mM NaCl treatment; d) Comparison of fresh leaf weight between transgenic plants with downregulated or silenced GmSST1 expression and those transformed with empty vector (EV) under 120 mM NaCl treatment.

[0023] Figure 2 To analyze the gene expression levels of transgenic plants expressing GmSST1 and transgenic plants transformed with empty vectors (EVs), where a represents the expression level of the DNA fragment that downregulated or silenced the GmSST1 gene, and b represents the expression level of the GmSST1 gene. Detailed Implementation

[0024] This invention provides the application of the GmSST1 gene in the cultivation of salt-tolerant plants by downregulating or silencing the GmSST1 gene in plants.

[0025] This invention also provides the application of the GmSST1 gene in increasing plant fresh weight and plant height by downregulating or silencing the GmSST1 gene in plants.

[0026] In this invention, the plant is preferably a monocotyledonous or dicotyledonous plant; the monocotyledonous plant includes soybean, corn, wheat, rice, peanut, or alfalfa; in the specific implementation of this invention, the plant is preferably soybean. In this invention, the nucleotide sequence of the GmSST1 gene is shown in SEQ ID NO: 1, specifically as follows:

[0027] ATGTCTTACATGCAACTGTCTCAGAAGTTTTACGATGCTTTCAAGC

[0028] TGTGTGGGTCCCCACCCATTGCTCGCAAACTTCATGCCCAACTCATACT

[0029] CTCTGGTTTGGACGCTTCCCTTTTCTTACTCAACAATCTATTGCACATGT

[0030] ACTCCAACTGCGGCATGGTAGACGATGCTTTTTGCGTTTTCCGTGAGGC

[0031] CAACCATGCCAATATCTTCACTTGGAACACCATGCTCCATGCCTTTTTT

[0032] GATTCGGGTCGAATGAGGGAAGCAGAGAACTTGTTTGATGAAATGCCC

[0033] CATATAGTGAGAGACTCCGTTTCATGGACCACCATGATATCCGGCTATTG

[0034] TCAAAACGGCCTCCCTGCTCATAGCATCAAAACTTTTATGTCAATGCTC

[0035] CGGGACTCCAATCATGACATTCAAAACTGTGACCCCTTTTCCTATACTT

[0036] GTACTATGAAGGCTTGTGGCTGCCTTGCCTCCACTCGGTTTGCTCTTCA

[0037] GTTGCATGCCCATGTCATCAAGTTACATTTGGGAGCCCAAACCTGCATT

[0038] CAGAACTCCCTTGTTGATATGTATATTAAGTGTGGAGCAATCACTTTGG

[0039] CTGAGACTGTTTTCCTTAACATTGAAAGCCCAAGTTTGTTCTGTTGGAA

[0040] CAGTATGATTTATGGATATTCTCAATTATATGGACCCTATGAAGCTCTCCA

[0041] CGTGTTCACCCCGAATGCCTAAACATGACCATGTTTCTTGGAACACGCTG

[0042] ATCTCAGTGTTCTCTCAATACGGCCATGGGATCCGCTGTCTTAGTACGTA

[0043] TGTGGAGATGTGCAATCTGGGGGTTTAAGCCCAATTTCATGACTTATGGC

[0044] AGTGTACTCAGTGCATGTGCCAGCATTTCTGATCTGAAATGGGGTGCCC

[0045] ATTTGCATGCTCGGATTCTTCGCATGGAACATAGCCTGGATGCGTTTTT

[0046] GGGAAGTGGTCTCATAGACATGTATGCCAAATGTGGATGCTTAGCACTG

[0047] GCGAGGCGTGTGTTTAACAGTTTAGGGGAACAGAATCAAGTTTCTTGG

[0048] ACTTGCTTGATTTCAGGGGTTGCACAGTTTGGACTTGGTGATGATGCTT

[0049] TGGCACTATTTAACCAAATGAGGCAGGCTTCTGTGGTGTTGGATGAATT

[0050] CACCCTTGTGACAATTCTTGGGGTTTGTTCAGGTCAAAATTATGCTGCC

[0051] ACTGGGGAACTACTTCATGGATATGCAATCAAAAATGGGATGGATTCCT

[0052] CTGTTCCTGTGGGGAATGCAATCATTACAATGTATGCAAGGTGTGGTGA

[0053] TACTGAGAAAGCTAGTCTTGCATTTAGATCAATGCCACTAAGAGATACC

[0054] ATATCATGGACGGCCATGATCACTGCATTCTCTCAGAATGGAGATATTG

[0055] ACAGGGCCCGCCAATGTTTTGATATGACGCCTGAGCGTAATGTCATAAC

[0056] TTGGAACTCCATGTTAAGCACATATATTCAACATGGCTTCTCGGAAGAA

[0057] GGGATGAAGTTGTATGTTTTGATGAGAAGCAAAGCAGTCAAACCGGAT

[0058] TGGGTCACTTTTGCAACATCTATCCGGGCCTGCGCTGATTTGGCTACTAT

[0059] AAAACTTGGGACACAAGTCGTATCTCATGTGACAAAGTTTGGACTTAG

[0060] TTCGGATGTTTCAGTTGCAAACAGTATTGTCACCATGTATTCAAGATGT

[0061] GGACAAATCAAAGAAGCACGGAAAGTTTTTGACTCAATACATGTGAAA

[0062] AACCTGATTTCCTGGAATGCCATGATGGCAGCATTTGCTCAAAATGGTT

[0063] TAGGCAATAAAGCAATCGAAACATATGAGGATATGTTAAGGACAGAAT

[0064] GCAAACCTGACCATATAAGCTATGTTGCTGTTTTATCTGGTTGCAGCCA

[0065] CATGGGGCTTGTAGTTGAAGGGAAACATTATTTTGATTCCATGACTCAA

[0066] GTGTTTGGCATTTCTCCAACAAATGAGCACTTTGCTTGTTTGGTAGATC

[0067] TGCTTGGCCGAGCAGGGTTACTAGACCAGGCCAAGAATTTAATAGACG

[0068] GAATGCCTTTTAAGCCAAATGCCACTGTTTGGGGTGCTCTACTAGGAGC

[0069] ATGCCGAATCCATCACGATTCAATACTAGCAAAAACTGCCGCAAAGAA

[0070] GTTGATGGAATTAAATGTTGAAGATTCTGGAGGTTATGTTCTTCTAGCA

[0071] AATATATATACAGAGTCTGGGGAACTAGAAAATGTTGCTGATATGAGAA

[0072] AGTTAATGAAAGTGAAAGGAATTCGAAAGAGTCCAGGTTGTAGCTGGA

[0073] TAGAGGTTGATAACAGGCTACATGTGTTTACTGTAGATGAAACCAGTCA

[0074] TCCACAGATAAACGAGGTTTATGTAAAACTGGAGGAGATGATGAAGAA

[0075] GATAGAAGATACAGGAAGATACGTTAGTATCGTCTCTTGTGCCCATAGG

[0076] AGTCAGAAATACCATAGTGAAAAGCTTGCTTTTGCTTTTGGGTTGCTTA

[0077] GTTTGCCACCTTGGATGCCTATACAAGTAACGAAGAATCTCCGCGTCTG

[0078] CAATGATTGTCACTTGGTAATAAAGTTGTTGTCCATGGTCACCTCAAGG

[0079] GAACTTATCATGAGAGATGGATTTCGATTTCATCATTTCAAGGATGGGTTTTGCTCCTGTCGAGACTACTGG。

[0080] This invention also provides a DNA fragment for downregulating or silencing the GmSST1 gene, the nucleotide sequence of which is shown in SEQ ID NO: 2 or SEQ ID NO: 3; specifically as follows:

[0081] AAAGCATCGTAAAACTTCTGAGACGTTGTTGTTGTTATGGTCTAAT TTAAATATGGTCTAAAGAAGAAGAATAAAGCATCGTAAAACTTCTGAG AC (SEQ ID NO: 2);

[0082] AAAGCATCGTAAAACTTCTGAGACGTTGTTGTTGTTATGGTCTAGT TGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGG TCTAAAGAAGAAGAATAAAGCATCGTAAAACTTCTGAGAC (SEQ ID NO: 3).

[0083] In this invention, the DNA fragment comprises sequence R, STTM-48 sequence (or STTM-88 sequence), and sequence R connected in sequence; specifically as follows:

[0084] STTM-48 sequence:

[0085] GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGA AT (SEQ ID NO: 4)

[0086] STTM-88 sequence:

[0087] GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAAT ATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT (SEQ ID NO: 5).

[0088] The present invention does not have any particular limitation on the preparation method of the DNA fragment for downregulating or silencing the GmSST1 gene. Conventional preparation methods in the art can be used. In the specific implementation of the present invention, the DNA fragment is prepared by direct synthesis of double strands.

[0089] The present invention also provides a recombinant vector for downregulating or silencing the GmSST1 gene, the recombinant vector comprising an initial vector and the DNA fragment for downregulating or silencing the GmSST1 gene.

[0090] In this invention, the initial vector includes a pEGAD expression vector, and the DNA fragment that downregulates the expression of the GmSST1 gene is preferably ligated between the Sma I and BamHI restriction sites of the initial vector.

[0091] In this invention, the recombinant vector is preferably prepared by double digestion of the initial vector with enzymes, followed by ligation of the linearized initial vector and the DNA fragment via homologous recombination. Following ligation, the ligation product is preferably transformed into competent *E. coli* cells for cloning and sequencing verification.

[0092] This invention also provides a recombinant bacterial strain that downregulates or silences the GmSST1 gene, wherein the recombinant strain is transformed into the recombinant vector in the original strain. In this invention, the original strain is preferably *Agrobacterium plantarum*, more preferably *Agrobacterium K599*, derived from Shanghai Weidi Biotechnology Co., Ltd. In this invention, the concentration of the recombinant vector is preferably 10–1000 ng / μl, more preferably 100–600 ng / μl; the volume ratio of the original strain to the recombinant vector is preferably 200:5–10.

[0093] The present invention also provides a method for cultivating salt-tolerant plants, comprising the following steps:

[0094] 1) Explants were obtained by infecting plant cotyledons with the recombinant strain described above;

[0095] 2) After culturing the explants in a culture medium for 2-4 days, transfer them to a new culture medium to induce hairy roots;

[0096] 3) Once the hairy roots reach 7-8 cm in length and true leaves emerge, transplant the hairy root composite seedlings into the substrate for cultivation to obtain salt-tolerant plants.

[0097] In this invention, explants are obtained by infecting plant cotyledons with the recombinant bacterial strain. In this invention, soybean is preferably used as an example, and the soybean variety is preferably W82 (the American variety Williams82). In this invention, soybean seed material is preferably disinfected, preferably by chlorine fumigation, and the disinfection time is preferably 9-12 hours, more preferably 10-11 hours. After disinfection, the seeds are placed on a culture medium for germination, preferably B5 medium; the germination time is preferably 4-6 days, more preferably 5 days; in this invention, the cotyledons are cut off when they are just about to open, preferably after a cross-cut at the lower end of the cotyledons before infection. In this invention, the infection time is preferably 20-50 minutes, more preferably 25-35 minutes; the OD of the recombinant bacterial suspension... 600 The preferred value is 0.5 to 0.8, and more preferably 0.6 to 0.7.

[0098] In this invention, after obtaining the explants, they are transferred to a culture medium and cultured for 2–4 days, then transferred to a new culture medium to induce hairy roots. In this invention, the culture medium is preferably 1 / 2 MS medium, and the pH of the culture medium is preferably 5.5–6.0, more preferably 5.6–5.8; the culture time is preferably 3 days; the new culture medium is freshly replaced 1 / 2 MS medium; and the hairy root induction time is preferably 6–8 days, more preferably 7 days.

[0099] In this invention, when the hairy roots reach 7-8 cm in length and true leaves emerge, the hairy root composite seedlings are transplanted into a substrate for cultivation to obtain salt-tolerant plants. In this invention, the substrate is preferably vermiculite, and the transplanted seedlings are preferably hairy root composite seedlings at similar developmental stages. Salt-tolerant plants can be obtained through conventional cultivation after transplanting.

[0100] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0101] Example 1

[0102] 1) Extraction of total RNA from the root tissue of Wilmas82 soybean

[0103] The mortar was treated at 180℃ for 8 hours to eliminate RNase contamination; chloroform, isopropanol, ethanol and other reagents were freshly opened and uncontaminated; other equipment such as pipette tips, centrifuge tubes and reagents such as ultrapure water and NaAc were treated with 1‰ DEPC water overnight and then sterilized by high temperature moist heat at 121℃ for 30 minutes, and pipette tips and centrifuge tubes were dried at 65℃ for later use.

[0104] Total RNA was extracted from soybeans using the Trizol method.

[0105] (1) Take 100mg of soybean root material and grind the material with liquid nitrogen. Add 1mL of TRI pure reagent (purchased from Adley Company, catalog number rn0102). After thorough homogenization, aspirate the homogenate into a 1.5ml centrifuge tube and let it stand at room temperature for 5min.

[0106] (2) Add 200 μl of chloroform, shake to mix, let stand for 5 min, centrifuge at 4℃, 12000 r / min for 10 min;

[0107] (3) Take the supernatant into another centrifuge tube, add an equal volume of isopropanol, shake to mix, precipitate at -20℃ for 30 min, centrifuge at 4℃, 12000 r / min for 10 min;

[0108] (4) Discard the supernatant, wash with 1 mL of 75% ethanol (prepared with DEPC-treated sterile water), centrifuge at 12000 r / min at 4℃ for 10 min, repeat twice, air dry at room temperature for 10 min, and add 20 μl of DEPC-treated RNase-free water (DEPC water) to dissolve the precipitate.

[0109] 2) Reverse transcription PCR

[0110] (1) Add 5 μL of soybean total RNA obtained in step 1) and 3 μL of oligo(dt)18 and 4 μL of dNTPs sequentially to a 200 μL PCR tube treated with DEPC, incubate at 65℃ for 5 min and then quickly place on ice to cool.

[0111] (3) Add the following solutions in the following order: 4 μl of 5X M-MLV buffer, 1 μl of RNase inhibitor (purchased from Thermo, catalog number E00382), 1 μl of M-MLV (purchased from Promega, catalog number M1701), and 2 μl of 0.1M DTT.

[0112] (4) Mix the above reaction solution well and react at 37°C for 30 min;

[0113] (5) After the reaction is complete, treat at 70℃ for 10 min to inactivate reverse transcriptase activity; the first strand of cDNA synthesized in the reaction can be used as a PCR reaction template.

[0114] 3) Constructing recombinant expression vectors

[0115] For the CDS sequence (SEQ ID NO: 1) of the GmSST1 gene that needs to be downregulated or silenced, a 24 bp complementary sequence R was designed based on sequence specificity. A synthetic sequence was designed, linking sequence R to the STTM backbone sequence, and vector homologous arm sequences were added to both ends: 5'-upstream homologous arm sequence-Sequence R-48nt-Sequence R-downstream homologous arm sequence-3' (GmSST1-STTM 48) or 5'-upstream homologous arm sequence-Sequence R-88nt-Sequence R-downstream homologous arm sequence-3' (GmSST1-STTM 88). This sequence can be directly synthesized as a double strand.

[0116] The target sequence is:

[0117] GTCTCAGAAGTTTTACGATGCTTT(SEQ ID No.6)

[0118] The sequence R is:

[0119] AAAGCATCGTAAAACTTCTGAGAC(SEQ ID No.7)

[0120] The synthesized sequence of GmSST1-STTM 48 is as follows:

[0121] AAAGCATCGTAAAACTTCTGAGACGTTGTTGTTGTTATGGTCTAAT TTAAATATGGTCTAAAGAAGAAGAATAAAGCATCGTAAAACTTCTGAG AC (SEQ ID No. 2)

[0122] The synthesized sequence of GmSST1-STTM 88 is as follows:

[0123] AAAGCATCGTAAAACTTCTGAGACGTTGTTGTTGTTATGGTCTAGT TGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGG TCTAAAGAAGAAGAATAAAGCATCGTAAAACTTCTGAGAC(SEQIDNo.3)

[0124] Upstream homologous arm sequence:

[0125] AGCGGCCGAATTCCCCGGG(SEQ ID No.8)

[0126] Downstream homologous arm sequence:

[0127] CGAGATCAGTTATCTAGATCCGGTGGATCC(SEQ ID No.9)

[0128] 4) Homologous recombination ligation of pEGAD expression vector

[0129] a. The pEGAD plasmid was digested with Sma I and BamHI to obtain the linear pEGAD nucleotide sequence. The specific procedure was as follows: Thermo Scientific FastDigest fast digestion enzyme was used for the digestion reaction, and the digestion reaction system is shown in Table 1.

[0130] Table 1. Enzyme digestion system of pEGAD vector

[0131]

[0132]

[0133] Mix the reagents according to the above system and incubate at 37°C for 1 hour for enzyme digestion. Perform electrophoresis on a 1% agarose gel and recover the excised target vector.

[0134] b. Homologous recombination of the synthesized GmSST1-STTM 48 and GmSST1-STTM 88 nucleotide sequences into the pEGAD expression vector was performed. 2.5 μl of 2x SoSoo Mix Plus (purchased from TreliefSoSoo Cloning Kit Ver. 2, catalog number: TSV-S2), 1 μl of linear pEGAD vector, and 1.5 μl of GmSST1-STTM 48 or GmSST1-STTM 88 insert fragment were added to a 5 μl system. The ligation was then completed by temperature control using a PCR instrument at 50℃ for 30 min.

[0135] (2) The ligation product was heat-shocked and transformed into competent Escherichia coli DH5α strain, cultured overnight at 37°C, and positive clones were selected for sequencing; the sequencing results showed that recombinant plasmids GmSST1-STTM 48-pEGAD and GmSST1-STTM 88-pEGAD were obtained.

[0136] 5) Agrobacterium K599-mediated hairy root transformation:

[0137] (1) Transformation of Agrobacterium K599 strain (purchased from Shanghai Weidi Biotechnology Co., Ltd.): Agrobacterium was transformed using the liquid nitrogen freeze-thaw method. The specific operation was as follows:

[0138] a. Take out 200 μl of frozen competent cells, thaw them, add 5 μl (concentration of 200 ng / μl) of plasmid DNA (empty vector plasmid pEGAD and recombinant plasmid GmSST1-STTM 48-pEGAD, respectively), gently tap the tube wall to mix, and place on ice for 25 min;

[0139] b. After placing the tube in liquid nitrogen for 5 minutes, remove it and transfer it to 37°C (5 minutes) to melt it. Then add 800 μl of LB (without resistance) liquid culture medium and shake it at 28°C at a low speed (150 r / min) for 5 hours.

[0140] c. 4000 r / min, 30 s, remove supernatant, add 100 μl LB liquid medium, suspend the bacterial cells and plate (containing 50 mg / ml kanamycin);

[0141] d. Incubate at 28℃ until white transformants emerge, which are then used for the transformation of hairy roots;

[0142] (2) Agrobacterium K599-mediated hairy root transformation

[0143] Using soybean variety W82 as material, the seeds were sterilized with chlorine for 10 hours and then germinated for 5 days on B5 medium (medium formula: 2% sucrose, 0.8g agar powder (Sigma), 1×GAMBORG B-5BASAL (Phyto Technology Laboratories, catalog number: G398), pH adjusted to 5.7). When the cotyledons were just about to open, the cotyledons were cut off at the lower end in a cross shape and immersed in activated Agrobacterium K599 for 30 minutes (OD). 600 =0.6) After that, the explants were transferred to 1 / 2 MS medium (medium formula: 2% sucrose, 0.8 agar powder (sigma), 0.5× MURA SHIGE & SKOOG BASAL MEDIOM w / VITAMINS (Phyto Technology Laboratories, catalog number: G519), and the pH was adjusted to 5.7; after co-culture for 3 days, they were transferred to 1 / 2 MS medium to induce hairy roots. After 7 days, hairy roots grew. When the soybean true leaves grew and the hairy roots reached 7-8 cm, the hairy root composite seedlings with similar developmental stages were selected and transplanted into vermiculite. After 7 days of culture, they were treated with 0 mM and 120 mM NaCl solutions. After 7 days of culture, the fresh weight of the leaves and the plant height were recorded.

[0144] 6) Real-time quantitative PCR detection:

[0145] (1) Reagent Vazym, item number Q111-02, ¥440; Instrument Bio-Rad CFX96 / 384, approximately ¥200,000.

[0146] (2) Reaction design: Each sample should contain two amplification categories: internal reference gene and target gene. Each category should have at least three replicate wells. Design the sample layout of the reaction plate according to the experimental needs and plan the use of the plate. Use at least 2 / 3 of the plate wells in each experiment. If the number of samples is small, an eight-tube array (MicroAmp Part No 4316567) can be used.

[0147] (3) Preparation of the reaction system:

[0148]

[0149] (4) Perform real-time quantitative PCR:

[0150]

[0151] Results Observation

[0152] The results are as follows Figures 1-2 As shown in Tables 2 and 3.

[0153] Table 2. Statistical results of plant height in each treatment group (unit: cm)

[0154]

[0155] Table 3. Statistical results of leaf fresh weight for each treatment group (unit: g)

[0156]

[0157]

[0158] like Figure 1 As shown, under 0 mM NaCl solution treatment, the transgenic plants with downregulated GmSST1 expression showed significantly increased leaf fresh weight and plant height compared to the transgenic plants transformed with empty vector (EV). Under 120 mM NaCl solution treatment, the transgenic plants with downregulated GmSST1 expression also showed significantly increased leaf fresh weight and plant height compared to EV. Furthermore, there was no significant difference in plant height and leaf fresh weight between the transgenic plants with downregulated GmSST1 expression before and after treatment, but there was a significant difference in plant height and leaf fresh weight between the EV and GmSST1. Figure 1 (ad in the text)

[0159] Figure 2 To analyze the expression level of GmSST1 in transgenic roots, the results showed that the expression of GmSST1 was significantly downregulated in transgenic roots.

[0160] As can be seen from the above embodiments, the recombinant vector for downregulating or silencing the GmSST1 gene and the recombinant strain provided by the present invention, when used to infect plants, can achieve downregulation or silencing of the GmSST1 gene in plants, improve the salt tolerance of plants, increase plant height and fresh leaf weight; and have great significance for improving plant yield.

Claims

1. GmSST1 The application of genes in the breeding of salt-tolerant soybeans is characterized by, Downregulation of expression in soybeans GmSST1 Genes, the ones mentioned GmSST1 The gene is derived from soybean, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. GmSST1 The application of genes in improving soybean plant height and fresh weight is characterized by, Downregulation of expression in plants GmSST1 Genes, the ones mentioned GmSST1 The gene is derived from soybean, and its nucleotide sequence is shown in SEQ ID NO:

1.

3. A method for cultivating salt-tolerant soybeans, characterized in that, Includes the following steps: 1) Explants were obtained by infecting soybean cotyledons with recombinant bacterial strains; 2) After culturing the explants in a culture medium for 2-4 days, transfer them to a new culture medium to induce hairy roots; 3) When the hairy roots reach 7-8 cm in length and true leaves emerge, transplant the hairy root composite seedlings into the substrate for cultivation to obtain salt-tolerant soybeans. The recombinant strain was transformed into a recombinant vector in the original strain, the recombinant vector comprising an initial vector and a downregulated expression vector. GmSST1 A DNA fragment of a gene; the nucleotide sequence of said DNA fragment is as shown in SEQ ID NO: 2 or SEQ ID NO: 3; GmSST1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. The method according to claim 3, characterized in that, The initial vector includes a pEGAD expression vector, and the downregulated expression... GmSST1 The DNA fragment of the gene is ligated between the Sma I and BamHI restriction sites of the initial vector.

5. The method according to claim 3, characterized in that, The original strain was Agrobacterium plantarum.

6. The method according to claim 3, characterized in that, The infection time described in step 1) is 20-50 minutes; the OD of the recombinant strain's bacterial culture... 600 The value is 0.5~0.8.

Images