Application of osrl4 protein in regulating rice root development

Abstract

The application discloses application of an OsRL4 protein in regulating rice root development. An amino acid sequence of the OsRL4 protein is shown in SEQ ID NO:1. Experiments prove that, when the OsRL4 gene is overexpressed in Nipponbare, root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length and meristem cell number are all significantly reduced; when the expression of the OsRL4 gene is inhibited in Nipponbare, root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length and meristem cell number are all significantly increased. Therefore, the OsRL4 protein negatively regulates rice root development. The OsRL4 gene can improve root system traits of rice varieties, and has important significance for cultivating new drought-tolerant rice varieties. The application has important application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of OsRL4 protein in regulating rice root development. Background Technology

[0002] Rice is one of the world's most important food crops, belonging to the dicotyledonous genus Oryza, also known as paddy rice. It is the oldest food crop in the Oryza genus and one of the most important food sources in my country and the world. Water is essential for life, and water resources are crucial for crop growth and yield. However, with global warming and rapid population growth, the problem of global water scarcity is becoming increasingly serious, and drought caused by water shortages severely impacts global food production. Drought frequently occurs in my country's food production. Compared to other crops, rice has a shallow root system, making its yield more susceptible to drought stress. Furthermore, most rice cultivation currently relies on irrigation, which consumes a large amount of water. Even in the relatively water-rich southern regions, phenomena such as "summer drought" and "autumn drought" occur.

[0003] A robust root system is crucial for higher plants to fully absorb water and nutrients from the soil and to perceive the soil environment. Long roots facilitate the absorption of water and nutrients from deeper soil layers, enhancing the crop's survival ability in arid environments. Therefore, given the increasing severity of water scarcity and drought, researching genes related to root development, improving rice root systems, enhancing rice's drought resistance and tolerance, and cultivating water-saving and drought-resistant varieties are of paramount practical significance for the sustainable development of rice cultivation and food security.

[0004] Developing drought-resistant rice varieties with well-developed root systems using traditional breeding methods is a long process, highly unpredictable, and results in unstable varieties with slow progress. In contrast, genetic engineering technology can directly modify the genetic background of plants at the gene level, allowing for targeted modification of their genetic traits. The introduction of exogenous genes enriches genetic resources, compensates for the shortcomings of conventional breeding methods, and is one of the effective approaches to selecting drought-resistant varieties. Summary of the Invention

[0005] The purpose of this invention is to regulate plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and / or meristem cell number.

[0006] This invention first protects the application of the OsRL4 protein, which may be a1) or a2):

[0007] a1) Regulate at least one of the following plant parameters: root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number;

[0008] a2) Develop transgenic plants with alterations in at least one of the following: root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

[0009] This invention also protects the application of nucleic acid molecules encoding the OsRL4 protein, which may be a1) or a2):

[0010] a1) Regulate at least one of the following plant parameters: root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number;

[0011] a2) Develop transgenic plants with alterations in at least one of the following: root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

[0012] In the above applications, the nucleic acid molecule may be a DNA molecule as shown in c1), c2), c3), or c4):

[0013] c1) The coding region is the DNA molecule shown in SEQ ID NO:2;

[0014] c2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO:2;

[0015] c3) has 75% or more homology with the nucleotide sequence defined by c1) or c2) and is derived from a rice DNA molecule that encodes the OsRL4 protein.

[0016] c4) hybridizes under strict conditions with a nucleotide sequence defined by c1) or c2) to a DNA molecule derived from rice that encodes the OsRL4 protein.

[0017] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0018] SEQ ID NO:2 consists of 1122 nucleotides, and the nucleotides of SEQ ID NO:2 encode the amino acid sequence shown in SEQ ID NO:1.

[0019] Those skilled in the art can readily mutate the nucleotide sequence encoding the OsRL4 protein of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the OsRL4 protein of this invention, as long as they encode the OsRL4 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0020] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the OsRL4 protein shown in SEQ ID NO:1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0021] In any of the above-described applications, the regulation of at least one of the following plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number can be either decreasing at least one of the following plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number, or increasing at least one of the following plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

[0022] In any of the above-described applications, the transgenic plant with altered root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number can be a transgenic plant with reduced root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number, or a transgenic plant with increased root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

[0023] The present invention also protects a method for cultivating transgenic plants, comprising the following steps: increasing the expression level and / or activity of OsRL4 protein in a recipient plant to obtain a transgenic plant; compared with the recipient plant, the transgenic plant has reduced root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length and / or meristem cell number.

[0024] In the above method, the expression level and / or activity of OsRL4 protein in the recipient plant can be increased by methods well known in the art, such as transgenics, multiple copies, alteration of promoters, and regulatory factors, to achieve the effect of increasing the expression level and / or activity of OsRL4 protein in the recipient plant.

[0025] In the above method, the increase in the expression level and / or activity of OsRL4 protein in the recipient plant is achieved by introducing a nucleic acid molecule encoding OsRL4 protein into the recipient plant.

[0026] In the above method, the nucleic acid molecule can be a DNA molecule as shown in c1), c2), c3), or c4):

[0027] c1) The coding region is the DNA molecule shown in SEQ ID NO:2;

[0028] c2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO:2;

[0029] c3) has 75% or more homology with the nucleotide sequence defined by c1) or c2) and is derived from a rice DNA molecule that encodes the OsRL4 protein.

[0030] c4) hybridizes under strict conditions with a nucleotide sequence defined by c1) or c2) to a DNA molecule derived from rice that encodes the OsRL4 protein.

[0031] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0032] SEQ ID NO:2 consists of 1122 nucleotides, and the nucleotides of SEQ ID NO:2 encode the amino acid sequence shown in SEQ ID NO:1.

[0033] The introduction of nucleic acid molecules encoding the OsRL4 protein into the recipient plant can be achieved by introducing a recombinant vector containing any of the aforementioned nucleic acid molecules into the recipient plant.

[0034] The recombinant vector containing any of the above-mentioned nucleic acid molecules can be a recombinant plasmid obtained by inserting the DNA molecule shown in SEQ ID NO: 2 into the multiple cloning site of the expression vector.

[0035] The recombinant vector containing any of the aforementioned nucleic acid molecules can specifically be the recombinant vector ubi::OsRL4. The recombinant vector ubi::OsRL4 can be a recombinant plasmid obtained by replacing the small DNA fragment between the restriction endonucleases SpeI and KpnI of the vector pCM1307-3FLAG with the DNA molecule shown in SEQ ID NO:2.

[0036] The present invention also protects a method for cultivating transgenic plants, comprising the following steps: inhibiting the expression level and / or activity of OsRL4 protein in a recipient plant to obtain a transgenic plant; compared with the recipient plant, the transgenic plant has increased root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length and / or meristem cell number.

[0037] In the above method, the expression level and / or activity of OsRL4 protein in the recipient plant can be inhibited by methods well known in the art, such as RNA interference, homologous recombination, and site-directed gene editing, to achieve the purpose of inhibiting the expression level or activity of OsRL4 protein.

[0038] In the above method, the inhibition of the expression level and / or activity of OsRL4 protein in the recipient plant is achieved by introducing a substance into the recipient plant that inhibits the expression level and / or activity of OsRL4 protein in the recipient plant.

[0039] In the above method, the substance that inhibits the expression level and / or activity of OsRL4 protein in the recipient plant can be the recombinant plasmid OsRL4-CR; the recombinant plasmid OsRL4-CR is obtained by inserting the DNA double-stranded molecule shown in SEQ ID No: 3 into the recognition site of the restriction endonuclease BsaI of the vector pHUE411.

[0040] The OsRL4 protein described above may be b1), b2), b3), or b4):

[0041] b1) The amino acid sequence is that of the protein shown in SEQ ID NO:1;

[0042] b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:1;

[0043] b3) Proteins derived from rice and related to plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length and / or meristem cell number, obtained by substituting and / or deleting and / or adding one or more amino acid residues as shown in b1) or b2).

[0044] b4) A protein that has 80% or more homology with the amino acid sequence defined by SEQ ID NO:1, is derived from rice, and is associated with plant root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and / or meristem cell number.

[0045] To facilitate the purification of the protein in b1), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein shown in SEQ ID NO:1.

[0046] Table 1. Sequence of Labels

[0047] Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tagII 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0048] The protein in b3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0049] The proteins mentioned in b3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0050] The gene encoding the protein in b3) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO:2, and / or by performing a missense mutation on one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0051] The plant mentioned above may be any one of the following d1) to d6): d1) dicotyledonous plant; d2) monocotyledonous plant; d3) grass; d4) rice; d5) rice variety Nipponbare; d6) rice variety IRAT109.

[0052] Experiments have shown that, compared with Nipponbare, homozygous OsRL4 mutants (such as KO-1, KO-2, and KO-3) exhibited significantly increased root tip meristem length and meristem cell number, while transgenic OsRL4 rice (such as OE-1, OE-2, and OE-3) showed significantly decreased root tip meristem length and meristem cell number. Overexpression of the OsRL4 gene in Nipponbare significantly reduced root length, lateral root density, lateral root length, root volume, and root dry weight. Inhibition of OsRL4 gene expression in Nipponbare significantly increased root length, lateral root density, lateral root length, root volume, and root dry weight. Therefore, the OsRL4 protein negatively regulates rice root development. The OsRL4 gene can improve root traits in rice varieties, which is of great significance for breeding new drought-resistant rice varieties. This invention has significant application value. Attached Figure Description

[0053] Figure 1 Association analysis of candidate genes for qMRL4-2 was performed.

[0054] Figure 2 To enable real-time quantitative PCR detection of the relative expression level of the OsRL4 gene in T3 generation homozygous transgenic OsRL4 rice.

[0055] Figure 3 Statistics on mutation types of Cas9 target sequences for KO-1, KO-2, and KO-3.

[0056] Figure 4 The results show the root system and root length statistics of transgenic OsRL4 rice and OsRL4 homozygous mutants.

[0057] Figure 5 The statistical results are for the lateral root density, lateral root length, crown root number, root volume, and root dry weight of transgenic OsRL4 rice and OsRL4 homozygous mutants.

[0058] Figure 6 Histological analysis of root tips from transgenic OsRL4 rice and OsRL4 homozygous mutants. Detailed Implementation

[0059] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0061] YEP liquid medium: Dissolve 10g of yeast extract, 5g of NaCl and 10g of tryptone in distilled water, then bring the volume to 1L with distilled water and autoclave at 121℃ for 15min.

[0062] YEP solid medium: Dissolve 10g yeast extract, 5g NaCl and 10g tryptone in distilled water, then bring the volume to 1L with distilled water, and finally add 15g agar powder. Autoclave at 121℃ for 15min.

[0063] AAM liquid culture medium: Dissolve 50 ml of AAM (20×), 5 ml of MS (200×), 10 ml of AAM organic (100×), 10 ml of iron salt (100×), 500 mg of hydrolyzed casein, 68.5 g of sucrose, 36 g of glucose, 75 mg of glycine, 877 mg of glutamine, 266 mg of aspartic acid, and 228 mg of arginine in an appropriate amount of deionized water, then bring the volume to 1 L with deionized water, adjust the pH to 5.5, and autoclave at 115℃ for 15 min; finally, add 1 ml of 20 mg / ml acetylsuccione solution and mix well.

[0064] AAM (20×): Dissolve 6.645g CaCl2, 58.8g KCl, 3.4g KH2PO4 and 7.4g MgSO4·7H2O in an appropriate amount of distilled water, and then make up to 1L with distilled water.

[0065] MS micro-scale (200×): Dissolve 166 mg KI, 3.38 g MnSO4·H2O, 1.24 g H3BO3, 50 mg Na2MoO4·2H2O, 1.72 g ZnSO4·7H2O, 5 g CoCl2·6H2O and 5 g CuSO4·5H2O in an appropriate amount of distilled water, and then make up to 1 L with distilled water.

[0066] AAM Organic (100×): Dissolve 50mg of vitamin B1, 50mg of vitamin B5 and 10mg of vitamin B6 in an appropriate amount of distilled water, and then bring the volume up to 1L with distilled water.

[0067] Iron salt (100×): Dissolve 3.73g Na2EDTA.2H2O and 2.78g FeSO4.7H2O in an appropriate amount of distilled water, and then make up to 1L with distilled water.

[0068] NB solid culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, and 3 g of plant gel in 1 L of distilled water, then adjust the pH to 5.8 and autoclave for 20 min.

[0069] Co-culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.4, sterilize at 121℃ for 15 min, and when cooled to 50-60℃, add 10 g of glucose and 20 mg of acetylsuccinone that have been filtered and sterilized with 0.22 μM.

[0070] Delayed screening medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 500 mg of cephalosporin that has been filtered and sterilized with 0.22 μM solution when the medium has cooled to 50–60 °C.

[0071] First round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 500 mg of cephalosporin and 50 mg of hygromycin after filtration sterilization at 0.22 μM when the temperature has cooled to 50-60℃.

[0072] Second round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM when the temperature has cooled to 50-60℃.

[0073] Predifferentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 1 mg of 6-BA, 2 mg of NAA and 5 mg of ABA in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM solution when cooled to 50-60℃.

[0074] Differentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 2 mg of 6-BA, 1 mg of NAA, and 1 mg of KT in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM solution when cooled to 50–60 °C.

[0075] Seedling growth medium: Dissolve 25 mL of 20×MS large volume stock solution, 2.5 mL of 200×MS micro volume stock solution, 2.5 mL of 200×MS iron salt stock solution, 2.5 mL of 200×MS organic stock solution, 3 g of plant gel, 0.5 mg of NAA and 0.25 mg of paclobutrazol in 1 L of distilled water, adjust the pH to 5.8, and sterilize at 121℃ for 15 min.

[0076] The solutes and their concentrations in the 20×MS mother liquor were 38.00 g / L KNO3, 8.80 g / L CaCl2·2H2O, 7.40 g / L MgSO4·7H2O, 3.40 g / L KH2PO4, and 33.00 g / L NH4NO3. The solvent was water, and the pH was natural.

[0077] The solutes and their concentrations in the 200×MS trace mother liquor were 4.46 g / L MnSO4·4H2O, 0.166 g / L KI, 1.24 g / L H3BO3, 1.72 g / L ZnSO4·7H2O, 0.050 g / L Na2MoO4·2H2O, 0.005 g / L CuSO4·5H2O, and 0.005 g / L CoCl2·6H2O. The solvent was water, and the pH was natural.

[0078] The solutes and their concentrations in the 200×MS iron salt mother liquor were 5.56 g / L FeSO4·7H2O and 7.46 g / L Na2·EDTA·2H2O, with water as the solvent and natural pH.

[0079] The solutes and their concentrations in the 200×MS organic mother liquor were 20 g / L inositol, 100 mg / L nicotinic acid, 100 mg / L pyridoxine hydrochloride, 100 mg / L thiamine hydrochloride, and 400 mg / L glycine. The solvent was water, and the pH was natural.

[0080] The solutes and their concentrations in the large volume of 50×N6 mother liquor were 141.50 g / L KNO3, 20 g / L KH2PO4, 23.15 g / L (NH4)2SO4, 9.25 g / L MgSO4·7H2O and 8.30 g / L CaCl2·2H2O, with water as the solvent and natural pH.

[0081] The solutes and their concentrations in the 100×B5 trace mother liquor were 0.3 g / L H3BO3, 1 g / L MnSO4·4H2O, 0.0025 g / L CoCl2·6H2O, 0.0025 g / L CuSO4·5H2O, 0.2 g / L ZnSO4·7H2O, 0.025 g / L Na2MoO4·2H2O, and 0.075 g / L KI. The solvent was water, and the pH was natural.

[0082] The solutes and their concentrations in the 1000×B5 organic mother liquor were 2 g / L glycine, 100 g / L inositol, 1 g / L nicotinic acid, 1 g / L pyridoxine hydrochloride, and 10 g / L thiamine hydrochloride. The solvent was water, and the pH was natural.

[0083] The rice variety Nipponbare is referred to as wild-type rice or WT in the following text.

[0084] Alternating light and dark culture, with the following conditions: 28℃; 14 hours of light culture / 10 hours of dark culture; light intensity during light culture: 90 μE / m². 2 / s.

[0085] Example 1: Obtaining the OsRL4 gene

[0086] The inventors of this invention used an MLM model to perform genome-wide association analysis on root length traits in 795 cultivated rice germplasms, obtaining a new QTL locus associated with root length, qMRL4-2 (YZhao, H Zhang, J Xu, C Jiang, ZLi, et al. (2018) Loci and natural alleles underlying robust roots and adaptive domestication of upland ecotype rice in aerobic conditions. PLoS Genet 14(8): e1007521.). Further, candidate gene association analysis was performed on qMRL4-2, and its highest signal point was located at the promoter of the OsRL4 gene (LOC_Os04g50770), as shown below. Figure 1 As shown (rectangles represent annotated genes, light blue represents non-candidate genes, and red represents candidate genes).

[0087] The OsRL4 gene, derived from the rice variety IRAT109, was finally obtained through screening. The full-length cDNA sequence of the OsRL4 gene is 1122 bp, and its nucleotide sequence is shown in SEQ ID NO:2. The OsRL4 gene encodes the OsRL4 protein, and the amino acid sequence of the OsRL4 protein is shown in SEQ ID NO:1.

[0088] Example 2: Application of OsRL4 protein in regulating rice root development

[0089] I. Obtaining and Identifying OsRL4 Gene-Transgenic Rice

[0090] 1. Construction of recombinant vector ubi::OsRL4 and obtaining recombinant Agrobacterium EHA105 / ubi::OsRL4

[0091] (1) Using the cDNA of rice variety IRAT109 as a template, the following formula was used: F-HA-F: 5'-ATCGATACCGTCGACGAGCTCTCTAGA ACTAGT ATGGGGAAGGGCCGGGCACC-3' (underlined is the recognition site of the restriction endonuclease SpeI) and F-HA-R: 5'-AGACTGGTGATTTTTGCGGAGTACCCG GGTACC The primer pair consisting of TTACACGTAGTAATCCATGG-3' (underlined is the recognition site of restriction endonuclease KpnI) was used for PCR amplification, and a PCR amplification product of about 1188 bp was obtained.

[0092] (2) The PCR amplification product obtained in step (1) was sequenced. The results showed that the PCR amplification product contained the DNA fragment shown in SEQ ID NO:2.

[0093] (3) The PCR amplification product obtained in step (1) and the vector pCM1307-3FLAG (described in the following literature: Rice SPL10 positively regulates trichome development through expression of HL6 and auxin-related genes[J]. Journal of Integrative Plant Biology, 2021., named pCM1307-3FLAG vector in the literature) were homologously recombinated to obtain the recombinant vector ubi::OsRL4.

[0094] The recombinant vector ubi::OsRL4 was sequenced. Sequencing results showed that the recombinant vector ubi::OsRL4 was obtained by replacing a small DNA fragment between the restriction endonucleases SpeI and KpnI in the vector pCM1307-3FLAG with the DNA molecule shown in SEQ ID NO:2.

[0095] In the recombinant vector ubi::OsRL4, the OsRL4 gene is inserted downstream of the maize ubiquitin promoter. The recombinant vector ubi::OsRL4 expresses the OsRL4 protein shown in SEQ ID NO:1.

[0096] (4) The recombinant vector ubi::OsRL4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which was named EHA105 / ubi::OsRL4.

[0097] 2. Obtaining T3 generation homozygous transgenic OsRL4 rice

[0098] The method described in the reference (Mei-Rong, XU, Xia, ZH, Zhai, WX, Jian-Long, XU, Zhou, YL, & Zhi-Kang, LI (2008). Construction of double right-border binary vector carrying non-host gene rxo1 resistant to bacterial leafstreak of rice. Rice Science, 15(3), 243-246.) was used to transform EHA105 / ubi::OsRL4 into Nipponbare rice, and then T3 generation homozygous transgenic OsRL4 rice was obtained through self-pollination. The specific steps are as follows:

[0099] (1) Acquisition of callus

[0100] Mature Nipponbare seeds were shelled, sterilized with alcohol, then with sodium hypochlorite, rinsed once with sterile water, and air-dried for 3 hours to obtain sterile Nipponbare seeds. These sterile Nipponbare seeds were inoculated onto NB solid medium and cultured in the dark at 28°C for 2 weeks to obtain embryogenic callus. The embryogenic callus was subcultured twice to obtain callus tissue. Each culture method involved inoculating the embryogenic callus onto fresh NB solid medium and cultured in the dark at 28°C for 2 weeks.

[0101] (2) Preparation of the infiltration solution

[0102] EHA105 / ubi::OsRL4 was spread on YEP solid medium containing kanamycin and rifampin and incubated in the dark at 28°C for 2 days; then Agrobacterium was scraped onto AAM liquid medium to obtain OD. 600nm The infection solution is approximately 0.3.

[0103] (3) Co-cultivation

[0104] Select naturally dispersed, bright yellow granular callus tissue with a diameter of about 3-5 mm from the callus tissue obtained in step (1) and place it in an Erlenmeyer flask. Then add the infection solution prepared in step (2) and let it stand for 10 min for infection. After that, use sterile filter paper to absorb the excess infection solution and place the callus tissue on a co-culture medium covered with a layer of filter paper. Co-culture at 20℃ for 2-3 days.

[0105] (4) Screening of resistant callus

[0106] ① Take the callus tissue after completing step (3), first wash it with sterile water by shaking 5-6 times, then wash it with sterile water containing cephalosporin and carbenicillin for 20 minutes, then place it on sterile filter paper to drain for 3 hours, and finally transfer it to delayed selection medium and incubate it in the dark at 28°C for 1 week.

[0107] ②After completing step ①, transfer the callus tissue to the first round of screening medium and incubate in the dark at 28°C for 2 weeks.

[0108] ③ After completing step ②, the callus tissue was transferred to the second round of screening medium and cultured in the dark at 28°C for 2 weeks to obtain resistant callus tissue.

[0109] (5) Differentiation

[0110] ① Transfer the resistant callus obtained from step (4) to a predifferentiation medium and incubate in the dark at 28°C for 2 weeks.

[0111] ②After completing step ①, the resistant callus tissue is transferred to the differentiation medium and cultured under alternating light for 2-3 weeks to obtain transgenic seedlings.

[0112] (6) Strong seedlings

[0113] The transgenic seedlings obtained in step (5) were transferred to a seedling culture medium. After the seedlings took root, they were removed from the culture bottle, the culture medium on the roots was washed off, and the seedlings were hardened off for 1-2 weeks before being transplanted to the field for planting until maturity, thus obtaining T0 generation rice transgenic with the OsRL4 gene.

[0114] (7) Select positive seedlings of the T0 generation of rice to be transgenic into the OsRL4 gene obtained in step (6), and then perform self-pollination to obtain the T1 generation of rice transgenic into the OsRL4 gene.

[0115] (8) Select positive seedlings of the T1 generation transgenic OsRL4 rice obtained in step (7), and then perform self-pollination to obtain the T2 generation transgenic OsRL4 rice.

[0116] (9) Select positive seedlings of the T2 generation transgenic OsRL4 rice obtained in step (8), and then perform self-pollination to obtain T3 generation homozygous transgenic OsRL4 rice.

[0117] The above method for screening positive seedlings is as follows: Genomic DNA of rice seedlings is extracted and used as a template. PCR amplification is performed using primer pairs consisting of hyg(280)-F: 5'-ACGGTGTCGTCCATCACAGTTTGCC-'3 and hyg(280)-R: 5'-TTCCGGAAGTGCTTGACATTGGGGA-'3 to obtain PCR amplification products. Then, the following judgment is made: If a PCR amplification product contains a DNA fragment of approximately 280 bp, the rice seedling corresponding to that PCR amplification product is a positive seedling.

[0118] 3. Real-time quantitative PCR detection of the relative expression level of the OsRL4 gene in T3 generation homozygous transgenic OsRL4 rice.

[0119] (1) The seedlings of each T3 generation homozygous transgenic OsRL4 rice that had grown to 10 days were placed in liquid nitrogen for preservation to obtain the corresponding test samples. Nipponbare seeds were taken and cultured at 28℃ with alternating light and dark conditions for 10 days to obtain the rice seedlings to be tested; the rice seedlings to be tested were placed in liquid nitrogen for preservation to obtain the corresponding test samples.

[0120] (2) Total RNA was extracted from the sample to be tested using the Trizo1 method, and then the first-strand cDNA was reverse transcribed using a reverse transcription kit (TransGen). The cDNA was diluted 50 times with sterile water as a template, and the relative expression level of the OsRL4 gene was detected by real-time quantitative PCR (Ubq gene Os03g0234200 was used as an internal reference gene).

[0121] The primers for detecting the OsRL4 gene are 5'-TTCTCGGCAACAAGTGGTC-3' and 5'-TGCGTGTTCCAGACGTTCT-3'.

[0122] The primers for detecting the Ubq gene are 5'-AACCAGCTGAGGCCCAAGA-3' and 5'-ACGATTGATTTAACCAGTCCATGA-3'.

[0123] Some test results can be found Figure 2 The results showed that, compared with Nipponbare, the relative expression level of the OsRL4 gene was significantly increased in all T3 generation homozygous transgenic OsRL4 rice lines. Three of these T3 generation homozygous transgenic OsRL4 rice lines were named OsRL4-OE1 (abbreviated as OE-1), OsRL4-OE2 (abbreviated as OE-2), and OsRL4-OE3 (abbreviated as OE-3), respectively.

[0124] II. Obtaining and Identifying Homozygous OsRL4 Mutants

[0125] In this embodiment, target sites T1 and T2 were selected for experiments. The sequence of target site T1 is: 5'-GTGGCCGTACTTCTGAATGT-3' (i.e., positions 89-108 from the 5' end of SEQ ID No: 2). The sequence of target site T2 is: 5'-TGCCCGAAATCGTGGACCTC-3' (i.e., positions 722-741 from the 5' end of SEQ ID No: 2). The target gene corresponding to targets T1 and T2 is the OsRL4 gene.

[0126] 1. Obtaining the recombinant plasmid OsRL4-CR

[0127] (1) Using the intermediate vector pCBC-MT1T2 (described in the following literature: Xing, HL, Dong, Wang, ZP, Zhang, HY, Han, CY, Liu. ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMCPLANT BIOL, 2014) as a template, PCR amplification was performed using a primer combination consisting of primers FT1-BsF: 5'-ATATATGGTCTCTGGCGGTGGCCGTACTTCTGAATGTGTT-3', primers FT1-F0: 5'-CGGTGGCCGTACTTCTGAATGTGTTTTAGAGCTAGAAATAGC-3', primers FT2-R0: 5'-AACGAGGTCCACGATTTCGGGCACGCTTCTTGGTGCC-3' and primers FT2-BsR: 5'-ATTATTGGTCTCTAAACGAGGTCCACGATTTCGGGCAC-3'. Approximately 964 bp of PCR amplification product was recovered.

[0128] In the PCR amplification system, the concentrations of primers FT1-BsF and FT2-BsR were 10 μM, and the concentrations of primers FT1-F0 and FT2-R0 were 0.5 μM.

[0129] (2) Construction of the enzyme digestion-ligation system. The enzyme digestion-ligation system consisted of 15 μL of PCR amplification product recovered in step (1), 2 μL of vector pHUE411 (described in the following literature: Xing, HL, Dong, Wang, ZP, Zhang, HY, Han, CY, Liu. Acrispr / cas9 toolkit for multiplex genome editing in plants. BMC PLANT BIOL, 2014), 1.5 μL of 10×NEB T4 Buffer (a component of T4 Ligase), 1.5 μL of T4 Ligase (NEB), 1 μL of restriction endonuclease BsaI (NEB), 1 μL of 10×Cutsmart buffer (a component of restriction endonuclease BsaI), and water.

[0130] (3) Take the enzyme digestion-ligation system constructed in step (2), react, and obtain the recombinant plasmid OsRL4-CR.

[0131] Reaction conditions: 37℃ for 5 hours; 50℃ for 5 minutes; 80℃ for 10 minutes.

[0132] (4) The recombinant plasmid OsRL4-CR was sequenced. The sequencing results showed that the recombinant plasmid OsRL4-CR was obtained by inserting the DNA double-stranded molecule shown in SEQ ID No: 3 into the recognition site of the restriction endonuclease BsaI of the vector pHUE411.

[0133] 2. Obtaining the OsRL4 homozygous mutant

[0134] Because rice is a diploid plant, when Cas9 begins to edit specific genes, both alleles on the two homologous chromosomes within the same cell can be edited, producing the same or different types of mutations. Therefore, two alleles in a plant are considered two gene editing events. A homozygous mutant is one where the OsRL4 gene on both homologous chromosomes of the plant has the same mutation. A biallelic mutant is one where the OsRL4 gene on both homologous chromosomes of the plant has been mutated, but in different forms. A heterozygous mutant is one where the OsRL4 gene on one of the two homologous chromosomes of the plant has been mutated, while the OsRL4 gene on the other homologous chromosome has not been mutated. A wild-type is one where the OsRL4 gene on neither of the two homologous chromosomes of the plant has been mutated.

[0135] (1) The recombinant plasmid OsRL4-CR was transferred to Agrobacterium tumefaciens EHA105 by liquid nitrogen freezing to obtain recombinant Agrobacterium, which was named EHA105 / OsRL4-CR.

[0136] (2) The method in the reference (Mei-Rong, XU, Xia, ZH, Zhai, WX, Jian-Long, XU, Zhou, YL, & Zhi-Kang, LI (2008). Construction of double right-border binary vector carrying non-host gene rxo1 resistant to bacterial leafstreak of rice. Rice Science, 15(3), 243-246.) was used to transform EHA105 / OsRL4-CR into Nipponbare rice. After screening, differentiation and rooting, T0 generation OsRL4 gene knockout rice was obtained.

[0137] (3) Using genomic DNA from T0 generation OsRL4 gene knockout rice leaves as templates, PCR amplification was performed using primer pairs consisting of primers T1F: 5'-AGTTACGTGCAAAGTAGGCGTT-3' and primer T1R: 5'-TACGTACTTGTTGCCGAGAAGG-3', yielding the corresponding PCR amplification products. The PCR amplification products were then subjected to Sanger sequencing. The sequencing results were compared with the Cas9 target sequence of the OsRL4 gene (SEQ ID No: 2) to identify mutation types. Several heterozygous mutant strains were obtained.

[0138] (4) Self-pollinate the heterozygous mutant obtained in step (3) to obtain the seeds, which are the T1 generation seeds. The plants grown from the T1 generation seeds are the T1 generation plants. Self-pollinate the T1 generation plants to obtain the seeds, which are the T2 generation seeds. The plants grown from the T2 generation seeds are the T2 generation plants.

[0139] (5) Using genomic DNA from leaves of T2 generation plants as templates, PCR amplification was performed using primer pairs consisting of primers T1F: 5'-AGTTACGTGCAAAGTAGGCGTT-3' and T1R: 5'-TACGTACTTGTTGCCGAGAAGG-3', yielding the corresponding PCR amplification products. The PCR amplification products were then subjected to Sanger sequencing. The sequencing results were compared with the Cas9 target sequence of the OsRL4 gene (SEQ ID No: 2) to identify mutation types.

[0140] Test results are shown Figure 3 Three homozygous mutant strains of OsRL4 were obtained and named OsRL4-KO1 (KO-1), OsRL4-KO2 (KO-2), and OsRL4-KO3 (KO-3), respectively.

[0141] The OsRL4 gene on both homologous chromosomes of KO-1 has the same mutation, specifically the deletion of one "A" nucleotide in the OsRL4 gene on both homologous chromosomes (i.e., deletion at position 91 from the 5' end of SEQ ID No: 2), which causes a frameshift and results in the loss of function of the protein OsRL4.

[0142] The OsRL4 gene on both homologous chromosomes of KO-2 has the same mutation, specifically, the insertion of a "C" nucleotide in the OsRL4 gene on both homologous chromosomes (i.e., a C is inserted at position 91 to 92 from the 5' end of SEQ ID No: 2), which causes a frameshift, resulting in premature termination of translation of the protein OsRL4 and loss of function.

[0143] The OsRL4 gene on both homologous chromosomes of KO-3 has the same mutation, specifically the deletion of one "T" nucleotide in the OsRL4 gene on both homologous chromosomes (i.e., deletion at position 93 from the 5' end of SEQ ID No: 2), which causes a frameshift and results in the loss of function of the protein OsRL4.

[0144] 3. Real-time quantitative PCR detection of the relative expression level of the OsRL4 gene in homozygous OsRL4 mutants

[0145] (1) Seedlings of KO-1, KO-2 and KO-3 that have grown to 10 days were placed in liquid nitrogen for preservation to obtain the corresponding test samples. Seeds of Nipponbare were taken and cultured at 28℃ with alternating light and dark for 10 days to obtain rice seedlings to be tested; the rice seedlings to be tested were placed in liquid nitrogen for preservation to obtain the corresponding test samples.

[0146] (2) Total RNA was extracted from the sample to be tested using the Trizo1 method, and then the first-strand cDNA was reverse transcribed using a reverse transcription kit. The cDNA was diluted 50 times with sterile water as a template, and the relative expression level of the OsRL4 gene was detected by real-time quantitative PCR (Ubq gene Os03g0234200 was used as an internal reference gene).

[0147] The primers for detecting the OsRL4 gene are 5'-TTCTCGGCAACAAGTGGTC-3' and 5'-TGCGTGTTCCAGACGTTCT-3'.

[0148] The primers for detecting the Ubq gene are 5'-AACCAGCTGAGGCCCAAGA-3' and 5'-ACGATTGATTTAACCAGTCCATGA-3'.

[0149] The results showed that, compared with Nipponbare, the relative expression levels of the OsRL4 gene in KO-1, KO-2 and KO-3 were significantly reduced.

[0150] III. Statistics on root length (i.e., taproot length), lateral root density, lateral root length, crown root number, root volume, and root dry weight of OsRL4 gene-transgenic rice and OsRL4 homozygous mutants

[0151] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows:

[0152] 1. Remove the husks from 20 rice seeds (Nipponbare, KO-1, KO-2, KO-3, OE-1, OE-2 or OE-3), disinfect them with alcohol, then disinfect them with sodium hypochlorite, rinse them once with sterile water, and air dry them for 3 hours to obtain sterile rice seeds for testing.

[0153] 2. Inoculate sterile rice seeds to be tested onto NB solid medium and incubate vertically at 28°C for 5 days.

[0154] 3. During the cultivation process in step 2, measure the root length daily.

[0155] Root systems of some rice seeds tested after 5 days of vertical culture are shown below. Figure 4 The statistical results for root lengths of A and D in the figure are shown in the figure. Figure 4 The statistical results of the daily root length of some rice seeds tested during the cultivation period (B and E) are shown in [the original text]. Figure 4 C and F. The results showed that, compared with Nipponbare, the root length and root elongation rate of OsRL4 transgenic rice (such as OE-1, OE-2, and OE-3) were significantly reduced; compared with Nipponbare, the root length and root elongation rate of OsRL4 homozygous mutants (such as KO-1, KO-2, and KO-3) were significantly increased.

[0156] 4. After completing step 2, test the lateral root density (i.e., the number of lateral roots 2-3 cm below the base of the main root), lateral root length (the average of the three longest lateral roots 2-3 cm below the base of the main root), crown root number, root volume, and root dry weight.

[0157] The lateral root phenotypes of some rice seeds tested after 5 days of vertical culture are shown in the figure. Figure 5 The statistical results for lateral root density, lateral root length, crown root number, root volume, and root dry weight are shown in Figure A. Figure 5 The results showed that, compared with Nipponbare rice, transgenic OsRL4 rice (such as OE-1 and OE-2) had significantly lower lateral root density, lateral root length, root volume, and root dry weight, while OsRL4 homozygous mutants (such as KO-1, KO-2, and KO-3) had significantly higher lateral root density, lateral root length, root volume, and root dry weight.

[0158] Therefore, overexpression of the OsRL4 gene in Nipponbare significantly reduced root length, lateral root density, lateral root length, root volume, and root dry weight; while suppression of OsRL4 gene expression in Nipponbare significantly increased root length, lateral root density, lateral root length, root volume, and root dry weight. The OsRL4 protein negatively regulates rice root development.

[0159] Example 3: Histological analysis of root tips of OsRL4 transgenic rice and OsRL4 homozygous mutants

[0160] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows:

[0161] 1. Remove the husks from 10 rice seeds (Nipponbare, KO-1, KO-2, KO-3, OE-1, OE-2 or OE-3), disinfect them with alcohol, then disinfect them with sodium hypochlorite, rinse them once with sterile water, and air dry them for 3 hours to obtain sterile rice seeds for testing.

[0162] 2. Sterile rice seeds to be tested were inoculated onto NB solid medium and cultured vertically at 28°C for 7 days to obtain rice seedlings to be tested.

[0163] 3. Perform longitudinal paraffin sections of the root tips of the rice seedlings to be tested, and conduct histological observation of the root tip meristem. The section thickness is 2-4 μm, and the sections are stained with 0.25% toluidine blue. Observe the sections under an optical microscope, and count the length of the meristem, the size of the meristem cells, and the number of meristem cells. The number of cells counted for each plant should not be less than 10.

[0164] See results Figure 6 (OsRL4-KO is KO-1, OsRL4-OE is OE-1). The results showed that, compared with Nipponbare, the root tip meristem length and meristem cell number of homozygous OsRL4 mutants (such as KO-1, KO-2, KO-3) were significantly increased, while the root tip meristem length and meristem cell number of transgenic OsRL4 rice (such as OE-1, OE-2, OE-3) were significantly decreased. There were no significant differences in cell size in the meristem and maturation zones among Nipponbare, homozygous OsRL4 mutants, and transgenic OsRL4 rice.

[0165] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. <110> China Agricultural University <120> Application of OsRL4 protein in regulating rice root development <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 373 <212> PRT <213> Artificial sequence <400> 1 Met Gly Lys Gly Arg Ala Pro Cys Cys Ala Lys Val Gly Leu Asn Lys 1 5 10 15 Gly Ser Trp Thr Pro Glu Glu Asp Met Arg Leu Val Ala Tyr Ile Gln 20 25 30 Lys Tyr Gly His Ala Asn Trp Arg Ala Leu Pro Lys Gln Ala Gly Leu 35 40 45 Leu Arg Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg 50 55 60 Pro Asp Leu Lys Arg Gly Asn Phe Thr Ala Glu Glu Glu Glu Thr Ile 65 70 75 80 Ile Lys Leu His Gly Leu Leu Gly Asn Lys Trp Ser Lys Ile Ala Ser 85 90 95 Cys Leu Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Val Trp Asn Thr 100 105 110 His Leu Lys Lys Arg Val Ser Pro Glu Gln Lys Lys Gly Gly Gly Lys 115 120 125 Ser Lys Lys Lys Thr Thr Cys Thr Asp Val Leu Val Pro Ser Pro Ser 130 135 140 Pro Ser Ser Ser Thr Thr Thr Thr Thr Asn Cys Ser Ser Gly Asp Ser 145 150 155 160 Ala Gly Glu Gln Ser Asn Thr Ser Lys Glu Glu Glu Glu Glu Thr Asp 165 170 175 Lys Ile Glu Ile Pro Met Leu Glu Leu Asp Pro Cys Cys Phe Asp Phe 180 185 190 Asp Met Leu Val Asp Pro Val Val Pro Asp Thr Tyr Cys Pro Ala Val 195 200 205 Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Pro Thr Ser Pro Cys Ser 210 215 220 Ser Thr Ser Pro Ser Cys Ala Arg Ala Gly Val Asp Pro Leu Leu Asp 225 230 235 240 Leu Pro Glu Ile Val Asp Leu Gly Pro Glu Leu Trp Ser Ile Met Asp 245 250 255 Gly Gly Ala Gly Asp Gly Cys Thr Glu Ala Pro Pro Pro Ala Trp Ser 260 265 270 Asn Ala Ala Ala Ala Ala Ala Ala Asn Ala Thr Val Ala Thr Thr Thr 275 280 285 Ser Leu Glu Glu Glu Glu Gly Lys Glu Trp Trp Leu Lys Asp Leu Glu 290 295 300 Lys Glu Leu Gly Leu Trp Gly Pro Thr Asp Asp Tyr His Cys His Pro 305 310 315 320 Gly Pro Gln Gly Gln Pro Gly Arg Ala Gly Pro Pro Pro Ser Ala Val 325 330 335 Val Glu Asp Pro Val Ser Cys Tyr Phe Gln Ala Gly Pro Thr Ala Ala 340 345 350 Ala Thr Trp Gln Gly His Glu Pro Ser Ala Val Ile Thr Ser Asn Pro 355 360 365 With Asp Taurus Taurus Val 370 <210> 2 <211> 1122 <212> DNA <213> Artificial sequence <400> 2 atggggaagg gccgggcacc gtgctgcgcc aaggtggggc tgaacaaggg gtcgtggacg 60 ccggaggagg acatgaggct cgtcgcctac attcagaagt acggccacgc caactggcgc 120 gccctgccca agcaagcagg tttgctccgg tgcgggaaga gctgccgact ccggtggatc 180 aactacctcc ggccggacct caagcgcggc aacttcaccg ccgaggagga ggagaccatc 240 atcaagcttc acggccttct cggcaacaag tggtcgaaga tcgcgtcgtg cctgccgggg 300 aggacggaca acgagatcaa gaacgtctgg aacacgcacc tcaagaagcg ggtgtcgccg 360 gagcagaaga agggtggggg caagagcaag aagaagacga cctgcaccga cgtgctcgtc 420 ccgtccccat cgccgtcgtc gtccaccacc accacgacca actgctccag cggcgactca 480 gccggcgagc accgacc gagggagggagggagggagggaggcgaccgaggc 540 cccatgctcg agctcgaccc ctgctgctc gactcgaca tgctagttga cccgttgtc 600 ccggacacgt actgccccgc gtgtcggcg tcggcgtcgg cgtcggcgtc ggcgccgacg 660 tcgccgtgct cgtccacgtc cccgtcgtgc gcccgtgcag gcgtggaccc gctgctcgac 720 ctgcccgaaa tcgtggacct cggccggag ctaggagca tcatggacgg cggcggccggc 780 gacgggtgca ccgaagcgcc gccgccggcg tggagcaatg cggcggcggc ggcggcggcc 840 aatgcacag tggccaccac gaccagcctg gaggaggagg agggaagga gtggtggttg 900 aaggacttgg agaaggagct cgggctgtgg gggcccacgg acgactacca ctgccaccg 960 ggcccacaag gtcagcccgg tcgcgcgggc ccaccaccct ccgccgtcgt ggaggaccca 1020 gtgtcgtgct acttccaagc gggccccacg gcagccgcca cgtggcagggg acacgagcccc 1080 tcggctgtca tcacgagtaa ccccatgat tactacgt aa 1122 <210> 3 <211> 942 <212> DNA <213> Artificial sequence <400> 3 tggcggtggc cgtacttctg aatgtgtttt agagctagaa atagcaagtt aaaataaggc 60 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttttttt tcgttttgca 120 ttgagttttc tccgtcgcat gtttgcagtt ttattttccg ttttgcattg aaatttctcc 180 gtctcatgtt tgcagcgtgt tcaaaaagta cgcagctgta tttcacttat ttacggcgcc 240 acattttcat gccgtttgtg ccaactatcc cgagctagtg aatacagctt ggcttcacac 300 aacactggtg acccgctgac ctgctcgtac ctcgtaccgt cgtacggcac agcatttgga 360 attaaagggt gtgatcgata ctgcttgctg ctcatgaatc caaaccacac ggagttcaaa 420 ttcccacaga ttaaggctcg tccgtcgcac aaggtaatgt gtgaatatta tatctgtcgt 480 gcaaaattgc ctggcctgca caattgctgt tatagttggc ggcagggaga gttttaacat 540 tgactagcgt gctgataatt tgtgagaaat aataattgac aagtagatac tgacatttga 600 gaagagcttc tgaactgtta ttagtaacaa aaatggaaag ctgatgcacg gaaaaaggaa 660 agaaaaagcc atactttttt ttaggtagga aaagaaaaag ccatacgaga ctgatgtctc 720 tcagatgggc cgggatctgt ctatctagca ggcagcagcc caccaacctc acgggccagc 780 aattacgagt ccttctaaaa gctcccgccg aggggcgctg gcgctgctgt gcagcagcac 840 gtctaacatt agtcccacct cgccagttta cagggagcag aaccagctta taagcggagg 900 cgcggcacca agaagcgtgc ccgaaatcgt ggacctcgtt ta 942

Claims

1. The application of the OsRL4 protein, characterized by: The application is either a1) or a2): a1) Application of OsRL4 protein overexpression in reducing root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number in rice. a2) Application of OsRL4 protein overexpression in the cultivation of transgenic rice with reduced root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number. The OsRL4 protein is as follows (b1) or (b2): b1) The amino acid sequence of the OsRL4 protein is shown in SEQ ID NO:1; b2) The OsRL4 protein is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:

1.

2. The application of knocking out the gene encoding the OsRL4 protein as described in claim 1, characterized in that: The application is either d1) or d2): d1) The application of knocking out the gene encoding the OsRL4 protein in increasing root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number in rice. d2) Application of knocking out the gene encoding the OsRL4 protein in the cultivation of transgenic rice with increased root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

3. The application according to any one of claims 1 to 2, characterized in that: The rice variety is either Nipponbare or IRAT109.

4. A method for cultivating transgenic rice, comprising the following steps: obtaining transgenic rice by increasing the expression level of the OsRL4 protein as described in claim 1 in recipient rice; compared with the recipient rice, the transgenic rice has reduced root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

5. The method according to claim 4, characterized in that: The increase in the expression level of the OsRL4 protein as described in claim 1 in the recipient rice is achieved by introducing a nucleic acid molecule encoding the OsRL4 protein into the recipient rice.

6. A method for cultivating transgenic rice, comprising the following steps: obtaining transgenic rice by knocking out the expression level of the OsRL4 protein as described in claim 1 in recipient rice; compared with the recipient rice, the transgenic rice has increased root length, lateral root density, lateral root length, root volume, root dry weight, root tip meristem length, and meristem cell number.

7. The method according to claim 6, characterized in that: The expression level of the OsRL4 protein in the recipient rice of claim 1 is achieved by introducing a substance into the recipient rice that knocks out the expression level of the OsRL4 protein in claim 1 of the recipient rice. The substance used to express the OsRL4 protein in claim 1 in the knockout receptor rice is the recombinant plasmid OsRL4. - CR; The recombinant plasmid OsRL4 - CR represents the recombinant plasmid obtained by inserting the DNA double-stranded molecule shown in SEQ ID No: 3 into the recognition site of the restriction endonuclease BsaI in the vector pHUE411.

8. The method according to any one of claims 4-7, characterized in that: The recipient rice is either the Nipponbare or the IRAT109 rice variety.

Images