Application of WNT10A and SLCO4A1-AS1 in diagnosis and treatment of glioma

CN117230198BActive Publication Date: 2026-09-11JINAN MICROECOLOGY & BIOMEDICINE PROVINCIAL LAB
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311282269.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-28
Publication Date
2026-09-11
Estimated Expiration
2043-09-28

AI Technical Summary

Technical Problem

然而,其在胶质瘤中的作用尚未见报道

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117230198B_ABST
    Figure CN117230198B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine and molecular biology, and particularly relates to application of WNT10A and SLCO4A1-AS1 in diagnosis and treatment of glioma. The application proves for the first time that expression of WNT10A and SLCO4A1-AS1 increases with increase of malignant degree of glioma, and is negatively correlated with survival rate; meanwhile, WNT10A lentivirus silencing can significantly inhibit expression level of WNT10A of glioma, and the silencing of WNT10A inhibits proliferation and colony formation of glioma cells, and can be used as an effective drug for preventing and / or treating glioma; meanwhile, down-regulation of SLCO4A1-AS1 gene can also effectively inhibit malignant growth and invasion ability of glioma cells. The application provides a new view for finding biomarkers for clinical diagnosis and prognosis evaluation of glioma and drug treatment targets, lays a foundation for related drug research and development, and has important significance for research and treatment of glioma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to the application of WNT10A and SLCO4A1-AS1 in the diagnosis and treatment of glioma. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Gliomas are the most common primary intracranial tumors, accounting for 81% of malignant brain tumors. Glioblastoma is the most common type of glioma (accounting for approximately 45% of all gliomas), characterized by a poor prognosis, resistance to surgery and radiotherapy / chemotherapy regimens, with a 5-year relative survival rate of only 5%. The main reasons for the poor prognosis of GBM patients are the high proliferative capacity of tumor cells, invasive growth, intratumoral genetic heterogeneity, and malignant phenotypes and characteristics such as microvascular proliferation. Currently, the international standard treatment for GBM is maximal surgical resection followed by concurrent chemoradiotherapy with temozolomide (TMZ), combined with radiotherapy, but the overall treatment effect is not ideal. Due to the infiltration characteristics of glioma cells into surrounding brain tissue and the poor permeability of the blood-brain barrier to chemotherapeutic drugs, even with the use of advanced microsurgical techniques, it is still difficult to completely remove the tumor, and glioma cells are prone to high resistance and tolerance to treatment interventions. Therefore, finding novel treatments that effectively inhibit the malignant biological characteristics of gliomas, thereby prolonging patient survival and improving their quality of life, is a significant challenge in the field of neuro-oncology.

[0004] The WNT signaling pathway exhibits pleiotropic physiological functions, ranging from neurogenesis to stem cell proliferation, and is involved in various human cancers, including gliomas. This pathway is particularly relevant in the context of cancer stem cells (CSCs), which have been identified as key mediators of cancer recurrence and resistance to radiotherapy and chemotherapy. Therefore, novel therapeutic strategies targeting specific components of the WNT pathway have been extensively explored. Previous studies have found that the WNT pathway is associated with drug resistance in gastric and bladder cancers, poor prognosis in patients with esophageal squamous cell carcinoma, and an increased risk of colorectal adenomas. The applicant previously screened WNT members specifically expressed in gliomas, with WNT10A being the candidate gene showing the highest statistical significance. Importantly, to date, no studies have explored the relevance of WNT10A in human gliomas.

[0005] Meanwhile, over the past decade, long non-coding RNAs have been found to have a potential link to cancer development and progression. These long non-coding RNAs are mostly endogenous, at least 200 nucleotides in length, and have limited or no ability to encode proteins. SLCO4A1 antisense RNA 1 (SLCO4A1-AS1), located on the antisense strand of SLCO4A1 on chromosome 20, is significantly overexpressed in several cancer types and is associated with poor prognosis. However, its role in glioma has not been reported. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the inventors, through long-term technical and practical exploration, have developed an application of WNT10A and SLCO4A1-AS1 in the diagnosis and treatment of gliomas. This invention is the first to demonstrate that WNT10A and SLCO4A1-AS1 are highly expressed in gliomas, and their expression levels are correlated with glioma prognosis. Furthermore, regulating WNT10A expression can control the malignant growth and invasiveness of glioma cells, suggesting its potential application as a diagnostic / therapeutic / prognostic biomarker for gliomas.

[0007] To achieve the above technical objectives, the present invention adopts the following technical solution: A first aspect of the invention provides the use of substances that detect WNT10A and SLCO4A1-AS1 in the preparation of products for the diagnosis, detection, monitoring, or prediction of glioma progression.

[0008] This invention demonstrates that WNT10A expression is upregulated in gliomas and correlates with tumor molecular grade. Furthermore, WNT10A expression is significantly associated with prognosis; high WNT10A expression predicts a poor prognosis for glioma patients. Similarly, SLCO4A1-AS1 expression is upregulated in gliomas and correlates with tumor grade, IDH mutation status, and 1p / 19q coding status. Moreover, high expression in all glioma patients, LGG, and GBM patients all predict poor prognosis. Therefore, WNT10A and SLCO4A1-AS1 can serve as biomarkers for diagnosing, detecting, monitoring, or predicting glioma progression.

[0009] A second aspect of the present invention provides a product for diagnosing, detecting, monitoring, or predicting the progression of glioma, comprising detecting the expression of WNT10A and SLCO4A1-AS1 in a sample based on high-throughput sequencing methods and / or quantitative PCR methods and / or probe hybridization methods.

[0010] A third aspect of the invention provides a system for diagnosing, detecting, monitoring, or predicting the progression of gliomas, the system comprising: i) An analysis unit comprising a detection substance selected from the above-mentioned WNT10A and SLCO4A1-AS1 expression levels in a subject's test sample; ii) An assessment unit comprising: determining the subject’s disease status based on the expression levels of WNT10A and SLCO4A1-AS1 determined in i).

[0011] A fourth aspect of the invention provides the use of a substance that inhibits the expression of WNT10A and SLCO4A1-AS1 and / or reduces their activity in at least one of the following a1)-a5): a1) Inhibit the proliferation of glioma cells or prepare products that inhibit the proliferation of glioma cells; a2) Inhibit the colony-forming ability of glioma cells or prepare products that inhibit the colony-forming ability of glioma cells; a3) Inhibit the invasive ability of glioma cells or prepare products that inhibit the invasive ability of glioma cells; a4) Inhibit the growth or / or invasion of gliomas or prepare products that inhibit the growth or / or invasion of gliomas; a5) To treat gliomas or to prepare products for treating gliomas.

[0012] A fifth aspect of the present invention provides a method for preventing and / or treating gliomas, the method comprising administering to a subject the aforementioned substances that inhibit the expression of WNT10A and SLCO4A1-AS1 and / or reduce their activity.

[0013] Compared with existing technical solutions, one or more of the above technical solutions have the following beneficial effects: The above-mentioned technical solution demonstrates for the first time that the expression of WNT10A and SLCO4A1-AS1 increases with the degree of malignancy of glioma and is negatively correlated with survival rate; at the same time, WNT10A silencing lentivirus can significantly inhibit the expression level of WNT10A in gliomas, and the silencing of WNT10A inhibits the proliferation and colony formation of glioma cells, which can be used as an effective drug for the prevention and / or treatment of gliomas; in addition, the downregulation of SLCO4A1-AS1 gene can also effectively inhibit the malignant growth and invasive ability of glioma cells.

[0014] In summary, the above-mentioned technical solutions provide a new perspective for finding biomarkers and drug targets for the clinical diagnosis and prognostic assessment of gliomas, lay the foundation for the development of related drugs, and are of great significance for the research and treatment of gliomas, thus having good practical application value. Attached Figure Description

[0015] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0016] Figure 1 This is a graph illustrating the expression level and prognostic significance of WNT10A in glioma tissue in Example 1 of this invention. A represents the differential expression of WNT10A in low-grade gliomas and glioblastomas in the TCGA database; B represents the differential expression of WNT10A in low-grade gliomas and glioblastomas in the CGGA database; C represents the differential expression of WNT10A in gliomas of all grades in the TCGA database; D represents the differential expression of WNT10A in gliomas of all grades in the CGGA database; and E represents THE HUMAN PROTEIN. Differential expression of WNT10A in glioblastoma and low-grade glioma tissue samples from the ATLAS database. F shows the immunohistochemical results of WNT10A in glioma specimens of different grades in our case database. G shows the expression of WNT10A and its co-expression with the stemness indicator SOX2 in glioma specimens of different grades in our case database. H shows the differential RNA expression of WNT10A in different cell lines. I shows the differential protein expression of WNT10A in different cell lines. J and K are the prognostic curves of WNT10A in the TCGA and CGGA databases, respectively. L and M show the changes in WNT10A expression levels when different glioma cells are induced to restore stemness and when stemness is lost, respectively. *P<0.05; **P<0.01; ***P<0.001.

[0017] Figure 2This is a series of graphs showing the reduction in proliferation and invasion of glioma cells after WNT10A-specific knockdown in Example 1 of this invention. A is the CCK-8 assay showing the growth curves of LN229, U118, and GBM#P3 cells based on OD450; B is the graph showing the decrease in colony formation ability after shWNT10A transfection; C is the graph showing EdU proliferation after shWNT10A transfection; D is the graph showing the decrease in 3D invasion ability after shWNT10A transfection; E is the graph showing the increase in apoptotic cells after shWNT10A transfection; F is the graph showing the decrease in brain-like invasion ability after shWNT10A transfection; G and H are the graphs showing the decrease in spheroidization ability after shWNT10A transfection; I and J are the graphs showing the decrease in stemness after shWNT10A transfection; K is the graph showing the effect of biofluorescence imaging on the establishment of an orthotopic xenograft glioma model with stable shWNT10A cells in BALB / c nude mice. The BLI (Bio-Liquid Immunofluorescence) system was used to evaluate tumor growth. Compared to the WNT10A knockdown group, mice in the control group showed higher fluorescence intensity, indicating larger tumors. L (Left) represents shorter survival time in the control group compared to the WNT10A knockdown group. M (Mellow) indicates lower Ki67 immunohistochemical scores in the WNT10A knockdown group, which assessed tumor cell proliferation. N (Nellow) shows weaker tumor stemness in the WNT10A knockdown group, which assessed tumor stemness using SOX2 immunofluorescence. *P<0.05; **P<0.01; ***P<0.001.

[0018] Figure 3 This invention, in Example 1, verifies that WNT10A activates the JNK-cJUN-FOSB pathway in glioblastoma cells via FZD1. Figure AF verifies that WNT10A can directly bind to FZD1, thus exerting its effect. Figure G verifies that WNT10A mainly exerts its effect by activating JNK phosphorylation. Figure H shows that it exerts its effect downstream through FOSB. Figures I and J show that knocking down or overexpressing WNT10A will correspondingly affect FOSB expression. Figure K demonstrates that cJUN, after forming the AP-1 complex, acts as a transcription factor affecting FOSB expression. Figure L shows that WNT10A knockdown affects the activation of the FZD1-JNK-Cjun signaling pathway, thus affecting FOSB expression. Figure M shows that without the FZD1 receptor, the FZD1-JNK-Cjun signaling pathway cannot be activated. Figure N is a schematic diagram of the mechanism by which WNT10A exerts its effect.

[0019] Figure 4This refers to the expression levels of SLCO4A1-AS1 in glioma and normal tissue samples in Example 2 of this invention. Specifically, A represents the differential expression of SLCO4A1-AS1 in normal brain tissue and glioblastoma in the TCGA and GTEx databases; B represents the differential expression of SLCO4A1-AS1 in normal brain tissue and glioma in the GSE44971 database; C and D represent the differential expression of SLCO4A1-AS1 in different grades of glioma in the TCGA and CGGA databases; and E and F represent the differential expression of SLCO4A1-AS1 in glioma at different age groups in the TCGA and CGGA databases. G and H represent the differential expression of SLCO4A1-AS1 in different IDH states of glioma in the TCGA and CGGA databases, and I and J represent the differential expression of SLCO4A1-AS1 in different 1p / 19q coding states of glioma in the TCGA and CGGA databases. *P<0.05; **P<0.01; ***P<0.001.

[0020] Figure 5 This is a univariate and multivariate regression analysis of SLCO4A1-AS1 in glioma in Example 2 of the present invention. A and B are univariate and multivariate Cox regression analyses performed in the TCGA (n=667) and CGGA (n=325) databases, respectively.

[0021] Figure 6 This is a diagram illustrating the prognostic significance of SLCO4A1-AS1 in gliomas in Example 2 of this invention. Figure 6 A and Figure 6 B represents the prognostic curves of SLCO4A1-AS1 in all glioma patients, low-grade glioma (LGG), and glioblastoma (GBM) patients analyzed in the TCGA (n=667) and CGGA (n=325) databases, respectively.

[0022] Figure 7 This is a series of graphs showing that SLCO4A1-AS1 knockout can reduce the proliferation of glioma cells in Example 2 of this invention; where A is a real-time quantitative PCR analysis showing that the relative RNA level of SLCO4A1-AS1 was significantly reduced after using small interference knockout cells, with GAPDH as a control; B is a CCK-8 assay based on OD450 to show the growth curves of LN229, A172, U118 and GBM#P3 cells; C is the reduced cell colony formation ability after SLCO4A1-AS1 knockout.

[0023] Figure 8 In Example 2 of this invention, after knocking out SLCO4A1-AS1, cell proliferation activity decreased; *P<0.05; **P<0.01; ***P<0.001.

[0024] Figure 9 This is a graph showing the reduction in glioma invasiveness after si-SLCO4A1-AS1 transfection of cells in Example 2 of this invention. In this graph, A represents glioma cells LN229, A172, and U118; B represents glioma cells GBM#P3; *P<0.05; **P<0.01; ***P<0.001. Detailed Implementation

[0025] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0026] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0027] In one typical embodiment of the present invention, the use of substances for detecting WNT10A and SLCO4A1-AS1 in the preparation of products for diagnosing, detecting, monitoring or predicting the progression of gliomas is provided.

[0028] This invention demonstrates that WNT10A expression is upregulated in gliomas and correlates with tumor molecular grade. Furthermore, WNT10A expression is significantly associated with prognosis; high WNT10A expression predicts a poor prognosis for glioma patients. Similarly, SLCO4A1-AS1 expression is upregulated in gliomas and correlates with tumor grade, IDH mutation status, and 1p / 19q coding status. Moreover, high expression in all glioma patients, LGG, and GBM patients all predict poor prognosis. Therefore, WNT10A and SLCO4A1-AS1 can serve as biomarkers for diagnosing, detecting, monitoring, or predicting glioma progression.

[0029] Among them, WNT10A and SLCO4A1-AS1 are of human origin; The gliomas include low-grade gliomas (grades I-II) and high-grade gliomas (grades III-IV). As mentioned above, the upregulation of WNT10A and SLCO4A1-AS1 is positively correlated with the increase in glioma grade (malignancy) and negatively correlated with the better prognosis of glioma patients.

[0030] Specifically, the methods for diagnosing, detecting, monitoring, or predicting the progression of gliomas include, but are not limited to, (early or adjunctive) diagnosis of gliomas, assessment of malignancy, and prognostic assessment of glioma patients. The prognostic assessment includes at least an assessment of the overall survival of patients with gliomas.

[0031] In another specific embodiment of the present invention, a product for diagnosing, detecting, monitoring or predicting the progression of glioma is provided, comprising substances for detecting the expression of WNT10A and SLCO4A1-AS1 in a sample based on high-throughput sequencing methods and / or quantitative PCR methods and / or probe hybridization methods.

[0032] The sample can be a glioma sample from the subject, such as glioma cells or glioma tissue from the subject.

[0033] The products mentioned may be detection reagents, detection kits, biosensors, and related detection devices and equipment, etc., without specific limitations.

[0034] In another specific embodiment of the present invention, a system for diagnosing, detecting, monitoring, or predicting the progression of gliomas is provided, the system comprising: i) An analysis unit comprising a detection substance selected from the above-mentioned WNT10A and SLCO4A1-AS1 expression levels in a subject's test sample; ii) An assessment unit comprising: determining the subject’s disease status based on the expression levels of WNT10A and SLCO4A1-AS1 determined in i).

[0035] Among them, WNT10A and SLCO4A1-AS1 are of human origin.

[0036] The assessment of the subject's disease status includes at least an evaluation of the subject's (early or auxiliary) diagnosis of glioma, the degree of malignancy, and the prognosis of glioma patients; further, the prognostic assessment includes at least an evaluation of the overall survival of glioma patients.

[0037] In another specific embodiment of the present invention, the use of a substance that inhibits the expression of WNT10A and SLCO4A1-AS1 and / or reduces their activity is provided in at least one of the following a1)-a5): a1) Inhibit the proliferation of glioma cells or prepare products that inhibit the proliferation of glioma cells; a2) Inhibit the colony-forming ability of glioma cells or prepare products that inhibit the colony-forming ability of glioma cells; a3) Inhibit the invasive ability of glioma cells or prepare products that inhibit the invasive ability of glioma cells; a4) Inhibit the growth or / or invasion of gliomas or prepare products that inhibit the growth or / or invasion of gliomas; a5) To treat gliomas or to prepare products for treating gliomas.

[0038] Furthermore, this study found that knocking down WNT10A effectively inhibited the activation of the FZD1-JNK-cJUN signaling pathway in glioma cells, thereby affecting malignant phenotypes such as glioma cell proliferation and invasion.

[0039] Substances that inhibit the expression of WNT10A and SLCO4A1-AS1 and / or reduce their activity include, but are not limited to, RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNAs, substances that induce lentiviral infection or gene knockout, etc.

[0040] The product may be a drug or an experimental reagent, and the experimental reagent may be used for basic research.

[0041] According to the present invention, when the product is a drug, the drug further includes at least one inactive pharmaceutical ingredient.

[0042] The inactive components of the drug can be pharmaceutically commonly used carriers, excipients, and diluents. Furthermore, according to conventional methods, it can be formulated into oral, topical, suppository, and sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0043] The non-pharmaceutical active ingredients that may be included, such as carriers, excipients, and diluents, are well known in the art, and those skilled in the art can determine that they meet clinical standards.

[0044] In another specific embodiment of the invention, the drug of the invention can be administered into the body by known means, such as intravenous systemic delivery. Alternatively, it can be administered via intravenous, percutaneous, intranasal, mucosal, or other delivery methods. Such administration can be performed via a single dose or multiple doses. Those skilled in the art will understand that the actual dose to be administered in the invention can vary considerably depending on a variety of factors, such as target cells, biological type or tissue, the general condition of the subject to be treated, route of administration, manner of administration, etc.

[0045] In another specific embodiment of the present invention, the drug can be administered to humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, preferably humans.

[0046] In another specific embodiment of the present invention, a method for preventing and / or treating glioma is provided, the method comprising administering to a subject the aforementioned substances that inhibit the expression of WNT10A and SLCO4A1-AS1 and / or reduce their activity.

[0047] The present invention will be further illustrated below with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Experimental conditions not specifically specified in the examples are generally performed under conventional conditions or as recommended by the sales company; unless otherwise specified in the present invention, these conditions are commercially available.

[0048] Example 1 I. Materials and Methods Tissue Samples and Databases: This embodiment includes glioma samples and normal brain tissue from the Department of Neurosurgery, Qilu Hospital of Shandong University. This study protocol was approved by the hospital's policy review committee, and written informed consent was obtained from each participant. Three normal brain tissue samples, ten WHO grade II-III samples, and five grade IV (GBM) tissue samples were obtained through routine surgical treatment. Glioma specimens were verified and classified by two experienced clinicopathologists according to the WHO tumor classification. Clinical information and expression data of glioma samples from public databases were obtained from the TCGA and CGGA databases.

[0049] Cell culture and reagents: Human glioblastoma cells were purchased from the Cell Bank of the Chinese Academy of Sciences. All cells were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C in a cell culture incubator containing 5% carbon dioxide.

[0050] WNT10A knockdown was achieved using lenti-shWNT10A and lenti-Control lentiviruses (Genepharma, Shanghai; sequences shown in the table below), constructed and synthesized using a lentiviral vector. These lentiviruses were then used to infect glioma cells according to a standard protocol. Post-infection cells were screened with puromycin for subsequent experiments.

[0051]

[0052] Real-time quantitative PCR was performed using Trizol reagent (Invitrogen, Life Technologies) to extract RNA from glioma cells, followed by reverse transcription. The primers for WNT10A were: forward primer: 5'- CTTCCACTGGTGCTGTTTCGT -3' (SEQ ID NO.3); reverse primer: 5'- TCACTTGCAGACGCTGACCC -3' (SEQ ID NO.4).

[0053] Western blot-harvested cells were lysed using heat denaturation in RIPA cell lysis buffer. Protein lysates (20 μg) were analyzed, and proteins were transferred to a polyethylene difluoride (PVDF) membrane. Major antibodies WNT10A, p-JNK, JNK, p-cJUN, cJUN, FOSB, and GAPDH were incubated. Specific proteins were detected using enhanced chemiluminescence (ECL, Millipore, Bredford, USA).

[0054] Cell proliferation analysis - CCK-8: Glioma cells were cultured in 96-well cell culture dishes at a density of 3000 cells / well. Cell proliferation was analyzed using the Cell Counting Kit-8 (CCK-8) at 24, 48, 72, and 96 hours after transfection. 10 μL of CCK-8 solvent was added to each well, and the cells were incubated for 1 hour. The optical density was then measured at 450 nm using Ensight (PerkinElmer), and cell proliferation curves were plotted.

[0055] EdU proliferation assay: Glioma cells were cultured in 24-well cell culture dishes at a density of 50,000 cells / well. After transfection for 48 hours, EdU reagent was added, followed by staining according to the manufacturer's instructions. The cells were photographed under a fluorescence microscope, and the total number of cells and the number of EdU-positive cells were counted and the ratio was calculated.

[0056] For cell colony formation assays, cells were seeded into 6-well plates at a density of 1000 cells / well. DMEM containing 10% fetal bovine serum was replaced every three days. After 15 days, cells were fixed with methanol, stained with crystal violet for 15 minutes, and photographed. Each assay was repeated three times.

[0057] In the cell spheroidization assay, cells were seeded into 12-well plates at a density of 1000 cells / well and cultured using Neurobasal stem cell culture medium. After 10 days, the number of spheroids was assessed under a microscope and photographed for statistical analysis. Each experiment was repeated three times.

[0058] The cell invasion assay for glioma spheroidization involved incubating cells in a spheroidizing matrix for 72 hours, then implanting spheroids with a diameter >2 mm into 96-well plates and adding an invasion gel. The glioma spheroids were photographed under a microscope every 24 hours. The ellipsoid at 0 h was used as a reference point for measuring the invasion area of ​​the invasive cells.

[0059] Invasive Sphere-Brain Organoid Invasion Assay: Our previous work described a protocol for co-culturing GBM brain organoids to invade rat fetal brain organoids cultured in vitro for 18 days. After 3 weeks of culture, normal brain organoid cells had differentiated, and tumor spheres were exposed to the normal brain organoids. U251-GRP cells (n=3000) cultured with GFP lentivirus were placed in 96-well plates and cultured for 3 days to generate tumor spheres, which were then co-cultured with mature brain organoids for 24 hours. RB treatment was then performed. The relative area of ​​tumor cell invasion was captured using confocal microscopy at 0, 48, and 96 hours. Soft analysis of the images revealed the relative area of ​​the invasion region associated with GBM cells.

[0060] In vivo mouse experiments established intracranial gliomas using GBM#P3-luciferase (1×10⁻⁶). 6 Mice were transfected with Lenti-shWNT10A or Lenti-Control virus and then stereotactically implanted into the brains of mice. Bioluminescence imaging was used to detect intracranial tumor growth on days 4 and 20. Kaplan-Meier survival curves were used to describe survival time and body weight.

[0061] Chromatin immunoprecipitation-CHIP was performed using the Millipore Chromatin Immunoprecipitation Kit, following the instructions. cJUN and IgG antibodies were added separately, and the products were quantified by PCR.

[0062] Immunohistochemistry involved preheating paraffin sections in a 65°C incubator for 60 min, followed by dewaxing in xylene I and II for 15 min each, and then hydration in pure ethanol I, pure ethanol II, 95% ethanol, 80% ethanol, and 70% ethanol for 5 min each. After rinsing with PBS, antigen retrieval was performed using sodium citrate buffer (pH 6.0) at 80°C for 5 min and then at 20°C for 15 min. Incubate with 3% H2O2 for 15 min to remove endogenous peroxidase activity, then wash with PBS for 5 min × 3 times. Incubate with 10% goat serum blocking solution at 37℃ for 15 min to block non-specific antigens. After discarding the supernatant, add an appropriate proportion of diluted primary antibody working solution (proliferation marker: Ki67) and incubate overnight at 4℃. Wash with PBS for 5 min × 3 times, then add biotinylated secondary antibody working solution (goat anti-rabbit) and incubate at 37℃ for 15 min. Wash with PBS for 5 min × 3 times, then add horseradish enzyme-labeled streptavidin working solution and incubate at 37℃ for 15 min. Wash with PBS for 5 min × 3 times, then develop with DAB for 1-3 min until brown granules appear, then stop the incubation. Rinse thoroughly with tap water. Counterstain with hematoxylin for 3 min, rinse, then differentiate with hydrochloric acid alcohol, and rinse with tap water to return to blue. Then, the slides were dehydrated for 5 minutes each in 70%, 80%, 95%, 100% I, and 100% II ethanol, respectively, followed by clearing with xylene I and II for 15 minutes each, and then mounted with neutral resin. After drying and solidification, the slides were observed under a microscope and photographed.

[0063] Statistical analysis was performed using GraphPad Prism 7 software, with ANOVA or t-tests applied. All experiments were repeated three times, and the mean ± standard error was calculated. Kaplan-Meier survival curves were analyzed using the log-rank test. Chi-square test and Fisher's exact analysis were used to determine the relationship between WNT10A expression and clinicopathological findings. A p-value < 0.05 was considered statistically significant.

[0064] II. Experimental Results WNT10A expression is upregulated in gliomas and correlates with tumor molecular grade; high expression may serve as a marker of poor prognosis in glioma patients. First, the gene expression levels of WNT family genes in GBM and LGG were analyzed using the TCGA and CGGA databases. Results showed that WNT10A and WNT16 expression levels were significantly increased in GBM, with WNT10A showing the most significant difference. Figure 1 (As shown in AB). Next, we analyzed the expression level of WNT10A in gliomas of different grades using the TCGA and CGGA databases. The results showed that the expression level of WNT10A was highest in grade 4 gliomas (As shown in AB). Figure 1As shown in CD. The results of immunohistochemistry and immunofluorescence of specimens from the THEHUMAN PROTEIN ATLAS database and our hospital's patients also confirm this conclusion. Figure 1 (See EG). We used RT-qPCR and Western blot techniques to detect the differences in WNT10A levels in glioma cell lines, primary glioma cells, and normal astrocytes, and found that WNT10A is highly expressed in most glioma cell lines. Figure 1 (See HI). The prognostic value of WNT10A expression in overall survival (OS) of glioma patients was examined using Kaplan-Meier survival curves. In the TCGA and CGGA databases, WNT10A expression was significantly associated with prognosis; high WNT10A expression consistently predicted a poor prognosis. Figure 1 (As shown in JK). Therefore, WNT10A can serve as a novel prognostic biomarker for gliomas, providing a basis for assessing postoperative survival in patients. We also found that WNT10A affects the stemness of gliomas (as shown in JK). Figure 1 (As shown in LM), and the stemness of gliomas can promote malignant phenotypes such as glioma proliferation.

[0065] To verify the inhibitory effect of WNT10A knockdown on glioma cell proliferation and invasion, based on the abnormal upregulation of WNT10A expression in gliomas, suggesting its potential role as an oncogene, a lentivirus lenti-shWNT10A was constructed to downregulate WNT10A expression in glioma cell lines LN229, U118, and GBM#P3 to assess the role of WNT10A in the malignant biological characteristics of gliomas. The effect of WNT10A on cell proliferation was measured using CCK-8 assays, colony formation assays, EdU assays, and cell spheroidization assays. CCK-8 results showed that the proliferation of glioma cells in the WNT10A knockdown group was significantly lower than that in the control group after 4 days. Figure 2 A); EdU's results also confirmed this conclusion ( Figure 2 C). Meanwhile, the colony-forming and spheroidizing abilities of glioma cells in the WNT10A knockdown group were inhibited. Figure 2 B, G, H). In the invasion ability test, the distance that glioma cells in the WNT10A knockdown group invaded into the surrounding stroma gel after 72 hours was significantly lower than that in the control group (B, G, H). Figure 2 D), the invasive ability of WNT10A knockdown glioma cells was tested again using brain-like technology, and the conclusions were consistent. Figure 2 F). Flow cytometry analysis showed that WNT10A knockdown promoted glial cell apoptosis. Figure 2 E) These results indicate that downregulation of the WNT10A gene can inhibit the malignant growth and invasive ability of glioma cells.

[0066] The effect of WNT10A on intracranial tumor growth was detected using a bioluminescence imaging (BLI) system to assess the growth and progression of gliomas in nude mice after intracranial tumor implantation. Results showed that the fluorescence intensity in the lenti-shWNT10A group was significantly lower than that in the control group 20 days after tumor implantation. Figure 2 K). The overall survival time of the control group was shorter than that of the lenti-shWNT10A group (P<0.001, Figure 2 L). Immunohistochemical detection of Ki67, a cell proliferation marker, using mouse brain tissue sections revealed a significant decrease in Ki67 histochemical score in the lenti-shWNT10A group. Figure 2 M), immunofluorescence showed that SOX2, a tumor cell stemness marker, was also significantly decreased ( Figure 2 The above results indicate that downregulation of WNT10A leads to a decrease in the growth rate of glioma cells in vivo.

[0067] WNT10A downregulates the FZD1-JNK-cJUN signaling pathway in glioma cells. cJUN protein is a component of the Activated Protein-1 (AP-1) transcriptional complex and is the most transcriptionally active transcription factor within the AP-1 complex. Various physical, chemical, and biological stimuli, as well as cellular stress responses, can promote cJUN protein expression and activation, thereby regulating biological processes such as cell proliferation and apoptosis. High cJUN protein expression has been confirmed to be closely related to the occurrence and prognosis of various malignant tumors. We used protein-protein interaction techniques to predict and validate the receptor FZD1 (cJUN) on the surface of tumor cells. Figure 3 AF) used Western blot technology to find that knocking down WNT10A decreased the phosphorylation level of JNK in tumor cells, while overexpression of WNT10A significantly increased the phosphorylation level of JNK. However, the signaling pathways closely related to Frizzled receptors, such as β-Catenin and CaMKII, did not show significant changes. Figure 3 G). Transcriptome sequencing revealed that knockdown of WNT10A primarily affected the expression of downstream FOSB, which was subsequently validated by RT-qPCR, and the results were consistent with the sequencing findings. Figure 3 HJ), and FOSB is an important component of the AP-1 complex. Decreased JNK phosphorylation levels also affect the stability of cJUN protein, which in turn regulates FOSB expression as a transcription factor, thus forming a positive feedback loop. This process was verified by CHIP experiments. Figure 3 K). And the corresponding verification was performed using Western blot technology. Figure 3Based on the above experiments, we propose the following view: knocking down WNT10A inhibits the activation of the FZD1-JNK-cJUN signaling pathway in glioma cells, thereby affecting the malignant phenotypes of glioma cells such as proliferation and invasion.

[0068] Example 2 I. Materials and Methods Clinical information and expression data of glioma samples in tissue samples and public databases were obtained from TCGA, CGGA and GEO databases.

[0069] Cell culture and reagents: Human glioblastoma cells were purchased from the Cell Bank of the Chinese Academy of Sciences. All cells were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C in a cell culture incubator containing 5% carbon dioxide.

[0070] SLCO4A1-AS1 knockout was performed using a high-efficiency, low-interference transfection protocol to transfect glioma cells, as shown in the following sequence:

[0071] RNA was extracted from glioma cells using Trizol reagent (Invitrogen, Life Technologies) for real-time quantitative PCR and then reverse transcribed. The primers for SLCO4A1-AS1 were: forward primer: 5'-TGGGCAGAGTGTCGCTG-3' (SEQ ID NO.7); reverse primer: 5'-GGCATTCAGAGAGTTGCGTTCA-3' (SEQ ID NO.8).

[0072] 5. Cell proliferation capacity analysis Glioma cells were evenly seeded into 96-well plates and divided into three groups (si-NC, si-SLCO4A1-AS1-1, and si-SLCO4A1-AS1-2). After 24, 48, 72, and 96 hours of culture, 10 μL of CCK-8 was added to each well, and the cells were incubated for 1-2 hours. The absorbance at 450 nm was measured using a microplate reader.

[0073] 6. Cell colony formation experiment LN229, A172, and U118 cells transfected with si-NC, si-SLCO4A1-AS1-1, and si-SLCO4A1-AS1-2 were evenly seeded into 6-well plates at 800 cells per well and cultured in an incubator for approximately 14 days. The cells were then fixed with 4% paraformaldehyde for 20 minutes. The cells were stained with crystal violet for 15 minutes and observed and imaged under a microscope.

[0074] 7. EDU Experiment We used an EdU cell proliferation assay kit to detect EDU. Both the control and experimental groups were seeded in 24-well plates, with 20,000 cells per well. After 24 hours, the cells were cultured with EDU at 37°C for 2 hours, then fixed with 4% neutral paraformaldehyde fixative for 15 minutes at room temperature in the dark. The cells were then incubated with 0.1 mL of 0.5% Triton X-100 exudate at room temperature for 20 minutes. The Click-iT reaction mixture was incubated at room temperature in the dark for 30 minutes. Finally, the cell nuclei were stained with Hoechst 33342 for 15–30 minutes, and the cells were imaged and counted under a microscope.

[0075] 8. Cell invasion ability detection experiment Cell invasion was assessed using a transwell assay. LN229, A172, and U118 cells, transfected 12–24 hours prior, were placed in the upper chamber of a 12-well plate in FBS-free medium. The lower chamber was filled with medium containing 15% fetal bovine serum (FBS). Cells were incubated at 37°C and 5% CO2 for 24–48 hours, fixed with 4% paraformaldehyde for 30 minutes, and the cells in the upper chamber were wiped with a cotton swab, stained with 0.1% crystal violet for 10 minutes, and counted. In a three-dimensional invasion assay, transfected P3 cells (3000 / well) were evenly seeded into 96-well plates. After spheroid formation, invasion gel was added to the wells, and the plates were incubated for 48 hours. The invasive spheroids were observed and imaged under a microscope. The invasiveness of the transfected tumor cells was examined by comparison with the control group.

[0076] 9. Statistical Analysis GraphPad Prism 7 software was used to apply ANOVA or t-tests. All experiments were repeated three times, and the mean ± standard error was taken. Kaplan-Meier survival curves were analyzed using the log-rank test. Chi-square test and Fisher's exact analysis were used to determine the relationship between SLCO4A1-AS1 expression and clinicopathology. P < 0.05 was considered statistically significant.

[0077] II. Experimental Results The expression level of SLCO4A1-AS1 is upregulated in gliomas and is correlated with tumor grade, IDH mutation status, and 1p / 19q coding status. First, the difference in gene expression levels of SLCO4A1-AS1 in GBM and normal brain tissue was analyzed using the combined TCGA and GTEx databases. The results showed that compared with normal brain tissue, the expression level of SLCO4A1-AS1 was increased in gliomas (…). Figure 4 As shown in A), it has been verified in the GSE44971 database. Figure 4 B). Further detailed analysis was conducted on the relationship between SLCO4A1-AS1 expression levels and glioma grading ( Figure 4(C, D) The results showed that SLCO4A1-AS1 expression was highest in GBM. These results indicate the important role of SLCO4A1-AS1 in the malignancy grading of gliomas. Furthermore, the applicant analyzed age (C, D) data in the TCGA and CGGA databases. Figure 4 E, F), IDH mutation state ( Figure 4 G, H), 1p / 19q encoding status ( Figure 4 The relationship between I, J) and SLCO4A1-AS1 expression levels was investigated. The results showed a significant correlation with high SLCO4A1-AS1 expression.

[0078] High expression of SLCO4A1-AS1 can serve as a marker of poor prognosis in glioma patients. Univariate and multivariate Cox regression analyses were used to verify the relationship between SLCO4A1-AS1 and other clinical traits and clinical prognosis. The results showed that the expression level of SLCO4A1-AS1 was independently associated with prognosis. Figure 5 (As shown). Kaplan-Meier survival curves were used to examine the prognostic value of SLCO4A1-AS1 expression in overall survival (OS) of glioma patients. In the TCGA and CGGA databases, SLCO4A1-AS1 expression was significantly associated with prognosis; high SLCO4A1-AS1 expression was a predictor of poor prognosis in all glioma patients, LGG, and GBM patients. Figure 6 (As shown). Therefore, SLCO4A1-AS1 can serve as a novel prognostic biomarker for gliomas, providing a basis for assessing postoperative survival in patients.

[0079] To verify the knockout efficiency of SLCO4A1-AS1 in glioma cells and its inhibitory effect on glioma cell proliferation and invasion, this study aimed to evaluate the role of SLCO4A1-AS1 in the malignant biological characteristics of gliomas. Based on the aberrant upregulation of SLCO4A1-AS1 expression in gliomas, suggesting its potential oncogene role in glioma development, small interference knockout was used to knock out SLCO4A1-AS1 expression in glioma cell lines LN229, A172, U118, and GBM#P3. Real-time quantitative PCR analysis confirmed that the expression level of SLCO4A1-AS1 was significantly lower after knockout compared to the NC group. Figure 7 A). These results further confirm the effectiveness of si-SLCO4A1-AS1 in downregulating SLCO4A1-AS1 in in vitro functional experiments on glioma cells. The effect of SLCO4A1-AS1 on cell proliferation was determined using CCK-8, colony formation, and EDU assays. CCK-8 results showed that the proliferation of glioma cells in the SLCO4A1-AS1 knockout group was significantly lower than that in the control group after 4 days. Figure 7B); Simultaneously, the colony-forming ability of glioma cells in the SLCO4A1-AS1 knockout group was inhibited. Figure 7 C), and the cell proliferation activity of the SLCO4A1-AS1 knockout group was significantly reduced ( Figure 8 In the invasive ability test, the invasive ability of glioma cells in the SLCO4A1-AS1 knockout group was significantly reduced. Figure 9 These results indicate that downregulation of the SLCO4A1-AS1 gene can inhibit the malignant growth and invasive ability of glioma cells.

[0080] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. Application of substances that detect the expression levels of WNT10A and SLCO4A1-AS1 in the preparation of products for the diagnosis and detection of glioma progression.

2. The application as described in claim 1, characterized in that, The WNT10A and SLCO4A1-AS1 are of human origin; The gliomas include low-grade gliomas and high-grade gliomas; The low-grade gliomas are grade I-II; the high-grade gliomas are grade III-IV. Upregulation of WNT10A and SLCO4A1-AS1 was positively correlated with increased glioma grade and negatively correlated with better prognosis in glioma patients.

3. The application as described in claim 1, characterized in that, Advances in the diagnosis and detection of gliomas include early or auxiliary diagnosis of gliomas, assessment of malignancy, and prognostic assessment of glioma patients. The prognostic assessment is an evaluation of the overall survival of patients with gliomas.

4. The application as described in claim 1, characterized in that, Products used for the diagnosis and detection of glioma progression contain substances that detect the expression of WNT10A and SLCO4A1-AS1 in samples based on high-throughput sequencing methods and / or quantitative PCR methods and / or probe hybridization methods.

5. The application as described in claim 4, characterized in that, The sample is a glioma sample from the subject, including glioma cells or glioma tissue from the subject; The products mentioned are detection kits and biosensors.

6. A system for diagnosing and detecting the progression of glioma, characterized in that, The system includes: i) An analysis unit comprising a detection substance for determining the expression levels of WNT10A and SLCO4A1-AS1 in a subject's test sample; ii) An assessment unit comprising: determining the subject’s disease status based on the expression levels of WNT10A and SLCO4A1-AS1 determined in i).

7. The system as described in claim 6, characterized in that, The WNT10A and SLCO4A1-AS1 are of human origin; The assessment of the subject's disease status includes evaluating the early or auxiliary diagnosis of the subject's glioma, the degree of malignancy, and the prognosis of glioma patients; the prognostic assessment is the evaluation of the overall survival of glioma patients.

8. Application of substances that inhibit WNT10A and SLCO4A1-AS1 expression and / or reduce their activity in the following a1)-a5): a1) Prepare products that inhibit the proliferation of glioma cells; a2) Prepare products that inhibit the formation of glioma cell colonies; a3) Prepare products that inhibit the invasive ability of glioma cells; a4) Prepare products that inhibit the growth or / or invasion of gliomas; a5) Prepare products for treating gliomas; The substance that inhibits the expression of WNT10A and SLCO4A1-AS1 and / or reduces their activity is shWNT10A, which inhibits WNT10A, and si-SLCO4A1-AS1, which inhibits SLCO4A1-AS1. The sequence of shWNT10A is shown in SEQ ID NO:1-2, and the sequence of si-SLCO4A1-AS1 is shown in SEQ ID NO:5-6.

9. The application as described in claim 8, characterized in that, The product is a drug or experimental reagent, and the experimental reagent is intended for use in basic research.

Citation Information

Patent Citations

  • Modulating resistance to BCL-2 inhibitors

    US20220401460A1