Use of mis18a gene in preparation of lung cancer diagnosis, treatment or prognosis evaluation product

Abstract

This invention discloses the application of the MIS18A gene in the preparation of products for lung cancer diagnosis, treatment, or prognostic assessment. Database sequencing analysis revealed that the MIS18A gene is highly expressed in lung adenocarcinoma patients, and this high expression significantly reduces the overall survival rate, indicating that MIS18A can serve as a biomarker for screening and prognostic assessment of lung adenocarcinoma patients. Furthermore, using CRISPR-Cas9 technology, a MIS18A gene-specific knockout vector was constructed. Knockout of MIS18A in lung adenocarcinoma cells significantly reduced cell viability, colony formation, and proliferation levels, and weakened cell migration, demonstrating that MIS18A knockout significantly inhibits the progression of lung adenocarcinoma cells and affects their proliferation and migration. Therefore, the MIS18A gene has significant research value in the screening, diagnosis, treatment, prognostic assessment, and targeted drug development for lung cancer patients.

Description

Technical Field

[0001] This invention belongs to the field of gene diagnostic technology. More specifically, it relates to the application of the MIS18A gene in the preparation of products for lung cancer diagnosis, treatment, or prognostic assessment. Background Technology

[0002] Lung cancer is a highly prevalent malignant tumor originating from the bronchial mucosa or glands of the lungs. It poses the greatest threat to public health and life, with approximately two million new cases of various types of lung cancer diagnosed globally each year. Histopathologically, lung cancer is divided into two main categories: small cell lung cancer and non-small cell lung cancer. Non-small cell lung cancer accounts for about 85% of all lung cancer cases and can be further classified into three subtypes based on different pathological characteristics: lung adenocarcinoma, lung squamous cell carcinoma, and large cell lung cancer. Lung adenocarcinoma is the most common subtype of lung cancer.

[0003] As research into the mechanisms of cancer development deepens, cancer is now considered a malignant disease caused by alterations in a series of oncogenes, leading to abnormal cell proliferation and subsequent metastasis and invasion. However, the pathogenesis of lung adenocarcinoma remains unclear, and methods for early diagnosis and prognostic assessment are still insufficient. Furthermore, widespread drug resistance to drugs targeting known oncogenes has led to breakthroughs in cancer progression after treatment. Therefore, clinically, there is still a lack of effective indicators and therapeutic targets for early detection.

[0004] Currently, genes such as EGFR, KRAS, ALK, MET, and HER2 have been identified as biomarkers associated with the development of lung adenocarcinoma. Targeted therapies against known biomarkers like EGFR and ALK mutations have generally improved patient survival rates in clinical practice. MIS18A (MIS18 kinetochore protein A) is an important component of the MIS18 complex, a protein complex that plays a crucial role in the regulation of centromere formation. Current technologies show that the MIS18A gene is related to the body's inflammatory response, but have not demonstrated a close association with lung adenocarcinoma. There are currently few biomarkers available for the diagnosis of lung adenocarcinoma, and there is an urgent need to research and develop more biomarkers or targets for the diagnosis, treatment, and prognostic assessment of lung adenocarcinoma. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the shortcomings of existing biomarkers for diagnosing lung adenocarcinoma and to provide the application of the MIS18A gene in the preparation of products for lung cancer diagnosis, treatment or prognosis assessment.

[0006] The purpose of this invention is to provide the application of the MIS18A gene in lung cancer.

[0007] Another object of the present invention is to provide a drug for treating lung cancer.

[0008] Another object of the present invention is to provide a kit for lung cancer screening, diagnosis, or prognostic assessment.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution: This invention, through comprehensive RNA sequencing analysis of a large database, reveals for the first time that the MIS18A gene is highly expressed in lung adenocarcinoma patients. In lung adenocarcinoma samples across all stages and in TNM-stage (I, II, III, and IV) lung adenocarcinoma samples, MIS18A gene expression was significantly higher than in adjacent normal tissues. Furthermore, high expression of the MIS18A gene significantly reduced the overall survival rate of lung adenocarcinoma patients, indicating that MIS18A can serve as a biomarker for screening and prognostic assessment of lung adenocarcinoma. Further, using CRISPR-Cas9 technology, a MIS18A gene-specific knockout vector was constructed. Knockout of the MIS18A gene in lung adenocarcinoma cells significantly reduced cell viability, colony formation, and proliferation levels, and weakened cell migration, demonstrating that MIS18A gene knockout significantly inhibited the progression of lung adenocarcinoma cells and affected their proliferation and migration. Therefore, the MIS18A gene can be used for lung cancer patient screening, diagnosis, prognostic assessment, and the screening and development of targeted drugs for lung cancer.

[0010] Therefore, the present invention provides the following applications of the MIS18A gene: Application of the MIS18A gene as a biomarker in the preparation of lung cancer detection products.

[0011] Application of the MIS18A gene in the preparation of kits for lung cancer screening, diagnosis, or prognostic assessment.

[0012] Application of the MIS18A gene in the preparation of drugs for treating lung cancer.

[0013] Furthermore, the drug can inhibit lung cancer cell viability and growth, or reduce the proliferation and migration ability of lung cancer cells.

[0014] Application of reagents for detecting MIS18A gene expression in the research and screening of targeted drugs for lung adenocarcinoma.

[0015] This invention provides the application of reagents for detecting the MIS18A gene in the preparation of products for screening, diagnosing, or prognostic assessment of lung cancer.

[0016] This invention provides the application of a reagent for knocking out MIS18A gene expression in the preparation of drugs for treating lung cancer.

[0017] Preferably, the reagent for knocking out MIS18A gene expression is a vector after knocking out the MIS18A gene using gene editing technology.

[0018] Preferably, the MIS18A knockout vector is constructed using CRISPR / Cas9 technology.

[0019] More preferably, the vector is a plasmid with the MIS18A gene knocked out (L13205 pLenti-MIS18A-sgRNA).

[0020] In addition, the present invention also provides the application of reagents for detecting MIS18A gene expression in the preparation of lung cancer treatment drugs or in the preparation of lung cancer detection kits.

[0021] The present invention also provides a drug for treating lung cancer, comprising a reagent for knocking out the MIS18A gene.

[0022] The present invention also provides a kit for screening, diagnosing, or prognostically assessing lung cancer, comprising a reagent for detecting the MIS18A gene.

[0023] Preferably, the mRNA sequence of the MIS18A gene is shown in SEQ ID NO: 1.

[0024] Furthermore, the aforementioned lung cancer is lung adenocarcinoma.

[0025] The present invention has the following beneficial effects: This invention, through database sequencing analysis, for the first time discovered that the MIS18A gene is highly expressed in lung adenocarcinoma patients, and that high expression of MIS18A leads to a significant decrease in the overall survival rate of lung adenocarcinoma patients, indicating that MIS18A can serve as a biomarker for screening and prognostic assessment of lung adenocarcinoma patients. Furthermore, using CRISPR-Cas9 technology, a MIS18A gene-specific knockout vector was constructed. Knockout of MIS18A in lung adenocarcinoma cells significantly reduced cell viability, colony formation ability, and proliferation level, and weakened cell migration ability, demonstrating that MIS18A knockout significantly inhibits the progression of lung adenocarcinoma cells and affects their proliferation and migration. This indicates that the MIS18A gene has significant research value in lung cancer patient screening, diagnosis, treatment, prognostic assessment, and the development of targeted drugs for lung cancer. Attached Figure Description

[0026] Figure 1 The results of whole RNA sequencing analysis from the TCGA, GEO, and EGA databases are as follows: (A) Differences in MIS18A expression levels between lung adenocarcinoma tissues and adjacent non-cancerous tissues in the TCGA database were analyzed using the UALCN online analysis website; (B) Differences in MIS18A expression levels between lung adenocarcinoma tissues and adjacent non-cancerous tissues at different stages in the TCGA database were analyzed using the UALCN online analysis website; (C) The relationship between overall survival and MIS18A expression levels in lung adenocarcinoma patients in the TCGA, GEO, and EGA databases was analyzed using the Kaplan-Meier online analysis website.

[0027] Figure 2 The quantitative analysis of MIS18A knockout and its effect on the proliferation of lung adenocarcinoma cells were performed as follows: (A) qRT-PCR verification of the transcriptional level of MIS18A in H1975 cells after MIS18A knockout in CRISPR / Cas9; (B) CCK8 verification of the viability of H1975 cells after MIS18A knockout; (C) Colony formation assay verification of the colony-forming ability of H1975 cells after MIS18A knockout; (D) EdU staining verification of the proliferation level of H1975 cells after MIS18A knockout; (E) Scratch assay verification of the migration level of H1975 cells after MIS18A knockout. Detailed Implementation

[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0029] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0030] In the statistical analysis of the data in the following examples, all measurements are expressed as mean ± standard deviation, and unpaired t-tests are performed for comparison. Graphpad Prism 8.0 is used for statistical analysis.

[0031] Example 1: Database Retrieval Analysis This embodiment analyzed whole RNA sequencing (RNA-seq) data from TCGA, GEO, and EGA databases. Using the UALCN online database (https: / / ualcan.path.uab.edu / ), it was found that the MIS18A gene was significantly highly expressed in all stages of lung adenocarcinoma samples and in stage 1, stage 2, stage 3, and stage 4 lung adenocarcinoma samples of TNM stages I, II, III, and IV compared to adjacent normal tissues. Figure 1 A, p<0.0001), the expression of the MIS18A gene was also significantly upregulated at different stages of lung cancer ( Figure 1 B, p<0.0001).

[0032] Further Kaplan-Meier analysis was performed on the clinical data from the aforementioned databases. The Kaplan-Meier online database (https: / / kmplot.com / analysis / ) was used to analyze the impact of the MIS18A gene on overall survival in lung adenocarcinoma patients. It was found that lung adenocarcinoma patients with high MIS18A expression had significantly lower overall survival than those with low MIS18A expression. Figure 1 (C, p<0.005) indicates that MIS18A can serve as a biomarker for screening and prognostic assessment of lung adenocarcinoma patients, and MIS18A is of great significance for screening and prognostic assessment of lung adenocarcinoma patients.

[0033] The mRNA sequence of the MIS18A gene is shown in SEQ ID NO: 1: ccatggcgct ctggggcgcgggcgatttgt aggtaatggc aggcgttcgg tcactgaggt gtagcagagg atgcgctggc ggctgtgagtgcggcgacaa gggcaaatgc agcgactcct cgctgttggg caagagactc tccgaagact cgagccgccaccagctgttg cagaagtggg cgagcatgtg gagctccatg agcgaagacg cgtcggtggc cgacatggagagggcgcagc tggaggagga ggcggcggct gcggaggaga ggccgctggt gttcctgtgc tccggctgccggcggccgct gggcgactcg ctgagctggg tggccagcca ggaggacacc aactgcatcc tgcttcgctgtgtttcctgt aatgtttctg tggataagga acagaagcta tccaaacgtg aaaaggaaaa tggttgcgtccttgagactt tgtgctgcgc ggggtgctca ctcaatcttg gctacgtgta cagatgcacg cccaagaatcttgattacaa gagagacttg ttttgcctca gtgttgaagc cattgaaagt tatgttttag ggtcctctgaaaagcaaatt gtgtcagaag ataaagagct ttttaatctt gaaagcagag ttgaaataga aaagtctctaacacagatgg aagatgtctt gaaagcatta caaatgaagc tgtgggaggc cgaatccaaa ttgtcctttgccacttgtaa aagctgaact ctagtctgtg tcctccattc tgcccccgcc cttcctcccc ttatttgttaaatgaagcaa catagtgaga cgtcgtctct acaaaaaaaa aaagaaaaaa aaaattagcc aggcatgcgaaacgctgagg tgggaggatc agatgagcttgggaggttga ggctgcagtg agccttggtc atgccactactgtgttctag tctgggcaac agagtgagac cttctctcaa aaaaaaaacc caaaattgta gaattacttctatagctata ttttatgata aagaagtgat tgtttctcaa aatcgcattt taaagacgtt ttatggtacttgttggaatt gggacttagg agttttgatt ttgataagaa actgggataa ttttctgaac tttttttcctctgtatcaca tttatttact atttttaaaa actttgacat ttaacacttg ggacaacatt tattataaatgataagaaaa atcttagagg tttgtctacc cacagtgtca tggaatcttc tctgaaaact aatccataaagttccctgga gaaattggtc agaatgatct gtcagaacca tttgaaaact tgctcaagag cagttgctttatatatagtag gattttatactt tttcctgctt atgtactact atatgcttaa aaaacctgga ggaatacttaccaaagagga gtaaccatct ctgagggtgg gattctgggg gaatttttgt ttttttctgt tttctataatgtgaaacttt tgtagtatgt atttttctaa ttgaagagaa taaagattaa aacaaa.

[0034] Example 2: Construction and Expression Analysis of the MIS18A CRISPR / Cas9 Vector 1. Cell Culture Lung adenocarcinoma cell line NCI-H1975 (purchased from the Chinese Academy of Sciences Type Culture Collection Center) was cultured in RPMI-1640 medium (61870036, Thermo Fisher, USA) containing 10% fetal bovine serum (FBS) (10099141, Thermo Fisher, USA) and 1% penicillin-streptomycin solution (15140148, Thermo Fisher).

[0035] 2. Construction of CRISPR / Cas9 vectors The lentiCRISPR v2 vector was digested with XbaI restriction enzyme, and the MIS18A-specific CRISPR / Cas9 guide RNA was ligated into the vector using T4 ligase to prepare the MIS18A CRISPR / Cas9 vector. The CRISPR / Cas9 guide RNA was synthesized by Sangon Biotech (Shanghai, China). The primer sequences for the MIS18A vector are shown below: Forward (SEQ ID NO: 2): 5'-CTCCATGAGCGAAGACGCGT-3'; Reverse (SEQ ID NO: 3): 5'-GAGGTACTCGCTTCTGCGCACG-3'.

[0036] 3. Cell transfection and infection The MIS18A CRISPR / Cas9 vector and its empty plasmid were transfected with lentiviral packaging plasmids using transfection reagent (L3000015, Invitrogen, USA) into 293T cells (purchased from the Chinese Academy of Sciences Center for Type Culture Collection). Viral fluid was collected at 48h and 72h and used to infect NCI-H1975 cells, resulting in MIS18A knockout and non-knockout NCI-H1975 cell suspensions. A lung adenocarcinoma cell model with MIS18A specific knockout was successfully constructed for subsequent experiments.

[0037] 4. Real-time quantitative PCR (qRT-PCR) Total RNA was extracted from cells in each group using an RNA extraction kit (DP430, Tiangen, China), and the concentration was measured. Then, reverse transcription and amplification reactions were performed using a reverse transcription kit (6215A, TaKaRa, Japan) and a quantitative real-time PCR (qRT-PCR) detection kit (RR420L, TaKaRa, Japan), respectively. The primer sequences used for qRT-PCR detection were synthesized by Sangon Biotech (Shanghai, China). The quantitative primer sequences for MIS18A are shown below: Forward (SEQ ID NO: 4): 5'-GGACACCAACTGCATCCTGCTT-3'; Reverse (SEQ ID NO: 5): 5'-CGTAGCCAAGATTGAGTGAGCAC-3'; b-actin-Forward (SEQ ID NO: 6): 5'-CACCATTGGCAATGAGCGGTTC-3'; b-actin-Reverse (SEQ ID NO: 7): 5'-AGGTCTTTGCGGATGTCCACGT-3'.

[0038] Real-time quantitative PCR analysis of MIS18A knockout expression showed that the CRISPR / Cas9 vector significantly reduced MIS18A expression. Figure 2 A, p<0.0001).

[0039] Example 3: Effect of MIS18A knockout on lung adenocarcinoma cell proliferation 1. Cell counting kit 8 assay (CCK8) Cell viability was estimated using CCK-8 assay to verify the effect of MIS18A knockout on the proliferation of lung adenocarcinoma cells. 100 μL of MIS18A knockout and non-knockout NCI-H1975 cell suspensions were added to each well of a 96-well plate (3599, Corning, USA) and cultured for 24, 48, 72, 96, and 120 hours. Then, 10 μL of CCK-8 solution (C0038, Beyotime, China) was added to each well, and the cells were incubated for another hour. The absorbance at 450 nm was then measured.

[0040] CCK8 assay results showed that the cell viability of H1975 cells after MIS18A knockout was significantly reduced. Figure 2 B, p<0.0001).

[0041] 2. Colony formation experiment The colony-forming ability of cells was assessed using a colony-forming assay to verify the effect of MIS18A knockout on the progression of lung adenocarcinoma cells. NCI-H1975 cell suspensions containing 1000 MIS18A knockout and non-knockout cells were added to 6-well plates (3599, Corning, USA) and cultured using standard methods. After 14 days, the culture medium was removed, and the cells were fixed with 1 mL of 4% paraformaldehyde for 30 min. The 4% paraformaldehyde solution was then removed, and the cells were washed three times with PBS solution and stained with 1 mL of 0.1% crystal violet solution for 30 min.

[0042] Colony formation experiments showed that the colony formation ability of H1975 cells after MIS18A knockout was significantly reduced. Figure 2 C, p<0.0001).

[0043] 3. EdU staining The proliferation activity of H1975 cells after MIS18A knockout was assessed using the 5-ethyl-20-deoxyuridine assay (EdU) kit (Cell Light EdU DNA Imaging Kit), following the instructions in the kit's manual.

[0044] EdU staining results showed that the proliferation level of H1975 cells after MIS18A knockout was significantly decreased. Figure 2 D, p<0.0001).

[0045] 4. Scratch test A wound healing experiment was conducted by making vertical scratches on a single layer of lung adenocarcinoma cells to verify the effect of MIS18A knockout on the migration of lung adenocarcinoma cells. Images were taken under an inverted microscope at 0h, 12h, and 24h after the scratches were made, and the wound area was calculated from three randomly selected microscopic fields.

[0046] Furthermore, we found through scratch assays that the migration ability of H1975 cells knocked out MIS18A was weakened. Figure 2 E). In summary, the results show that MIS18A affects the proliferation and migration of lung adenocarcinoma. Knocking out MIS18A significantly inhibited the progression of lung adenocarcinoma cells, indicating that the MIS18A gene can be used for the development of qPCR screening kits for lung adenocarcinoma patients, prognostic testing products for lung adenocarcinoma treatment efficacy, and targeted drugs for lung adenocarcinoma, playing an important role in the diagnosis, treatment, or prognostic assessment of tumors.

[0047] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent for knocking out the MIS18A gene in the preparation of drugs for treating lung adenocarcinoma, characterized in that, The mRNA sequence of the MIS18A gene is shown in SEQ ID NO: 1; the reagent is a knockout vector of MIS18A constructed using CRISPR / Cas9 technology, and the guide RNA sequence of the vector is shown in SEQ ID NO: 2-3.

Images