InDel molecular marker for identifying homozygous purple green stem mustard and application thereof

Abstract

The present application relates to the technical field of molecular marker assisted breeding, and specifically provides an InDel molecular marker for identifying homozygous purple green stem mustard and application thereof.The InDel molecular marker related to the purple trait of green stem mustard provided by the present application is obtained by amplification with specific primers shown in sequences such as SEQ ID NO.2-3.The InDel molecular marker provided by the present application can be used to distinguish and identify homozygous, heterozygous purple green stem mustard and green green stem mustard, and has accuracy and high efficiency.The InDel molecular marker provided by the present application is used for molecular marker assisted selection in breeding of homozygous purple green stem mustard, and has important significance in actual production.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to an InDel molecular marker for identifying homozygous purple green-stemmed vegetables and its application. Background Technology

[0002] *Brassica campestris* L.ssp.chinensis Makino var. *communis* Tsenet Lee is a variety of the Chinese cabbage subspecies belonging to the genus *Brassica* in the family Brassicaceae. It can be divided into two types based on petiole color: green-stemmed and white-stemmed. Traditional cultivated varieties of *Brassica campestris* have leaves of varying shades of green. *Brassica campestris* has a long history of cultivation in my country and boasts abundant genetic resources. Especially in the Yangtze River basin, it holds an important position among the main leafy vegetable varieties, with year-round production and supply, giving it significant economic value.

[0003] Purple-stemmed mustard greens are a high-end specialty vegetable introduced to the Chinese market in recent years. They are purple due to the abundance of anthocyanins in the edible leaves, which have antioxidant and anti-cancer properties, making them increasingly popular. Purple-stemmed mustard greens have high economic value, and cultivating diverse varieties has become a recent focus for breeders.

[0004] Obtaining homozygous purple-stemmed mustard greens is the primary prerequisite for obtaining the target parent for breeding. Practical work has revealed that it is difficult to distinguish between homozygous and heterozygous purple-stemmed mustard greens through field phenotypic observation. The main reason is that both homozygous and heterozygous purple-stemmed mustard greens have anthocyanin accumulation in their leaves, resulting in a purple upper epidermis, while green-stemmed mustard greens are entirely green. Figure 1 (c).

[0005] Anthocyanins are secondary metabolites of flavonoids. Accumulation in plant tissues can give plants various colors such as purple, red, and blue. In plants, anthocyanins can protect DNA from damage and assist in the plant's defense mechanisms against adverse conditions such as low temperatures and drought. As one of the most important secondary metabolites in plants, anthocyanins not only have physiological functions in plants but also benefit human health. Anthocyanins are antioxidants that help slow down aging and prevent Alzheimer's disease. They are also highly effective free radical scavengers, protecting the body from damage caused by harmful free radicals and helping to prevent various diseases related to free radicals.

[0006] Currently, the localization and functional analysis of genes related to anthocyanin accumulation in Brassica plants have become a research hotspot, and some progress has been made in the study of purple genes in Chinese cabbage. Existing reports indicate that genes regulating the purple trait in Chinese cabbage are located on chromosomes A02, A03, A07, and A09. However, different studies suggest that the regulation of the purple trait in Chinese cabbage varies, involving both qualitative and quantitative traits, indicating that the pathways related to anthocyanin synthesis in Chinese cabbage are quite complex.

[0007] Plant anthocyanin biosynthesis is mainly involved in structural genes and regulatory genes. Structural genes include early biosynthetic genes (EBGs) and late biosynthetic genes (LBGs). The role of regulatory genes in the transcriptional regulation of structural genes has been identified in many plant species, and transcription factors encoded by regulatory genes can regulate the spatiotemporal expression of structural genes. Current research on key genes involved in the regulation of purple and green leaf color and anthocyanin synthesis in *Clerodendrum chinense* has not yet been reported.

[0008] In recent years, marker-assisted selection has become one of the most effective auxiliary techniques in crop molecular breeding, and its application in breeding practice is becoming increasingly widespread. Molecular markers are genetic markers based on the polymorphism of nucleic acids, including traditional RFLP, RAPD, SSR, and AFLP markers, as well as more efficient markers such as SNP and InDel. They have advantages such as a large number of markers, good polymorphism, resistance to interference, and no impact on the expression of target traits. Developing and utilizing molecular markers closely linked to target plant genes allows for accurate selection of individual plants with target traits from large populations, effectively improving the efficiency of breeding work.

[0009] The leaf color of purple-skinned green-stemmed mustard greens is influenced by various conditions, such as temperature and light. Using field observation methods, it is difficult to distinguish between heterozygous and homozygous purple-skinned green-stemmed mustard greens plants with the naked eye. By utilizing marker-assisted selection (MAS), a marker closely linked to the purple leaf trait of green-stemmed mustard greens can be developed. This allows for the screening of homozygous and heterozygous purple-skinned mustard greens during the seedling stage, effectively accelerating the stabilization of homozygous parents. This is of great significance for shortening the breeding process, saving breeding costs, and accelerating the breeding of purple-skinned green-stemmed mustard greens in my country. Summary of the Invention

[0010] This invention identifies a deletion or insertion mutation, a polymorphic marker associated with the leaf color gene of *Gnaphalium affine*, based on resequencing data from *Gnaphalium affine* with purple leaves and common green leaves, as well as sequencing data from F1 hybrids obtained using these two materials as parents and F2 mixed populations obtained through self-pollination of F1. Based on this, this invention develops an InDel molecular marker, the purpose of which is to identify homozygous or heterozygous *Gnaphalium affine* strains by PCR amplification of band differences.

[0011] In a first aspect, the present invention provides an InDel molecular marker gene fragment related to the purple trait of leaves of Chinese cabbage, wherein the polymorphism of the InDel molecular marker gene fragment is a deletion / insertion sequence, which is obtained by amplification using specific primers with sequences as shown in SEQ ID NO.2-3.

[0012] Forward primer: TTCTTGTGCCGAGCATGGAT (SEQ ID NO.2);

[0013] Reverse primer: GTGTGTTTTCAGGACGGTGC (SEQ ID NO.3).

[0014] The nucleotide sequence of the InDel molecular marker gene fragment insertion sequence provided by this invention is shown in SEQ ID NO.1.

[0015] The regions to be amplified covered by the forward and reverse primers shown above are the complete sequences of the homozygous purple leaf color-related gene specific to the present invention, which are closely linked to the purple gene of the green-stemmed vegetable.

[0016] Secondly, the present invention provides specific primer pairs for detecting the above-mentioned InDel molecular marker gene fragments, the sequences of which are shown in SEQ ID NO.2-3.

[0017] Thirdly, the present invention provides a kit containing the above-described specific primer pairs.

[0018] The kit also includes other reagents for PCR amplification, including but not limited to PCR reaction buffer, DNA polymerase, dNTPs, ddH2O, etc.

[0019] Fourthly, the present invention provides the application of the above-mentioned InDel molecular marker gene fragment, the above-mentioned specific primer pair, or the above-mentioned kit in the identification or auxiliary identification of homozygous purple and heterozygous purple traits in the leaves of *Gnaphalium affine*.

[0020] This invention provides the application of the above-mentioned InDel molecular marker gene fragment, the above-mentioned specific primer pair, or the above-mentioned kit in the early screening of seedlings of Chinese cabbage and the prediction of leaf color in mature plants.

[0021] And the application of the above-mentioned InDel molecular marker gene fragment, the above-mentioned specific primer pair, or the above-mentioned kit in the genetic breeding of homozygous purple green-stemmed cabbage.

[0022] The application of the genetic breeding of homozygous purple-leaved green-stemmed cabbage provided by this invention is based on the amplification results of the primer pairs shown in SEQ ID NO.2-3. Homozygous purple-leaved green-stemmed cabbage materials can be screened and obtained for genetic breeding in the early seedling stage of planting.

[0023] Due to the influence of cultivation environment such as temperature and light, it is difficult to accurately distinguish whether a green-stemmed vegetable with purple leaves is a homozygous single plant based solely on field trait observation. Figure 1 a) or heterozygous single plant ( Figure 1 (b) This invention provides an accurate and efficient method for screening homozygous purple green-stemmed vegetables using molecular markers.

[0024] Fifthly, this invention provides a method for identifying homozygous *Gnaphalium affine* as having a purple leaf color trait. The method involves PCR amplification of *Gnaphalium affine* DNA using specific primers with sequences shown in SEQ ID NO. 2-3, followed by agarose gel electrophoresis analysis. If a 1063bp amplification product is present, the *Gnaphalium affine* is identified as homozygous purple; if a 250bp amplification product is present, the *Gnaphalium affine* is identified as green; and if both 250bp and 1063bp amplification products are present, the *Gnaphalium affine* is identified as heterozygous purple.

[0025] In the method for identifying the purple leaf color trait as homozygous green-stemmed cabbage provided by the present invention, the PCR amplification reaction program is as follows: 95℃, 3 min; 95℃, 15 s; 56-60℃, 15 s; 72℃, 20-40 s; 30-35 cycles; 72℃, 5 min; in the PCR amplification reaction system, the concentrations of the forward and reverse primers in the specific primer pair are 10 pmol / μL.

[0026] Preferably, the PCR amplification reaction system is as follows: 5 μL of 2xRapid Taq Master Mix, 0.2 μL of forward primer (10 μM), 0.2 μL of reverse primer (10 μM), 1 μL of gDNA, and 3.6 μL of ddH2O.

[0027] As a specific embodiment of the present invention, and as a preferred embodiment of the present invention, the method for identifying the purple morphology of *Gynostemma pentaphyllum* includes the following steps:

[0028] (1) Extract genomic DNA from the plant samples to be tested.

[0029] (2) PCR amplification was performed using the primers shown in SEQ ID NO.2-3. The presence of a 1063bp product in the PCR amplification product was detected by agarose gel electrophoresis. If a 1063bp amplification product was present, the tested green-stemmed vegetable was identified as homozygous purple green-stemmed vegetable; if a 250bp amplification product was present, the tested green-stemmed vegetable was identified as green green-stemmed vegetable; if both 250bp and 1063bp amplification products were present, the tested green-stemmed vegetable was identified as heterozygous purple green-stemmed vegetable.

[0030] In step (1) above, the plant sample to be tested can be the whole plant or a part of the plant, such as leaves or stems. The present invention preferably uses young leaves of the plant.

[0031] In this invention, "green-stemmed vegetable" refers to the green-stemmed vegetable belonging to the Brassica genus of the Brassicaceae family. "Purple green-stemmed vegetable" refers to the green-stemmed vegetable with purple leaves.

[0032] The PCR amplification products can be detected using conventional techniques in the field, such as electrophoresis and DNA sequencing. This invention preferably uses agarose gel electrophoresis for detection.

[0033] The beneficial effects of this invention are as follows:

[0034] This invention provides an InDel molecular marker associated with the purple trait of leaves in *Gnaphalium affine*. This molecular marker can be used to distinguish and identify homozygous and heterozygous purple *Gnaphalium affine* and green *Gnaphalium affine* with high accuracy. It can be used as a molecular marker-assisted selection tool for breeding homozygous purple *Gnaphalium affine* parents and has important significance in breeding practice. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0036] Figure 1 These are field photographs illustrating the leaf color traits of *Gnaphalium affine* seedlings to be identified in this invention. In the photographs, a represents homozygous purple *Gnaphalium affine*, b represents heterozygous purple *Gnaphalium affine*, c represents green *Gnaphalium affine*, and d represents a field photograph of the F2 segregating population.

[0037] Figure 2 The electrophoresis results of the PCR amplification products of purple homozygous, heterozygous and green green spiny vegetables in Example 2 of the present invention are shown. The DNA marker bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom.

[0038] Figure 3 This is a schematic diagram of the agarose gel electrophoresis results for screening and identifying the F2 generation population material in Example 3 of this invention. The DNA marker bands, from top to bottom, are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0039] Figure 4This is the agarose gel electrophoresis result of a random purple Chinese cabbage sample in Example 4 of the present invention. The DNA marker bands, from top to bottom, are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0041] Example 1: Development of InDel molecular markers associated with homozygous purple trait in Chinese cabbage

[0042] To better and faster screen for homozygous purple green-stemmed vegetable resources and promote molecular marker-assisted selection breeding practices, resequencing data of purple-leaved green-stemmed vegetables and common green-stemmed vegetables, as well as sequencing data of the F2 mixed population of offspring, were analyzed to discover an insertion sequence that causes the leaf color change in green-stemmed vegetables. The insertion sequence is closely linked to the purple gene of green-stemmed vegetables.

[0043] Based on the differential gene fragments found between purple and green *Gnaphalium affine*, a forward primer, InDel BrBur-F (sequence shown in SEQ ID NO.2), and a reverse primer, InDel BrBur-R (sequence shown in SEQ ID NO.3), were designed. *Gnaphalium affine* gDNA was amplified using the forward and reverse primers. The amplified fragment from homozygous purple *Gnaphalium affine* gDNA was 1063 bp in length (sequence shown in SEQ ID NO.1).

[0044] Example 2: Method for identifying leaf color of Chinese cabbage using InDel molecular markers

[0045] This embodiment provides a method for identifying leaf color of *Gnaphalium affine* using the InDel molecular marker from Example 1, as detailed below:

[0046] 1. Extract genomic DNA (gDNA) from the plant samples to be tested;

[0047] (1) Take a sample of a leaf of Chinese cabbage the size of a fingernail and place it in a 2ml centrifuge tube. Add two 4mm steel balls and 200μL LTPS solution.

[0048] (2) Grind the mixture in (1) in a 40Hz grinder for 40s;

[0049] (3) Add 600 μL TPS to a 2 ml centrifuge tube and incubate in a 75 °C water bath for 30 min;

[0050] (4) Centrifuge at 12000 rpm for 10 min;

[0051] (5) Take the supernatant and add an equal volume of isopropanol, and place at -20℃ for more than 0.5h;

[0052] (6) Centrifuge at 12000 rpm for 5 min and discard the supernatant;

[0053] (7) Add 1 ml of 75% alcohol, let stand for 10 min, centrifuge at 12000 rpm for 2 min to remove alcohol, and dry;

[0054] (8) Add 100 μL of ddH2O, mix well, and store at -20°C. The concentration of the DNA to be tested is 100-200 ng / μL.

[0055] 2. PCR amplification

[0056] The PCR amplification reaction system is as follows: 2xRapid Tag Master Mix: 5μL, forward primer F: 0.2μL, reverse primer R: 0.2μL, gDNA: 1μL, ddH2O: 3.6μL.

[0057] The PCR amplification program was as follows: 95℃, 3 min; 95℃, 15 s; 56℃, 15 s; 72℃, 40 s; 35 cycles; 72℃, 5 min.

[0058] 3. Detection and characterization of PCR amplification products

[0059] The PCR amplification products were detected by agarose gel electrophoresis. The steps for agarose gel preparation and electrophoresis are as follows:

[0060] (1) Prepare 1.5% agarose gel

[0061] ① Weigh 1.5g of agarose and add it to 100ml of 0.5% TAE buffer;

[0062] ② Heat until the agarose is completely dissolved, add 7 μL of nucleic acid dye, and mix well;

[0063] ③ Immediately apply the glue and insert the comb;

[0064] ④ Let it stand at room temperature until the agarose gel solidifies.

[0065] (2) Agarose gel electrophoresis

[0066] Electrophoresis was performed using the gel prepared in (1) under the following conditions: 140V for 20min. The presence of a 1063bp amplification product was determined. If a 1063bp amplification product was present, the tested *Gnaphalium affine* was identified as homozygous purple *Gnaphalium affine*; if a 250bp amplification product was present, the tested *Gnaphalium affine* was identified as green *Gnaphalium affine*; if both 250bp and 1063bp amplification products were present, the tested *Gnaphalium affine* was identified as heterozygous purple *Gnaphalium affine*. Figure 2 ).

[0067] Example 3: Identification of leaf color in *Gnaphalium affine* materials used in BSA-seq using InDel molecular markers.

[0068] Forty-nine seedlings of *Chlorophytum comosum* were randomly selected from populations P1 (homozygous purple *Chlorophytum comosum* parent), P2 (homozygous green *Chlorophytum comosum* parent), F1 (obtained by crossing P1 and P2), and F2 (self-crossed F1) for identification using the method described in Example 2. PCR amplification was performed using gDNA from different *Chlorophytum comosum* leaf materials as templates and primers shown in SEQ ID NO. 2-3. Electrophoresis results are shown below. Figure 3 As shown, 9 of the materials (numbered 1, 2, 8, 14, 15, 30, 34, 37, and 38) all had PCR products of 1063 bp in length, consistent with the characteristics of homozygous purple green-stemmed vegetables; 8 of the materials (numbered 3, 4, and 44-49) had PCR products of 250 bp in length, consistent with the characteristics of green green-stemmed vegetables; and 32 of the materials (numbered 5-7, 9-13, 16-29, 31-33, 35, 36, and 39-43) had PCR products of both 250 bp and 1063 bp in length, consistent with the characteristics of heterozygous purple green-stemmed vegetables.

[0069] The molecular marker identification results were compared with the actual plants and leaf color identification. The results showed that plants 1 and 2 were purple DH lines and homozygous materials; plants 8, 14, 15, 30, 34, 37, and 38 were F2 generation plants with purple leaves. The agarose gel electrophoresis results were consistent with the homozygous purple DH lines numbered 1 and 2, and they were identified as homozygous purple DH lines; plants 3 and 4 were homozygous green-leaved DH lines of higher generation; plants 44-49 were F2 generation plants with green leaves and green DH phenotypes. The agarose gel electrophoresis results were consistent with the green leaf phenotype. Plants numbered 5 and 6 are F1 generation plants, which are heterozygous purple-skinned *Gnaphalium affine*. Agarose gel electrophoresis results are consistent with those of heterozygous purple-skinned *Gnaphalium affine*. Materials 7, 9-13, 16-29, 31-33, 35, 36, and 39-43 are F2 generation single plants, exhibiting purple leaves. Agarose gel electrophoresis results are consistent with those of single plants 5 and 6, and they are identified as heterozygous purple-skinned *Gnaphalium affine*. Therefore, InDel BrBur-F and InDel BrBur-R can be used as markers to accurately distinguish whether the leaf color of *Gnaphalium affine* materials is homozygous, heterozygous purple, or green.

[0070] Example 4: Identification of the purchased and introduced *Gnaphalium affine* resources and other purple *Gnaphalium affine* species using InDel molecular markers.

[0071] Eight samples of purple and green purslane were identified using the method in Example 2. They were numbered 1 to 8. Sample 7 was a commercial variety of purple purslane produced by Zhangzhou Xiangcheng Junde Seed Co., Ltd., and sample 8 was a commercial variety of purple purslane produced by Zhangzhou Xiangcheng Junde Seed Co., Ltd., purchased from the market.

[0072] Using gDNA from leaf materials at different seedling stages of *Bufo gargarizans* as templates, PCR amplification was performed using primers shown in SEQ ID NO. 2-3. Electrophoresis results are as follows: Figure 4 As shown: 6 of the materials (numbered 1, 3-7) had PCR products of 1063 bp in length and were identified as homozygous purple green-stemmed vegetable; 1 material (numbered 2) had a PCR product of 250 bp in length and was identified as green green-stemmed vegetable; 1 material (numbered 8) had PCR products of approximately 250 bp and 1063 bp in length and was identified as heterozygous purple green-stemmed vegetable.

[0073] Comparing the molecular marker identification results with the leaf color phenotypes of the plants in the field, the results showed that numbers 1 and 3-6 belonged to the DH line of purple-stemmed cauliflower ( ). Figure 4 Number 2 is a high-generation inbred line of *Vigna oleifera* with green leaves and stems. Numbers 7 and 8 are purple *Vigna oleifera* introduced from the market. Identification determined that number 7 is a homozygous purple *Vigna oleifera* introduced from the market, and number 8 is a heterozygous purple *Vigna oleifera* introduced from the market. Therefore, InDel BrBur-F and InDel BrBur-R can be used for the identification of purple *Vigna oleifera* purchased from the market, serving as screening markers to distinguish between homozygous and heterozygous purple *Vigna oleifera* resources introduced from the market.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of primer pairs for amplifying the sequence shown in SEQ ID NO. 1 in the identification or auxiliary identification of the purple trait of *Gnaphalium affine*, characterized in that, The primer pair was used to detect whether the sequence shown in SEQ ID NO. 1 existed in the genome of *Gnaphalium affine*. If it existed, it was *Gnaphalium affine* var. *purple*.

2. The application of the specific primer pairs shown in SEQ ID NO. 2-3 or a kit containing such primer pairs in the identification or auxiliary identification of the purple trait of *Clerodendrum trichotomum*, characterized in that, The specific primer pairs shown in SEQ ID NO. 2-3 are used to detect whether the sequence shown in SEQ ID NO. 1 exists in the genome of *Gnaphalium affine*. If it exists, it is *Gnaphalium affine* var. *purple*.

3. A method for identifying homozygous green-stemmed vegetable with purple leaf color, characterized in that, The DNA of *Gnaphalium affine* was amplified by PCR using specific primers with sequences as shown in SEQ ID NO. 2-3. If only the 1063bp amplification product shown in SEQ ID NO. 1 was present, the *Gnaphalium affine* to be tested was identified as homozygous purple *Gnaphalium affine*.

4. The method according to claim 3, characterized in that, The PCR amplification reaction program is as follows: 95℃, 3 min; 95℃, 15 s; 56-60℃, 15 s; 72℃, 20-40 s; 30-35 cycles; 72℃, 5 min; In the PCR amplification reaction system, the concentration of the forward and reverse primers in the specific primer pair is 10 pmol / μL.

5. The application of specific primer pairs with sequences as shown in SEQ ID NO. 2-3, or kits containing such primer pairs, in predicting leaf color at the mature stage of *Clerodendrum trichotomum* seedlings, characterized in that... The presence of the sequence shown in SEQ ID NO. 1 in the genome of *Gnaphalium affine* indicates that it is purple *Gnaphalium affine*.

6. The application of specific primer pairs with sequences as shown in SEQ ID NO. 2-3, or kits containing such primer pairs, in the genetic breeding of homozygous purple-stemmed cabbage, characterized in that, The DNA of *Gnaphalium affine* was amplified by PCR using specific primers with sequences as shown in SEQ ID NO. 2-3. If only the 1063bp amplification product shown in SEQ ID NO. 1 was present, the *Gnaphalium affine* to be tested was identified as homozygous purple *Gnaphalium affine*.

7. The application according to claim 6, characterized in that, Based on the amplification results of the primer pairs shown in SEQ ID NO.2-3, homozygous purple green-stemmed cabbage can be identified and screened at the seedling stage for genetic breeding.

Images