Lactococcus garviae y3, a high lipase-producing starter culture and its application in cheese
Patent Information
- Application Number
- CN202310948034.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-31
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2043-07-31
AI Technical Summary
当前尚未有专门开发针对强化干酪内酯类风味化合物的辅助发酵剂,辅助发酵剂可以显著改善干酪的风味和品质,并且能够有效地促进干酪的成熟,从而降低生产成本
[0018]与现有技术相比,本发明的有益技术效果体现在以下方面:
Smart Images

Figure CN117247861B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a high-lipase-producing Lactococcus gasseri Y3, a starter culture agent, and its application in cheese. Background Technology
[0002] Cheese is a fermented dairy product with high nutritional value, made from milk through processes such as concentration and fermentation. In the past five years, with the rise of downstream demand and increased investment from domestic enterprises, cheese consumption in my country has shown rapid growth. However, compared horizontally, my country's per capita cheese consumption is far lower than that of other countries; at the same time, my country's cheese research and production are still in their initial stages, and the market supply heavily relies on imports. Therefore, the development of my country's cheese industry has enormous potential and is urgently needed.
[0003] Flavor is one of the important standards for cheese product quality and a crucial factor in determining consumer purchasing decisions. Currently, hundreds of aroma compounds have been identified in cheese, mainly including alcohols, aldehydes, ketones, esters, and lactones. Among these, lactones, while typically present in low concentrations in cheese, impart characteristic flavors such as fruit and milkiness. They also harmonize with other volatile components, resulting in a smoother overall flavor, making them one of the key aroma compounds in cheese and thus attracting considerable attention from researchers. Typical lactone compounds in cheese include... γ -Butyrolactone, δ -octyl lactone, δ The formation of β-decalactones and similar compounds mainly involves the breakdown of triglycerides into fatty acids under the action of lipases. These fatty acids, as precursors for lactone formation, undergo β-oxidation and cyclization to generate lactone compounds. Therefore, by altering the lipase content in cheese production, the formation of lactone compounds in the original cheese product can be affected. Lipases in cheese production can be added exogenously or endogenously enhanced using lipases produced by strains in the starter culture. The latter, compared to exogenous addition, has attracted considerable attention due to its advantages of easier strain cultivation, a wider variety of lipases produced, higher substrate selectivity, and fewer byproducts.
[0004] Therefore, the role of lactic acid bacteria with high lipase production capacity in cheese production cannot be ignored. Currently, there are no specially developed starter cultures for enhancing the flavor compounds of cheese, which can significantly improve the flavor and quality of cheese and effectively promote its maturation, thereby reducing production costs. Therefore, screening for lactic acid bacteria with high lipase production and preparing starter cultures containing these bacteria has great potential and development space in improving the flavor of cheese containing lactones. Summary of the Invention
[0005] The technical problem to be solved by the present invention is that: in the prior art, there is a lack of high-quality lactic acid bacteria with excellent lipase-producing performance, and the contribution of lactic acid bacteria to casein compounds is unknown; in addition, the content of casein flavor compounds in the prior art is low and the maturation time is long.
[0006] To solve the above-mentioned technical problems, the present invention provides a high-lipase-producing Lactococcus gasseri (Lactococcus gasseri). Lactococcus garvieae Y3, Auxiliary fermentation agent and its application in cheese.
[0007] The Lactococcus gasseri provided by this invention ( Lactococcus garvieae Y3 has a high capacity for producing lipase, which can promote the breakdown of triglycerides and thus affect the formation of lactone compounds in cheese.
[0008] The objective of this invention can be achieved through the following technical solutions: This invention first provides a Lactococcus gasseri that produces a high level of lipase. Lactococcus garvieae Y3, its biological name is: Lactococcus garvieae The specimen, classified and named Lactococcus gasseri, was deposited on January 3, 2023, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan, Hubei Province, 430072, China, with accession number CCTCC M 2023007.
[0009] The *Lactococcus gasseri* Y3 provided by this invention produces lipase with an enzyme activity of 1.46 ± 0.26 U / mL. In cheese matured for 120 days, it reduces the total content of lactone flavor compounds compared to cheese without *Lactococcus gasseri*. Lactococcus garvieae The cheese content of Y3 increased from 76.02 μg / kg to 640.86 μg / kg.
[0010] This invention also provides Lactococcus gasseri ( Lactococcus garvieae The 16S rRNA of Y3 has the nucleotide sequence shown in SEQ ID NO.1.
[0011] The present invention also provides a product containing the aforementioned Lactococcus gasseri ( Lactococcus garvieae Y3 is an auxiliary fermentation agent.
[0012] The present invention also provides a method for preparing the auxiliary fermentation agent, comprising the following steps: Step 1): Take Lactococcus gasseri ( Lactococcus garvieae Streak Y3 culture medium on agar plates and incubate at 28-32℃ for 24-48 h until single colonies grow. Step 2): Pick the single colony and culture it in MRS broth until the concentration reaches 1×10⁻⁶. 9The concentration of CFU / mL was increased, and the culture conditions were 35-38℃ for 14-16 h. The resulting culture medium was washed twice with physiological saline and then suspended in physiological saline.
[0013] In one embodiment of the present invention, the culture medium mentioned in step 1) is MRS agar medium.
[0014] In one embodiment of the present invention, the mass concentration of the physiological saline in step 2) is 0.85%, and the washing method is: controlling the rotation speed at 6000-8000 r / min, preferably 8000 r / min, and centrifuging for 5-10 min.
[0015] The present invention further provides the aforementioned Lactococcus gasseri ( Lactococcus garvieae The application of Y3 or auxiliary fermentation agents in the preparation of cheese.
[0016] In one embodiment of the present invention, the application is specifically as follows: pasteurized milk is fed into a cheese jar, a starter culture is added, and the mixture is matured at 31°C for 30 minutes. When the pH value of the pasteurized milk drops by 0.4, rennet is added to coagulate the milk for 40 minutes. After cutting, the mixture is blanched at 39°C. Next, a groove is left in the middle of the cheese vat, and cheese granules are placed on both sides of the groove to remove whey; 38°C warm water is poured into the jacket of the cheese jar, and the cheese jar is covered to ensure the temperature; as the acidity rises and the curd coagulates into blocks, the curd is cut into 30 cm cubes; the cheese blocks are piled together and turned over every 15 minutes. Cut the curd into 1 cm cubes, add sterile sodium chloride solution to the cheese and stir, then add Lactococcus gasseri (Lactococcus gasseri). Lactococcus garvieae Y3 or containing Lactococcus gasseri ( Lactococcus garvieae Y3, an auxiliary fermenting agent, is pressed into molds, vacuum-packed, and matured at a constant temperature of 4-14℃ for 120 days to obtain a product containing Lactococcus gasseri (Y3). Lactococcus garvieae Y3 cheese.
[0017] The present invention also provides Lactococcus gasseri containing the aforementioned Lactococcus gasseri ( Lactococcus garvieae Cheese made with Y3 or a starter culture. The Lactococcus gasseri (… Lactococcus garvieae Y3, or a starter culture aid, can increase the content of lactone flavor compounds in cheese. In cheese fermented solely by Lactococcus gasseri Y3 during the first 60 days of ripening, it produces... δ -octyl lactone, γ β-Butyrolactone, with contents ranging from 10.11 μg / kg to 111.80 μg / kg and from 5.45 μg / kg to 69.24 μg / kg, respectively.
[0018] Compared with the prior art, the beneficial technical effects of the present invention are reflected in the following aspects: (1) The Lactococcus gasseri of the present invention ( Lactococcus garvieae Y3, fermented in MRS medium for 48 h, produces lipase with an enzyme activity of 1.46 ± 0.26 U / mL, which can be used to break down triglycerides during cheese ripening and promote the formation of lactones. In *Lactococcus gasseri* (… Lactococcus garvieae With the addition of Y3 compared to the absence of Lactococcus gasseri ( Lactococcus garvieae Cheese fermented with Y3 only produces [a specific product] 60 days before maturity. δ -Octinolone (10.11 μg / kg-111.80 μg / kg) and γ -Butyrolactone (5.45 μg / kg-69.24 μg / kg), without the addition of Lactococcus gasseri ( Lactococcus garvieae Y3 cheese begins to accumulate fat after 90 days of maturation. δ - Octyl lactone (7.94 μg / kg - 26.46 μg / kg) and γ Butyrolactone (9.87 μg / kg - 21.76 μg / kg). The total lactone content of cheese products matured at 14°C for 120 days (640.86 μg / kg) was lower than that of cheese products without the addition of Lactococcus gasseri (Lactococcus gasseri). Lactococcus garvieae The total lactone content of Y3 cheese (76.02 μg / kg) increased by 8.43 times, improving the flavor and quality of the cheese and showing great promise in the cheese production field.
[0019] (2) The Lactococcus gasseri of the present invention ( Lactococcus garvieae Y3 has acid and salt resistance, and a high degree of autosolubility. It is highly adaptable to fermentation environments and can be used for cheese production.
[0020] (3) The present invention contains Lactococcus gasseri ( Lactococcus garvieae Y3 cheese can significantly increase the types and content of lactone compounds without the need for exogenous lipase addition, thereby improving the aroma quality of the product and showing broad prospects in the cheese product industry. Attached Figure Description
[0021] Figure 1 Lactococcus gasseri ( Lactococcus garvieae Results of preliminary screening test of Y3 neutral red oil and glyceryl tartrate on plate; Figure 2 Lactococcus gasseri ( Lactococcus garvieae Electrophoresis diagram of PCR products of Y3 16S rDNA; Figure 3 Lactococcus gasseri ( Lactococcus garvieaeY3 is a phylogenetic tree based on the 16S rRNA gene; Figure 4 To determine the incubation time for Lactococcus gasseri ( Lactococcus garvieae The effect of Y3 on lipase production; Figure 5 To determine the effect of culture temperature on Lactococcus gasseri ( Lactococcus garvieae The effect of Y3 on lipase production; Figure 6 For the inoculum amount of Lactococcus gasseri ( Lactococcus garvieae The effect of Y3 on lipase production; Figure 7 To study the effects of different pH and salt concentrations on Lactococcus gasseri (Lactococcus gasseri) Lactococcus garvieae The effect of Y3 on lipase production; Figure 8 Lactococcus gasseri based on the casein model ( Lactococcus garvieae )Y3 lactone content graph; Figure 9 For bacteria containing Lactococcus gasseri at different maturation times and temperatures ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae )Graph showing the total lactone content in cheese Y3; Figure 10 For bacteria containing Lactococcus gasseri at different maturation times and temperatures ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae ) Content of different lactone compounds in Y3 cheese; Figure 11 The presence of Lactococcus gasseri at different temperatures on day 0 of maturity ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae Sensory evaluation results of Y3 cheese.
[0022] Figure 12 The presence of Lactococcus gasseri at different temperatures after 30 days of maturation ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae Sensory evaluation results of Y3 cheese.
[0023] Figure 13 The presence of Lactococcus gasseri at different temperatures during 60 days of maturation ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae Sensory evaluation results of Y3 cheese.
[0024] Figure 14 The presence of Lactococcus gasseri at different temperatures after 90 days of maturation ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae Sensory evaluation results of Y3 cheese.
[0025] Figure 15 The presence of Lactococcus gasseri at different temperatures after 120 days of maturation ( Lactococcus garvieae Y3 and does not contain Lactococcus gasseri ( Lactococcus garvieae Sensory evaluation results of Y3 cheese. Detailed Implementation
[0026] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.
[0027] Lactococcus gasseri used in various embodiments of the present invention ( Lactococcus garvieae Y3, its biological name is: Lactococcus garvieae The specimen, classified and named Lactococcus gasseri, was deposited on January 3, 2023, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan, Hubei Province, 430072, China, with accession number CCTCC M 2023007.
[0028] The sterile physiological saline solution used in the various embodiments of the present invention contains 8.5 g of sodium chloride per liter, with the remainder being distilled water. It is sterilized at 121°C for 20 min, cooled, and stored at 4°C for later use. The preparation method is as follows: Weigh 8.5 g of sodium chloride, dilute to 1 L with distilled water, sterilize at 121°C for 20 min, cool, and store at 4°C to obtain sterile physiological saline solution.
[0029] The primary screening medium used in this invention for screening and isolating high-lipase-producing strains contains, per liter: 20 g olive oil emulsion, 10 g peptone, 10 g beef meal, 5 g yeast powder, 0.1 g magnesium sulfate, 5 g sodium acetate, 2 g ammonium citrate, 2 g potassium dihydrogen phosphate, 0.05 g manganese sulfate, 1.5 g agar powder, 1 g neutral red, and 1000 mL distilled water. The pH value is 7.0. The medium is sterilized at 121°C for 20 min to obtain the primary screening medium.
[0030] The tributyric acid glyceride culture medium used in this invention for screening and isolating high-lipase-producing strains is prepared as follows: 100 mL of 100 g / L tributyric acid glyceride, 900 mL of Tris-HCl buffer (pH = 8.0), and 20.0 g of agar are sterilized at 121°C for 20 min to obtain the tributyric acid glyceride culture medium.
[0031] The enzyme-producing culture medium used in this invention to determine lipase activity contains, per liter: 20 g olive oil emulsion, 10 g peptone, 10 g beef meal, 5 g yeast powder, 0.1 g magnesium sulfate, 5 g sodium acetate, 2 g ammonium citrate, 2 g potassium dihydrogen phosphate, 0.05 g manganese sulfate, and 1000 mL distilled water, with a pH of 7.0. The medium is sterilized at 121°C for 20 min to obtain the enzyme-producing culture medium.
[0032] The olive oil emulsion used in this invention for screening high-lipase-producing strains and determining lipase activity is prepared as follows: Weigh 1.4 g of Tween-80, then add 13.2 g of deionized water while stirring until homogeneous. Dissolve the solution in an 80°C water bath until it becomes transparent. Then add 4 g of olive oil and 1.4 g of Span-80. Homogenize the mixture for 20 min until it becomes a milky white, homogeneous emulsion. Note that the mixture should be prepared fresh for use.
[0033] Example 1 The collection and isolation of a high-lipase-producing lactic acid bacterium Y3 were carried out according to the following steps: (1) Sample collection Samples were taken from the brine of fermented stinky tofu produced in Shanghai. The collected samples were placed in an ice box and refrigerated at a low temperature. They were then brought back to the laboratory and placed in a 4°C refrigerator to isolate the lactic acid bacteria as soon as possible. (2) Sample pretreatment Take 10 mL of liquid sample and put it into a 250 mL Erlenmeyer flask (containing glass beads) containing 90 mL of sterile water. Shake and let stand for 20 min. (3) Isolation of lactic acid bacteria strains The pretreated samples were serially diluted with sterile water at a volume ratio of 1:10. 0.1 mL of each diluted sample was plated onto MRS agar plates and incubated at 37°C under facultative anaerobic conditions for 24 hours. - After 48 hours, use a sterile toothpick to pick up a single colony that is round, medium-sized, raised, slightly white, moist, with neat edges and a diameter of 3 mm ± 1 mm. Then, streak the bacteria on the corresponding agar plates to obtain pure single colonies, i.e., purified strains, and perform Gram staining. The purified strains were preserved in the appropriate isolation medium with 30% glycerol added as a protectant and frozen at -20°C. The MRS agar medium used on the above-mentioned MRS agar plates was a lactic acid bacteria selective medium, which was purchased from Beijing Luqiao Company.
[0034] Fourteen strains isolated from the brine exhibited filamentous, viscous, and mucous-like appearances on MRS agar medium.
[0035] (4) Initial screening of lipase-producing strains The strains obtained above were screened based on their ability to produce lipase. The specific steps are as follows: Lactic acid bacteria screened on MRS agar medium were cultured to the logarithmic phase using MRS liquid medium. The bacterial suspension was obtained by vortex mixing. 20 μL of the suspension was accurately measured and spread evenly on the primary screening medium. The suspension was then incubated at 37°C for 24-48 h. The presence of red discolored colonies was observed on the primary screening medium.
[0036] Make 0.8 cm wells on tributylate agar plates. Accurately measure 100 μL of the MRS culture of the discolorating colonies, vortex to homogenize, and inoculate the culture into different wells on the agar plates. Then incubate at 37°C for 24-48 h, observing whether oil droplets appear on the agar plates. The preliminary screening results are as follows: Figure 1 As shown in Table 1, 8 strains of lactic acid bacteria exhibited good color-changing ability on neutral red plates, and 14 strains of lactic acid bacteria formed transparent rings and hydrolyzed oil flowers on tributylate planes. It can be seen that the lipases produced by the above strains can effectively degrade long-chain substrates of olive oil (C18) and medium- and short-chain substrates of tributylate (C4).
[0037] Table 1. Initial screening results of lipase-producing lactic acid bacteria
[0038] (5) Determination of enzyme activity of lipase-producing strains The Y2 and Y3 strains, which exhibited excellent enzyme production, were inoculated into 10 mL of MRS broth medium and cultured at 37°C for 24 h. Subsequently, they were inoculated into 10 mL of olive oil medium at a 2% (v / v) inoculation rate and cultured at 37°C for 24 h to obtain the corresponding fermentation broths. One mL of the fermentation broth was centrifuged at 5120 × g at 4°C for 10 min to obtain the supernatant crude enzyme solution. Lipase (LPS) activity was measured using a lipase activity assay kit (Shanghai Sangon Biotech Co., Ltd.). The enzyme activity calculation formula is as follows:
[0039] In the formula: T, catalytic reaction time; m, dilution factor of fermentation broth.
[0040] The activity of lipases produced by lactic acid bacteria Y2 and Y3 was determined using the copper soap method. The results showed that the lipase produced by strain Y3 had a high enzyme activity of 1.46 ± 0.26 U / mL.
[0041] The lipase produced by strain Y3 has a high activity, greater than 1,000 U / mL, and can be used for further research.
[0042] Example 2 The high-lipase-producing lactic acid bacteria strain Y3 obtained in Example 1 was subjected to microbiological identification.
[0043] (1) Colony characteristics The strain was streaked on an MRS plate for isolation and anaerobic culture at 30°C for 48 h. The strain grew well, and its colonies were round, raised, with neat edges, milky white color, opaque, moist and smooth surface, and could be drawn into threads when picked up.
[0044] (2) Characteristics of bacterial cell morphology Gram staining was performed on strain Y3. The results showed that the bacteria were non-motile spherical, mostly arranged in chains of varying lengths, and also scattered individually. The bacteria were generally 0.6 μm × 1.5 μm in size, did not produce spores, and were Gram-positive.
[0045] (3) Physiological and biochemical identification The strain is peroxidase negative.
[0046] (4) Genetic identification of lipase-producing strains The high-lipase-producing strain Y3 obtained from the initial screening was further identified using molecular biology techniques, including PCR amplification of genomic DNA and 16S rRNA sequence detection. The DNA of the 14 lipase-producing strains was amplified by PCR, and the amplification products were subjected to agarose gel electrophoresis. The amplified bands were observed under a gel imaging system. The imaging results are as follows: Figure 2 As shown, the band of strain Y3 is clear and around 1500 bp.
[0047] Purified Y3 single colonies were picked and inoculated into 10 mL of MRS liquid medium. After incubation at 30°C for 15 h, the bacterial culture was centrifuged (4000 r / min, 15 min) to collect the bacterial pellet. Genomic DNA was extracted from the obtained bacterial cells using a genomic DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). PCR amplification was performed using two synthetic universal primers (16S 27F: GAGAGTTGATCCTGGCTCAG; 16S 1492R: CGGCTACCTTGTTACGACTT). The PCR products were recovered using a column-based PCR product purification kit (Sangon Biotech (Shanghai) Co., Ltd.) and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0048] The 16S rRNA nucleotide sequence of the obtained strain is shown in SEQ ID NO.1, specifically: Using the National Center for Biotechnology Information (NCBI) database, the obtained nucleotide sequences were subjected to GenBank sequence homology comparison using BLAST. A phylogenetic tree based on the 16S rRNA gene was constructed using MEGA 11.0 software to compare the sequences of the tested strain with those of other strains within the same genus. Figure 3 As shown. Through BLAST comparison analysis, among the strains preliminarily identified as having lipase-producing ability, Y3 and... Lactococcus garvieae NIZO2415T showed the highest homology (99%), therefore strain Y3 could be identified as *Lactococcus gasseri*. Lactococcus garvieae ).
[0049] Example 3 Lactococcus gasseri ( Lactococcus garvieae Enzyme production characteristics analysis of Y3 (1) Optimal culture time for lipase production by the strain Lactococcus gasseri Y3 was inoculated into 10 mL of MRS broth and cultured at 37°C for 24 h. Then, it was inoculated into enzyme-producing medium at a rate of 2% (v / v). Crude enzyme solution was collected every 12 h, and absorbance was measured at 710 nm. Lipase activity was determined according to the method in Example 1 to determine the optimal culture time for enzyme production. Results are as follows: Figure 4 As shown, the lipase activity of Lactococcus gasseri Y3 reached its highest level of 1.318 U / mL after 48 h of culture, and then gradually decreased. Therefore, 48 h of culture was selected as the optimal culture time.
[0050] (2) Optimal culture temperature for lipase production by the strain Lactococcus gasseri Y3 was inoculated into 10 mL of MRS broth and incubated at 37°C for 24 h. Then, it was transferred to 50 mL of enzyme-producing medium at a 2% (v / v) inoculation rate and incubated at 25°C, 30°C, 37°C, 40°C, and 45°C for 48 h, respectively. Lipase activity was then measured. Results are as follows: Figure 5 As shown, the enzyme activity of *Lactococcus gasseri* Y3 gradually increases with increasing temperature. When the culture temperature reaches 30℃, *Lactococcus gasseri* Y3 strain reaches its optimal lipase activity of 1.865 U / mL, which then gradually decreases. Therefore, the optimal culture temperature for enzyme production by *Lactococcus gasseri* is 30℃.
[0051] (3) Optimal inoculum size for lipase production by the strain Lactococcus gasseri Y3 was inoculated into 10 mL of MRS broth and incubated at 37°C for 24 h. Then, it was transferred to 50 mL of enzyme-producing medium at inoculation rates of 0.5%, 1%, 2%, 4%, and 6% (v / v), respectively, and incubated at 30°C for 48 h. Lipase activity was then measured. Results are as follows: Figure 6 At an inoculum size of 2% (v / v), Lactococcus gasseri Y3 produced the highest lipase activity, at 1.988 U / mL.
[0052] (4) Acid and salt tolerance of the strain After two generations of continuous activation of *Lactococcus gasseri* Y3 using MRS liquid medium, the bacteria were washed twice with phosphate buffer and then transferred at a 2% (v / v) inoculation rate to MRS broth with NaCl concentrations of 0%, 2%, 4%, and 6%. The cultures were incubated at 37°C for 24 h, and the absorbance at 600 nm was measured every 3 h at different salt concentrations, recorded as OD. 600 The bacterial suspension in phosphate buffer was mixed with MRS culture medium at pH values of 4.0, 5.0, and 6.0, and incubated at 37°C for 24 h. The OD of the strains was measured within 24 h. 600 The result is as follows Figure 7 As shown, Lactococcus gasseri Y3 can grow under all pH and salt concentration conditions.
[0053] (5) Determination of bacterial autolysis Lactococcus gasseri Y3 was inoculated into MRS medium at a 2% (v / v) inoculum and incubated at 37°C for 24 h to activate it. The culture was then centrifuged at 4650 × g for 15 min at 4°C to obtain bacterial pellet. The pellet was then resuspended in phosphate buffer (0.05 mol / L, pH 7.0), with the phosphate buffer used as a control, and the initial OD of the initial suspension was adjusted. 600 The absorbance was approximately 1.0, denoted as OD0. The suspension and control were incubated at 30℃ for 24 h, and the absorbance OD0 was measured at 600 nm. 24 The method for calculating bacterial cell autolysis: Autolysis (%) = OD0 - OD 24 / OD0 100%. The autolysis rate of Lactococcus gasseri Y3 is 21.08%, which is moderate, indicating that it can rapidly release intracellular enzymes for metabolic reactions.
[0054] Example 4 Lactococcus gasseri based on the rapid maturation model of cheese paste ( Lactococcus garvieae Performance analysis of lactone-producing compounds of Y3 Lactococcus gasseri ( Lactococcus garvieaeY3 was inoculated into 10 mL of MRS broth and cultured at 37°C for 24 h. Then, it was transferred to 50 mL of enzyme-producing medium at a 2% (v / v) inoculation rate and cultured at 37°C for 24 h. The fermentation broth was then transferred to centrifuge tubes and centrifuged at 4°C and 9100 ×g for 10 min. The precipitate was washed twice with 0.85% physiological saline to obtain the auxiliary fermentation agent.
[0055] After heating the pasteurized milk to 30°C in a water bath, its pH value was measured and recorded as pH1. Then, 1% (w / w) of commercial starter culture was added to the pasteurized milk, stirred thoroughly, and matured at 30°C for 30 minutes to complete the maturation and fermentation process. The pH value after maturation was then measured and recorded as pH2. When the difference between pH1 and pH2 was greater than 0.4, 1.5% (w / w) of rennet was added, stirred thoroughly, and allowed to stand for 40 minutes. After the pasteurized milk coagulated, it was cut into curd-like shapes, and the water bath heating continued during the cutting process, increasing the temperature by 1°C every 5 minutes until it reached 38°C. The whey was then drained, and the curd was cut into 30 cm × 30 cm blocks. The cheese blocks were piled together and turned over every 15-20 minutes, repeated 2-3 times to complete the curd curd fermentation.
[0056] 100 g of the above-mentioned cheese curd was placed into sterile vacuum bags. The control group received 50 mL of 5% sterile sodium chloride solution, while the experimental group received 47 mL of 5% sterile sodium chloride solution and 3 mL of auxiliary fermentation agent. The mixtures were stirred into a slurry and then vacuum-sealed. Both the control and experimental groups were matured at a constant temperature of 30℃. Samples were taken at 0, 3, 6, 9, and 12 days for analysis of lactone flavor compounds.
[0057] The results are as follows Figure 8 As shown, it contains Lactococcus gasseri ( Lactococcus garvieae Compared with the control group, the Y3 auxiliary starter group enriched the types of lactone compounds in the fermented cheese pulp samples and promoted the fermentation of cheese pulp samples. γ -Butyrolactone, δ - Production of octyl lactones. After 12 days of maturation, the total concentration of lactone compounds in the experimental group's cheese pulp samples was significantly higher than that of the control group by 2.21 times. Therefore, *Lactococcus gasseri* (Lactococcus gasseri) was obtained, demonstrating strong adaptability to the fermentation environment and significantly improving the lactone flavor of cheese. Lactococcus garvieae Y3 and its fermentation agent.
[0058] Example 5 Contains Lactococcus gasseri ( Lactococcus garvieae The preparation of Y3 cheese includes the following steps: Pasteurized milk is poured into cheese jars and heated to 31°C. A starter culture (1%, w / w) is added, and the mixture is then matured at 31°C for 30 minutes. When the pH of the pasteurized milk drops to 0.4, rennet (1.5%, w / w) is added. After coagulation for 40 minutes, the mixture is cut and heated to 39°C at a rate of 1°C every 10 minutes. A groove is then left in the center of the cheese vat, and cheese granules are arranged on both sides of the groove to drain the whey. Simultaneously, 39°C warm water is poured into the jacket of the cheese jar, and the jar is covered to maintain the temperature. As the acidity increases, the curd solidifies into blocks, which are then cut into 30 cm cubes. The cheese blocks are piled together and turned every 15 minutes. The curd blocks are then cut into 1 cm cubes. A NaCl solution (2.5%, w / w) is evenly sprinkled onto the cheddar cheese and stirred. An auxiliary starter culture (i.e., the lactic acid bacteria described in this patent, obtained by centrifugation, with a bacterial concentration of 1×10⁻⁶) is added. 9 The cheese containing Lactococcus gasseri Y3 was obtained by pressing the cheese into molds at a concentration of CFU / mL (0.8%, v / v) and vacuum packaging it. The cheese was then matured at constant temperatures of 4℃, 10℃, and 14℃ for 120 days.
[0059] Comparative Example 1 A type that does not contain Lactococcus gasseri ( Lactococcus garvieae The preparation of Y3 cheese includes the following steps: Similar to the steps in Example 5, except that no auxiliary fermentation agent is added after the cheese has finished composting, it is directly pressed and vacuum-packed, and then matured for 120 days under constant temperature conditions of 4℃, 10℃, and 14℃ to obtain cheese that does not contain the corresponding Lactococcus gasseri Y3.
[0060] Example 1 Comparison of the ability of cheeses prepared in Example 5 and Comparative Example 1 to produce lactone flavor compounds after maturing at 4°C, 10°C, and 14°C for 120 days.
[0061] Headspace solid-phase microextraction (HS-SPME) was used to extract lactones from cheese. 5.0 g of cheese samples prepared in Example 5 and Comparative Example 1 were accurately weighed, crushed, and placed in extraction flasks. 100 μL of 220 mg / L 2-octanol was added, and the mixture was equilibrated in a 60°C water bath for 5 min. Extraction was then performed at 60°C for 45 min using a DVB / CAR / PDMS three-in-one extraction head. The chromatographic column used was an HP-INNOWAX (60 m × 0.25 mm × 0.25 μm); injection port temperature: 250°C; temperature program: 40°C for 3 min, increased to 140°C at a rate of 5°C / min, held for 2 min, increased to 240°C at a rate of 3°C / min, held for 15 min; carrier gas: helium (99.99% purity); flow rate: 2 mL / min; injection method: splitless injection. Mass spectrometry conditions: electron ionization energy: 70 eV; ion source temperature: 230℃; quadrupole temperature: 150℃; emission current: 35 µA; scan rate: 1.9 scans / s; mass scan range: 30-450 amu. Qualitative analysis of all volatile compounds was performed using the NIST17 mass spectrometry library, identifying compounds based on matching degree and ion fragmentation. Retention indices (RIs) were calculated using C7-C30 n-alkanes and compared with reported values in the literature. These two methods were combined for accurate qualitative analysis of casein compounds. Quantitative analysis was performed using the internal standard method, calculating the content of each component based on peak area ratios.
[0062] The results are as follows Figure 9 As shown, the total lactone content of the cheese prepared in Example 5, after maturing at 14°C for 120 days, was 8.43 times higher than that of the cheese in Comparative Example 1 (76.02 μg / kg - 640.86 μg / kg). This demonstrates that the maturation process of fermented cheese can promote the improvement and enhancement of the types and contents of lactone-based flavor compounds in the cheese sample. Figure 10 As shown, in Example 5, compared to Comparative Example 1, the product could produce [something] 60 days before maturity at 14°C. δ -Octinolone (10.11 μg / kg-111.80 μg / kg) and γ β-Butyrolactone (17.16 μg / kg - 69.24 μg / kg). It can accumulate during maturation at 14℃. δ - Decanolactone (8.51 μg / kg - 364.24 μg / kg) and δ - Dodelactone (12.29 μg / kg-95.58 μg / kg). Overall, high-lipase-producing Lactococcus gasseri ( Lactococcus garvieae Y3 can promote the growth of cheese γ -Butyrolactone, δ Accumulation of octyl lactone, while significantly increasing the accumulation of lactone compounds.
[0063] Example 2 Sensory analysis experiments were conducted to evaluate the aroma intensity of the cheeses prepared in Example 5 and Comparative Example 1 after maturing at 4°C, 10°C, and 14°C for 120 days.
[0064] All sensory tests were performed in a sensory laboratory according to international standard ISO 8589:2007, with the room temperature controlled at 20°C. The cheese samples to be tested were randomly coded numerically. Each cheese sample was cut into uniformly sized pieces, weighed out in 5g portions, and stored in a covered, odorless glass container (total capacity 50 mL). These samples were then arranged in random order and presented to the evaluators for sensory evaluation. The sensory evaluators scored each cheese sample according to the attributes and definitions on the evaluation form. Specifically, in the cheese aroma sensory evaluation, each aroma attribute was graded on an intensity scale of 0-10 (intensity explanation: 0 = no intensity or imperceptible aroma, 5 = medium intensity, 10 = very strong). Each cheese sample was tested three times.
[0065] Table 2. Basic Sensory Terms for Descriptive Analysis of Cheese Milk flavor 0.002% diacetyl aqueous solution sour 0.06% lactic acid aqueous solution Fruity aroma 0.002% ethyl hexanoate aqueous solution alcoholic flavor 30% ethanol aqueous solution sulfur smell Crushed eggshells sour smell 0.1% butyric acid aqueous solution Fatty taste salad oil Nut flavor raw nuts Cheese flavor Fresh coconut meat or butter Based on the sensory analysis results, as shown in... Figures 11-15 It can be seen that the cheese aged 0 days is mainly characterized by cheese and fatty flavors, while the cheese prepared in Example 5 exhibits significantly higher aroma intensities of characteristic flavors such as milk, nuts, sulfur, and sourness compared to the sample in Comparative Example 1. With prolonged aging time, the sensory intensity of the cheese samples gradually increases, with a significant rise in the cheese and sourness flavor intensities of the cheese sample aged 120 days. Furthermore, the cheese prepared in Example 5, after aging at a storage temperature of 14 °C for 120 days, exhibits the highest aroma intensities of cheese and nuts, with values of 7.0 and 8.2, respectively. Therefore, the sensory evaluation results of the cheese prepared in Example 5, stored at a higher storage temperature for 120 days, are superior to those of the cheese sample in Comparative Example 1. This demonstrates that storage time, temperature, and different fermentation strains influence the formation and aroma intensity of characteristic flavors in cheese samples.
[0066] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.
Claims
1. A type of Lactococcus gasseri that produces lipase ( Lactococcus garvieae Y3, characterized in that, The Lactococcus gasseri ( Lactococcus garvieae Y3 was deposited at the China Center for Type Culture Collection (CCTCC) on January 3, 2023, with accession number CCTCC NO: M 2023007.
2. A formulation containing the *Lactococcus gasseri* as described in claim 1 (… Lactococcus garvieae Y3 is an auxiliary fermentation agent.
3. The method for preparing the auxiliary fermentation agent according to claim 2, characterized in that, Includes the following steps: Step 1): Take Lactococcus gasseri ( Lactococcus garvieae Streak the Y3 strain on a culture medium plate and incubate it in an incubator at 28-32℃ for 24-48 h until a single colony grows. Step 2): Pick the single colony and culture it in MRS broth until the concentration reaches 1×10⁻⁶. 9 The concentration of CFU / mL was increased, and the culture conditions were 35-38℃ for 14-16 h. The resulting culture medium was washed twice with physiological saline and then suspended in physiological saline.
4. The method for preparing the auxiliary fermentation agent according to claim 3, characterized in that, The culture medium mentioned in step 1) is MRS agar medium.
5. The method for preparing the auxiliary fermentation agent according to claim 3, characterized in that, The washing method in step 2) is as follows: control the rotation speed at 6000-8000 r / min and centrifuge for 5-10 min.
6. The *Lactococcus gasseri* as described in claim 1 (… Lactococcus garvieae The application of the auxiliary fermentation agent as described in claim 3 or claim 2 in the preparation of cheese.
7. The application according to claim 6, characterized in that, The specific application is as follows: pasteurized milk is poured into a cheese jar, a starter culture is added, and the mixture is matured at 31°C for 30 minutes. When the pH value of the pasteurized milk drops by 0.4, rennet is added and the mixture is coagulated for 40 minutes. After cutting, the mixture is blanched at 39°C. Next, a groove is left in the middle of the cheese vat, and cheese granules are placed on both sides of the groove to remove whey; 38°C warm water is poured into the jacket of the cheese jar, and the cheese jar is covered to ensure the temperature; as the acidity rises and the curd coagulates into blocks, the curd is cut into 30 cm cubes; the cheese blocks are piled together and turned over every 15 minutes. Cut the curd into 1 cm cubes, add sterile sodium chloride solution to the cheese and stir, then add Lactococcus gasseri (Lactococcus gasseri). Lactococcus garvieae Y3 or containing Lactococcus gasseri ( Lactococcus garvieae Y3, an auxiliary fermenting agent, is pressed into molds, vacuum-packed, and matured at a constant temperature of 4-14℃ for 120 days to obtain a product containing Lactococcus gasseri (Y3). Lactococcus garvieae Y3 cheese.
8. Containing the Lactococcus gasseri as described in claim 1 ( Lactococcus garvieae Cheese of Y3 or the fermentation aid of claim 2.
9. The cheese according to claim 8, characterized in that, Produced only in cheese fermented by Lactococcus gasseri Y3 60 days before maturity. δ - Octyl lactone content ranged from 10.11 μg / kg to 111.80 μg / kg. γ The content of β-butyrolactone ranged from 5.45 μg / kg to 69.24 μg / kg.