Application of a pollen exine protein BcGRP20 gene of Brassica campestris

Abstract

The application relates to the field of molecular breeding and genetic engineering, and particularly relates to application of pollen exine protein BcGRP20 gene of Brassica campestris, wherein the base sequence of the pollen exine protein BcGRP20 gene of Brassica campestris is shown as SEQ ID NO. 1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The pollen exine protein BcGRP20 gene of Brassica campestris is cloned, and through overexpression of Arabidopsis thaliana mutant grp20 and Brassica campestris sterile plant test, it is found that the BcGRP20 gene can restore pollen fertility, the expression levels of key genes AtAGL84 and AtMS1 related to pollen in the Arabidopsis thaliana mutant are restored, and the expression amount of AtAOP3 gene is significantly increased; after the gene is silenced in the fertile plant of Brassica campestris, the expression amount is reduced, the pollen is aborted, and the expression levels of BcAGL84, BcAOP3 and BcMS1 genes are all significantly reduced.

Description

Technical Field

[0001] This invention relates to the fields of molecular breeding and genetic engineering technology, specifically to the application of the BcGRP20 gene, a protein found in the outer wall of pollen from *Brassica napus*. Background Technology

[0002] Black cabbage (Brassica campestris L.syn.B.rapa L.ssp.chinensis var.rosularisTsen) is a variety of non-heading Chinese cabbage and one of the important cruciferous vegetables in my country. Due to its delicious taste and rich nutrition, it is highly favored by consumers and has been widely cultivated.

[0003] Pollen development is a complex biological process, and any abnormality in this process can lead to male sterility. The pollen exine, located on the outermost layer of the pollen, contains abundant pollen coat proteins (PCPs). These PCPs are a class of highly polymorphic, gametophyte-based, cysteine-rich small proteins. Previous studies have found that PCPs contain male determinants, playing crucial roles in protecting pollen from external disturbances, stigma-specific recognition, and pollen germination, and are also involved in plant signal transduction and stress resistance pathways.

[0004] Pollen exine proteins are involved in pollen wall synthesis, and their abnormal expression may lead to male sterility. To date, the fertility function of the *Brucea javanica* pollen exine protein BcGRP20 has not been studied. Therefore, research on the function of *Brucea javanica* pollen exine proteins is of great significance for both the theory and practical application of male sterility breeding in *Brucea javanica*.

[0005] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0006] The purpose of this invention is to solve the problem of how to apply the BcGRP20 gene of pollen exine protein of Brassica oleracea to male sterility breeding of Brassica oleracea, and to provide an application of the BcGRP20 gene of pollen exine protein of Brassica oleracea.

[0007] To achieve the above objectives, this invention discloses the application of overexpression of the BcGRP20 gene, a pollen exine protein from *Brucea javanica*, in restoring pollen fertility in male-sterile *Brucea javanica* plants.

[0008] The base sequence of the BcGRP20 gene is shown in SEQ ID NO.1.

[0009] The amino acid sequence of the protein expressed by the BcGRP20 gene is shown in SEQ ID NO.2.

[0010] The overexpression vector for the BcGRP20 gene is pCAMBIA1305-BcGRP20.

[0011] The silencing expression vector for the BcGRP20 gene is pCRISPR / Cas9-BcGRP20, with the target site sequence: ACCGGCGGCTGCTAAACCC, AGAAAGGTGTTTCCTGGTG.

[0012] This invention also discloses the application of overexpression of the BcGRP20 gene, a pollen exine protein from *Brassica rapa*, in restoring pollen fertility in the Arabidopsis male-sterile mutant grp20.

[0013] This invention also discloses the application of the BcGRP20 gene, a pollen exwall protein from *Brassica napus*, in regulating the expression of key genes for fertility in *Arabidopsis thaliana*, wherein the genes include AtAGL84, AtAOP3, and AtMS1.

[0014] This invention also discloses the application of the BcGRP20 gene, a pollen exwall protein of *Brucea javanica*, in regulating the expression of key genes for fertility in *Brucea javanica*, wherein the gene includes BcAGL84, BcAOP3, and BcMS1.

[0015] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention clones the BcGRP20 gene, a pollen exine protein from *Brucea javanica*. Through overexpression experiments with the Arabidopsis mutant grp20 and sterile *Brucea javanica* plants, it was found that the BcGRP20 gene can restore pollen fertility. The expression levels of key pollen-related genes AtAGL84 and AtMS1 in the Arabidopsis mutant were restored, while the expression level of the AtAOP3 gene significantly increased. Silencing this gene in fertile *Brucea javanica* plants reduced its expression level, resulting in pollen abortion. Furthermore, the expression levels of the BcAGL84, BcAOP3, and BcMS1 genes were significantly reduced. Therefore, the BcGRP20 gene has wide applications in pollen development. Attached Figure Description

[0016] Figure 1 To clone the BcGRP20 gene from fertile *Brucea javanica* plant 12-14B;

[0017] Figure 2 The expression levels of the BcGRP20 gene in different pollen development stages of fertile plants 12-14B and sterile plants 12-14A of *Brucea javanica* are shown in Figure 1. A: Relative expression level of BcGRP20 in different pollen development stages in fertile plants; B: Relative expression level of BcGRP20 in sterile plants compared to fertile plants.

[0018] Figure 3Overexpression of the BcGRP20 gene in the Arabidopsis mutant grp20 can completely restore pollen fertility. A: Pollen fertility of wild-type Arabidopsis plants; B: Pollen fertility of Arabidopsis gre20 mutant; C: Pollen fertility of Arabidopsis gre20 mutant with BcGRP20 gene overexpression.

[0019] Figure 4 Overexpression of the BcGRP20 gene in the Arabidopsis mutant grp20 can restore the expression levels of AtAGL84 and AtMS1, and increase the expression level of the AtAOP3 gene. A: Relative expression levels of the BcGRP20 gene in wild-type Arabidopsis, BcGRP20 overexpression, and grp20 mutant; B: Relative expression levels of the AtAGL84 gene in wild-type Arabidopsis, BcGRP20 overexpression, and grp20 mutant; C: Relative expression levels of the AtAOP3 gene in wild-type Arabidopsis, BcGRP20 overexpression, and grp20 mutant; D: Relative expression levels of the AtMS1 gene in wild-type Arabidopsis, BcGRP20 overexpression, and grp20 mutant.

[0020] Figure 5 To investigate the effect of overexpressing the BcGRP20 gene on restoring pollen fertility and the expression levels of BcAGL84, BcAOP3, and BcMS1 genes in sterile *Brucea javanica* plants, the following analyses were conducted: A: Pollen activity analysis of fertile, sterile, BcGRP20 transgenic, and gene-edited *Brucea javanica* plants; B: Relative expression levels of the BcGRP20 gene in fertile, sterile, BcGRP20 transgenic, and gene-edited *Brucea javanica* plants. C: Relative expression level of BcAGL84 gene in fertile plants, sterile plants, BcGRP20 transgenic plants, and gene-edited plants of *Brucea javanica*; D: Relative expression level of BcAOP3 gene in fertile plants, sterile plants, BcGRP20 transgenic plants, and gene-edited plants of *Brucea javanica*; E: Relative expression level of BcMS1 gene in fertile plants, sterile plants, BcGRP20 transgenic plants, and gene-edited plants of *Brucea javanica*. Detailed Implementation

[0021] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0022] I. Cloning of the BcGRP20 gene

[0023] 1. Take flower buds from fertile *Brucea javanica* plants during their full bloom period (12-14B), extract total RNA from the tetrad stage flower buds, and reverse transcribe it into cDNA.

[0024] 2. Using the BraA02g002400.3C gene sequence of Chinese cabbage from the BRAD database (http: / / brassicadb.cn) as a template, upstream and downstream specific primers GRP20-F1 and GRP20-R1 were designed.

[0025] GRP20-F1: ATGGGGGTACTCAGAAAGAAAC

[0026] GRP20-R1: TCATGTACTCGGTGCAGCTG

[0027] 3. Using cDNA template, GRP20-F1 as the upstream primer and GRP20-R1 as the downstream primer, perform PCR reaction according to the following system to obtain PCR products: Taq PCR Master Mix (25mM / L) 12.5μL, cDNA (100ng / μL) 1μL, Forward Primer (10μmol / L) 1μL, Reverse primer (10μmol / L) 1μL, ddH2O 9.5μL.

[0028] 4. The PCR purified product was ligated into the pMD-19 vector to obtain the pMD-BcGRP20 recombinant vector; this vector was transformed into DH5α Escherichia coli, and after positive PCR verification of the bacterial culture, sequencing was performed to confirm the result.

[0029] 5. For example Figure 1 As shown, the full-length BcGRP20 gene sequence, encoding 149 amino acids, was cloned from *Brucea javanica* 12-14A. Its base sequence is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2.

[0030] II. Detection of BcGRP20 gene expression level

[0031] 1. Take the inflorescences of fertile plants 12-14B and sterile plants 12-14A during their full bloom period. Divide the flower buds into four developmental stages: pollen mother cell stage, pre-tetraditional stage, post-tetraditional stage, and mature pollen stage. Extract RNA from each stage and reverse transcribe it into cDNA.

[0032] 2. Using the BcGRP20 gene sequence as a template, specific primers GRP20-F2 and GRP20-R2 were designed for upstream and downstream of real-time PCR.

[0033] GRP20-F2:CTTTGGGTCATCAAGCGAGTAA

[0034] GRP20-R2: TGCTGCCAGTTTAGATGGAGTAC

[0035] 3. Using the BcActin gene as an internal reference (F: TGGGTTTGCTGGTGACGAT, R: TGCCTAGGACGACCAACAATACT), quantitative real-time PCR analysis was performed.

[0036] 4. Results are as follows Figure 2 As shown, during anther development in fertile plants, the expression level of the BcGRP20 gene was higher in the tetrad and subsequent developmental stages; while in sterile plants, its expression level was significantly lower than that in fertile plants at all stages.

[0037] III. Construction of BcGRP20 gene overexpression vector

[0038] 1. Use the CE Design V program to design the homologous recombination primer sequences GRP20-F2 and GRP20-R2 for the BcGRP20 gene.

[0039] GRP20-F2: gacgatgacgataagggatccATGGGGGTACTCAGAAAGAAACAC

[0040] GRP20-R2: tgcctgcaggtcgactctagaTCATGTACTCGGTGCAGCTGC

[0041] 2. Using the pMD-BcGRP20 recombinant vector template, PCR amplification was performed with GRP20-F2 as the upstream primer and GRP20-R2 as the downstream primer, and the PCR product BcGRP20 fragment was purified.

[0042] 3. The pCAMBIA1305 vector (containing the 35S-MYC-nos multiple cloning expression cassette) was digested with HindIII and BamHI restriction endonucleases, and the digested fragments were recovered.

[0043] 4. Use The plus One step PCR Cloning Kit ligates the purified PCR product BcGRP20 fragment with the pCAMBIA1300 double-digested fragment; the ligation product is transformed into E. coli DH5α and verified by bacterial PCR. Positive bacterial cultures are selected for sequencing confirmation, and finally the p1305-BcGRP20 overexpression vector is obtained.

[0044] 5. The p1305-BcGRP20 overexpression vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-p1305-BcGRP20 engineered strain.

[0045] IV. Construction of BcGRP20 gene silencing vector

[0046] 1. Use CHOPCHOP software to design BcGRP20 gene knockout target site sequences T1 and T2 online.

[0047] T1(70%GC):ACCGGCGGCTGCTAAACCC

[0048] T2 (50% GC): AGAAAGGTGTTTCCTGGTG

[0049] 2. Based on the target sites T1 and T2, and using the BcGRP20 gene as a template, design forward and reverse primers GRP20-gRT1 and GRP20-U3dT1, and GRP20-gRT2 and GRP20-U3dT2 containing the target sites, respectively.

[0050] GRP20-gRT1:ACCGGCGGCTGCTAAACCCgttttagagctagaaat

[0051] GRP20-U3dT1: GGGTTTAGCAGCCGCCGGTgaccaatggtgctttg

[0052] GRP20-gRT2:AGAAAGGTGTTTCCTGGTGgttttagagctagaaat

[0053] GRP20-U3dT2:CACCAGGAAACACCTTTCTgaccaatgttgctcc

[0054] 3. Using the pYLgRNA-AtU3d-LacZ intermediate vector as a template, amplification was performed using primer pairs UF(CTCCGTTTTACCTGTGGAATCG) and GRP20-U3dT1, and GRP20gRT1 and gR-R(CGGAGGAAAATTCCATCCAC), respectively. 1 μL of each of the above PCR products was diluted 10-fold and used as a template. U3dT1-gRNA fragment PCR amplification was performed using primer pairs Pps-RC(TTCAGAggtctcTACCGACTAGTATGGAATCGGCAGCAAAGG) and Pgs-GG2(AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC) as primer pairs. The PCR products were then purified to obtain the T1sgRNA expression cassette. Using the same method, pYLsgRNA-AtU3b was used as a template, and PCR was performed with primer pairs UF and GRP20-U3dT2 and GRP20gRT2 and gR-R, respectively. Then, U3bT2-gRNA fragment PCR amplification was performed with primer pairs Pps-GG2(TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG) and Pgs-LC(AGCGTGggtctcGCTCGACGCGTATCCATCCACTCCAAGCT) as primer pairs. After purification, T2sgRNA expression cassette was obtained.

[0055] 4. Take the purified products of the T1sgRNA expression cassette and T2sgRNA expression cassette and perform an enzyme digestion-ligation reaction with the pYLCRISPR / Cas9 plasmid (10×CutSmart Buffer 3μL, 10mM ATP 3μL, pYLCRISPR / Cas9 plasmid 160ng, T1sgRNA expression cassette 30ng, BsaI-HF 1μL, T4 DNA ligase 0.2μL, H2O 30μL); reaction program: 37℃ 1min, 16℃ 1min, 30 cycles, 55℃ 5min; the purified product is transformed into DH5α Escherichia coli, the plasmid is extracted and verified by Mlu I enzyme digestion, and then sequenced to obtain the pCRISPR-BcGRP20 silencing vector.

[0056] 5. The pCRISPR-BcGRP20 silencing vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-pCRISPR-BcGRP20 engineered bacteria.

[0057] V. Genetic transformation of the BcGRP20 gene into the Arabidopsis mutant grp20

[0058] 1. The engineered bacteria GV3101-p1305-BcGRP20 was used to infect the Arabidopsis mutant grp20 using the inflorescence infection method to obtain T0 generation transgenic seeds.

[0059] 2. The obtained T0 generation transgenic seeds were screened for hygromycin resistance to identify resistant plants, and positive plants were obtained by PCR.

[0060] 3. After obtaining T1 seeds from positive plants, use the same method as above until T3 generation stable transgenic plants are obtained.

[0061] 4. During the peak flowering period of the T3 generation transgenic plants, pollen viability was determined using Alexander staining solution, and the results were as follows: Figure 3 As shown, genetic transformation of the Arabidopsis mutant grp20 with the BcGRP20 gene can completely restore its pollen fertility.

[0062] 5. The expression levels of the target gene and key fertility genes AtAGL84, AtAOP3, and AtMS1 in transgenic plants were detected using quantitative real-time PCR. The results are as follows: Figure 4 As shown, the expression levels of AtAGL84 and AtMS1 genes in transgenic plants were restored to the expression levels in wild-type fertile plants, while the expression level of AtAOP3 gene was significantly upregulated.

[0063] VI. Genetic transformation of *Brucea javanica* plants using the BcGRP20 gene

[0064] 1. Using the obtained GV3101-p1305-BcGRP20 engineered bacteria, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method. After the infected flower buds opened, the pollen was transferred to the stigma of sterile plant 12014A to obtain T0 generation transgenic seeds. Using the GV3101-pCRISPR-BcGRP200 engineered bacteria obtained in Example 4, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method to obtain T0 generation transgenic seeds.

[0065] 2. After the p1305-BcGRP20 transgenic seeds germinated, positive transgenic plants were obtained by hygromycin and PCR identification of the BcGRP20 target gene. The expression level of the BcGRP20 gene in the positive plants was detected by real-time PCR, and plants with overexpression of the BcGRP20 gene were screened.

[0066] 3. After germination of pCRISPR-BcGRP20 transgenic seeds, positive transgenic plants were obtained by hygromycin and Cas9 gene sequence PCR identification. The editing effect of the target site was detected by using the target site detection primers (T1F: AGCCGCAATATTCCTCTTATTG, T1R: ACTTGATGACCCAAAGGATGAG; T2F: GTGAACATGTTTTGAGCCGTAA, T1RCATCCTTTGCTTATTACCCACC). The expression level of BcGRP20 gene in the edited plants was detected by real-time PCR, and plants with silent expression of BcGRP20 gene were screened.

[0067] 4. Quantitative real-time PCR analysis was performed on flower buds of transgenic plants with overexpression of BcGRP20 gene and those with gene silencing at the tetrad stage to detect the expression levels of BcAGL84, BcAOP3, and BcMS1; at the same time, pollen activity was detected.

[0068] 5. Results are as follows Figure 5 As shown, overexpression of the BcGRP20 gene in sterile *Brucea javanica* plants significantly restored pollen fertility and also restored the expression levels of the BcAGL84, BcAOP3, and BcMS1 genes. Conversely, silencing the BcGRP20 gene in fertile *Brucea javanica* plants significantly reduced pollen fertility and also significantly downregulated the expression levels of the BcAGL84, BcAOP3, and BcMS1 genes.

[0069] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. The application of overexpression of the BcGRP20 gene, a pollen exine protein from *Brucea javanica*, in restoring pollen fertility in male-sterile *Brucea javanica* plants, characterized in that... The base sequence of the BcGRP20 gene is shown in SEQ ID NO.

1.

2. The application of the overexpression of the BcGRP20 gene, a pollen exine protein from *Brucea javanica*, as described in claim 1, in restoring pollen fertility in male-sterile *Brucea javanica* plants, characterized in that... The amino acid sequence of the BcGRP20 gene-expressed protein is shown in SEQ ID NO.

2.

3. The application of the overexpression of the BcGRP20 gene, a pollen exine protein from *Brucea javanica*, as described in claim 1, in restoring pollen fertility in male-sterile *Brucea javanica* plants, characterized in that... The overexpression vector for the BcGRP20 gene is pCAMBIA1305-BcGRP20.

4. Application of overexpression of the BcGRP20 gene, a pollen exine protein from *Brassica rapa*, in restoring pollen fertility in the Arabidopsis male-sterile mutant grp20.

Images