Use of a beta-glucosidase gene bcBGLU20 from Brassica campestris

Abstract

The application relates to the technical field of plant genetic breeding, and particularly relates to application of a beta-glucosidase BcBGLU20 gene of Brassica campestris L. var. chinensis L. The base sequence of the beta-glucosidase BcBGLU20 gene of Brassica campestris L. var. chinensis L. is shown as SEQ ID NO. 1, the amino acid sequence of an expression protein is shown as SEQ ID NO. 2, the BcBGLU20 gene overexpression Brassica campestris L. var. chinensis L. sterile plants can restore pollen activity, improve cold tolerance and salt tolerance; the gene knockout Brassica campestris L. var. chinensis L. fertile plants can significantly reduce pollen activity, reduce cold tolerance and salt tolerance; the gene is overexpressed in Arabidopsis thaliana, and it is found that the salt tolerance and cold tolerance of the transgenic plants can be significantly improved.

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to the application of a β-glucosidase BcBGLU20 from *Brassica oleracea*. Background Technology

[0002] Black cabbage (Brassica campestris L.syn.B.rapa L.ssp.chinensis var.rosularisTsen) is a variety of non-heading Chinese cabbage and one of the important cruciferous vegetables in my country. Due to its delicious taste and rich nutrition, it is highly favored by consumers and has been widely cultivated.

[0003] β-glucosidases are glycoside hydrolases (glycoside hydrolase family 1), widely distributed in organisms, functioning by hydrolyzing glycosidic bonds between sugars or non-sugar components. β-glucosidases typically function in plastids, cytoplasm, vacuoles, and apoplasts. Numerous reports have documented the functions of β-glucosidases. In Arabidopsis, BGLU1-6 act on flavonol accumulation, BGLU7-11 on anthocyanin glucosyltransferase, BGLU12-17 on flavonoid utilization, and BGLU26 and BGLU34-39 can stimulate the chemical defense mechanism of Arabidopsis. Furthermore, β-glucosidases can hydrolyze cellulose and participate in the synthesis and metabolism of nutrients, as well as participate in cell wall formation, hydrolyzing auxin-glucosides and other hormones, hydrolyzing carbohydrate glycosidic bonds, and participating in the development of the tapetum and pollen wall. However, the related functions of the BcBGLU20 gene in *Brucea javanica* have not yet been reported. Therefore, studying the function of the BcBGLU20 gene, a β-glucosidase found in Brassica oleracea, is of great significance for the theory and practical application of male sterility and stress-resistant breeding in Brassica oleracea.

[0004] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0005] The purpose of this invention is to solve the problem of how to apply the function of the β-glucosidase BcBGLU20 gene of *Brucea javanica* to male sterility and stress-resistant breeding, and to provide an application of the β-glucosidase BcBGLU20 gene of *Brucea javanica*.

[0006] To achieve the above objectives, this invention discloses the application of overexpression of the β-glucosidase BcBGLU20 gene in restoring pollen fertility and improving cold and salt tolerance in male-sterile plants of *Brucea javanica*. The base sequence of the BcBGLU20 gene is shown in SEQ ID NO.1.

[0007] The amino acid sequence of the expressed protein of the BcBGLU20 gene is shown in SEQ ID NO.2.

[0008] The overexpression vector for the BcBGLU20 gene is pCAMBIA1305-BcBGLU20.

[0009] The silencing expression vector for the BcBGLU20 gene is pCRISPR / Cas9-BcBGLU20.

[0010] This invention also discloses the application of the *Brassica napus* β-glucosidase BcBGLU20 gene in regulating the expression of key stress-resistance genes such as BcNHX1, BcSOS1, BcCBF3, BcZAT10, and BcCOR15 in *Brassica napus*.

[0011] This invention also discloses the application of overexpression of the *Brassica napus* β-glucosidase BcBGLU20 gene in *Arabidopsis thaliana* to enhance the cold and salt tolerance of *Arabidopsis thaliana*.

[0012] This invention also discloses the application of the *Brassica napus* β-glucosidase BcBGLU20 gene in regulating the expression of key stress-resistance genes in *Arabidopsis thaliana* such as AtNHX1, AtSOS1, AtCBF3, AtZAT10, and AtCOR15.

[0013] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention clones the BcBGLU20 gene of *Brucea javanica* β-glucosidase. Overexpression of the BcBGLU20 gene in sterile *Brucea javanica* plants restores pollen activity and improves cold and salt tolerance; gene knockout in fertile *Brucea javanica* plants significantly reduces pollen activity and decreases cold and salt tolerance; overexpression of this gene in *Arabidopsis thaliana* significantly improves the salt and cold tolerance of transgenic plants. Furthermore, key salt tolerance genes such as NHX1 and SOS1, and key cold tolerance genes such as CBF3, ZAT10, and COR15 are all significantly upregulated. Therefore, the BcBGLU20 gene has wide applications in pollen development and stress tolerance. Attached Figure Description

[0014] Figure 1 To clone the BcBGLU20 gene from fertile *Brucea javanica* plant 12-14B;

[0015] Figure 2 The expression levels of the BcBGLU20 gene in different pollen development stages of fertile *Brucea javanica* plants 12-14B and sterile plants 12-14A are shown in Figure 1. A: Relative expression level of the BcBGLU20 gene in different pollen development stages of fertile *Brucea javanica* plants; B: Relative expression level of the BcBGLU20 gene in different pollen development stages of sterile *Brucea javanica* plants compared to fertile plants.

[0016] Figure 3 To analyze the salt and cold tolerance of BcBGLU20 transgenic and gene-edited *Brucea javanica* plants, the following data were analyzed: A: Salt damage index of BcBGLU20 transgenic and gene-edited *Brucea javanica* plants under salt damage treatment; B: Chill damage index of BcBGLU20 transgenic and gene-edited *Brucea javanica* plants under chilling damage treatment; C: Relative expression levels of NHX1 and SOS1 genes in sterile *Brucea javanica* plants and BcBGLU20 transgenic plants under salt damage treatment, and CBF3, ZAT10, and COR15 genes under chilling damage treatment; D: Relative expression levels of NHX1 and SOS1 genes in fertile *Brucea javanica* plants and BcBGLU20 gene-edited plants under salt damage treatment, and CBF3, ZAT10, and COR15 genes under chilling damage treatment.

[0017] Figure 4 For the analysis of pollen activity of BcBGLU20 transgenic and gene-edited *Brucea javanica* plants, A: Pollen activity analysis of fertile plants, sterile plants and BcBGLU20 transgenic and gene-edited plants of *Brucea javanica*; B: Relative expression level of BcBGLU20 gene in fertile plants, sterile plants and BcBGLU20 transgenic and gene-edited plants of *Brucea javanica*.

[0018] Figure 5 To determine the pollen fertility of Arabidopsis thaliana mutant bglu20 overexpressing the BcBGLU20 gene, A: pollen staining of wild-type Arabidopsis thaliana, B: pollen staining of Arabidopsis thaliana mutant bglu20, C: pollen staining of Arabidopsis thaliana mutant bglu20 overexpressing BcBGLU20.

[0019] Figure 6 To analyze the salt and cold tolerance of the BcBGLU20 transgenic Arabidopsis thaliana, A: Salt damage index of wild-type Arabidopsis thaliana and BcBGLU20 transgenic plants; B: Chill damage index of wild-type Arabidopsis thaliana and BcBGLU20 transgenic plants; C: Relative expression levels of NHX1 and SOS1 genes in wild-type Arabidopsis thaliana and BcBGLU20 transgenic plants under salt damage treatment, and CBF3, ZAT10, and COR15 genes under chilling damage treatment. Detailed Implementation

[0020] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0021] I. Cloning of the BcBGLU20 gene

[0022] 1. Collect inflorescences of fertile *Brucea javanica* plants during their full bloom period (12-14B), and extract total RNA from tetrad-stage flower buds, which are then reverse transcribed into cDNA.

[0023] 2. Using the BraA02g023150.3C gene sequence of Chinese cabbage from the BRAD database (http: / / brassicadb.cn) as a template, upstream and downstream specific primers BGLU20-F1 and BGLU20-R1 were designed;

[0024] BGLU20-F1:ATGGAGAGGTTCCATAAGTTTC

[0025] BGLU20-R1:CTACAACTCATCGTGCTCATG

[0026] 3. Using cDNA template, BGLU20-F1 as the upstream primer and BGLU20-R1 as the downstream primer, a PCR reaction was performed; the purified PCR product was ligated into the pMD-19 vector to obtain the pMD-BcBGLU20 recombinant vector; this vector was transformed into DH5α Escherichia coli, and after positive PCR verification of the bacterial culture, sequencing was performed to confirm the result.

[0027] 4. For example Figure 1 As shown, the full-length sequence of the BcBGLU20 gene, encoding 550 amino acids, was cloned from *Brucea javanica* 12-14A. Its base sequence is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2.

[0028] II. Detection of BcBGLU20 gene expression level

[0029] 1. Take the inflorescences of fertile plants 12-14B and sterile plants 12-14A during their full bloom period. Divide the flower buds into four developmental stages: pollen mother cell stage, pre-tetraditional stage, post-tetraditional stage, and mature pollen stage. Extract RNA from each stage and reverse transcribe it into cDNA.

[0030] 2. Using the BcBGLU20 gene sequence as a template, specific upstream and downstream primers BGLU20-F2 and BGLU20-R2 were designed for real-time PCR.

[0031] BGLU20-F2:TGATTGACTTCGTCTTGGGATG

[0032] BGLU20-R2:GCCGTGCATGCAAATAGTG

[0033] 3. Using the BcActin gene as an internal reference (F: TGGGTTTGCTGGTGACGAT, R: TGCCTAGGACGACCAACAATACT), quantitative real-time PCR analysis was performed.

[0034] 4. Results are as follows Figure 2As shown, during anther development in fertile plants, the expression level of the BcBGLU20 gene was highest in the early tetrad stage, lower in the late tetrad stage and anther maturation stage, and lowest in the pollen mother cell stage. In sterile plants, the expression level at all stages was significantly lower than that in fertile plants, indicating that this gene is closely related to pollen development.

[0035] III. Construction of BcBGLU20 gene overexpression vector

[0036] 1. Design homologous recombination primer sequences BGLU20-F2 and BGLU20-R2 for the BcBGLU20 gene using software such as CE Design V and Snap Gene;

[0037] BGLU20-F2:gacgatgacgataagggatccATGGAGAGGTTCCATAAGTTTCCTC

[0038] BGLU20-R2: tgcctgcaggtcgactctagaCTACAACTCATCGTGCTCATGGTAC

[0039] 2. Using the pMD-BcBGLU20 recombinant vector template, PCR amplification was performed with BGLU20-F2 as the upstream primer and BGLU20-R2 as the downstream primer, and the PCR product BcBGLU20 fragment was purified.

[0040] 3. The pCAMBIA1305 vector (containing the 35S-MYC-nos multiple cloning expression cassette) was digested with BamHI and XbaI restriction endonucleases, and the digested fragments were recovered.

[0041] 4. Use The plus One step PCR Cloning Kit ligates the PCR purified product BcBGLU20 fragment with the pCAMBIA1305 double-digested fragment; the ligation product is transformed into E. coli DH5α and verified by bacterial PCR. Positive bacterial cultures are selected for sequencing confirmation, and finally the p1305-BcBGLU20 overexpression vector is obtained.

[0042] 5. The p1305-BcBGLU20 overexpression vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-p1305-BcBGLU20 engineered strain.

[0043] IV. Construction of BcBGLU20 gene silencing vector

[0044] 1. Use CHOPCHOP software to design online BcBGLU20 gene knockout target forward and reverse site sequences T1 and T2;

[0045] T1(60%GC):TCGGTGAGCCGATAAAGCCG

[0046] T2 (60% GC): GAGGGGTACAGCGCGAGATT

[0047] 2. Based on the target sites T1 and T2, using the BcBGLU20 gene as a template, design forward and reverse primers containing the target sites BGLU20-gRT1 and BGLU20-U3dT1, and BGLU20-gRT2 and BGLU20-U3dT2, respectively.

[0048] BGLU20-gRT1: TCGGTGAGCCGATAAAGCCGgttttagagctagaaat

[0049] BGLU20-U3dT1:CGGCTTTATCGGCTCACCGAgaccaatggtgctttg

[0050] BGLU20-gRT2: GAGGGGTACAGCGCGAGATTgttttagagctagaaat

[0051] BGLU20-U3dT2: AATTCCGCGCTGTACCCCTCgaccaatgttgctcc

[0052] 3. Using the pYLgRNA-AtU3d-LacZ intermediate vector as a template, the T1sgRNA expression cassette was obtained using nested and fusion PCR techniques. Similarly, using pYLsgRNA-AtU3b as a template, the T2sgRNA expression cassette was obtained. The purified products of the T1sgRNA and T2sgRNA expression cassettes were digested and ligated with the pYLCRISPR / Cas9 plasmid. The purified products were transformed into DH5α Escherichia coli. The plasmid was extracted and verified by Mlu I digestion, followed by sequencing verification, finally obtaining the pCRISPR-BcBGLU20 silencing vector.

[0053] 5. The pCRISPR-BcBGLU20 silencing vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-pCRISPR-BcBGLU20 engineered bacteria.

[0054] V. Genetic transformation of *Brucea javanica* plants using the BcBGLU20 gene

[0055] 1. Using the obtained GV3101-p1305-BcBGLU20 engineered bacteria, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method. After the infected flower buds opened, the pollen was transferred to the stigma of sterile plants 12-14A to obtain T0 generation transgenic seeds. Using the GV3101-pCRISPR-BcBGLU20 engineered bacteria obtained in Example 4, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method, and T0 generation transgenic seeds were obtained after self-pollination.

[0056] 2. After the p1305-BcBGLU20 transgenic seeds germinated, positive transgenic plants were obtained by hygromycin and PCR identification of the BcBGLU20 target gene. The expression level of the BcBGLU20 gene in the positive plants was detected by real-time quantitative PCR, and plants with overexpression of the BcBGLU20 gene were screened.

[0057] 3. After germination of pCRISPR-BcBGLU20 transgenic seeds, gene-edited plants were obtained by PCR identification using hygromycin and Cas9 gene sequences. The editing effect of the target site was detected using primers for target site detection (T1L: TCCCTTTTCTTAATTTTGCAGC, T1R: GGTACTCATCGTGCTGATCAAA; T2L: TGGAGAGGTTCCATAAGTTTCC, T1R: TGAGGTACCAAAAATGAAACCC). The expression level of the BcBGLU20 gene in the edited plants was detected using real-time quantitative PCR, and plants with silenced expression of the BcBGLU20 gene were screened.

[0058] 4. Salt tolerance to 100mM NaCl and cold tolerance to 4℃ were analyzed in seedlings of transgenic plants with overexpression and silencing of the BcBGLU20 gene. Results are as follows: Figure 3 As shown, overexpressing genes significantly improved salt tolerance and salt tolerance, with key salt tolerance genes such as BcNHX1 and BcSOS1, as well as key cold tolerance genes such as BcCBF3, BcZAT10, and BcCOR15, being significantly upregulated; while gene-silenced plants significantly reduced salt tolerance and salt tolerance, with key salt tolerance genes such as BcNHX1 and BcSOS1, as well as key cold tolerance genes such as BcCBF3, BcZAT10, and BcCOR15, being significantly downregulated.

[0059] 5. Quantitative real-time PCR analysis of BcBGLU20 in tetrad-stage flower buds of transgenic plants with overexpression and silencing of the BcBGLU20 gene was performed, and pollen viability was also detected. Results are as follows: Figure 4As shown, overexpression of the BcBGLU20 gene in sterile *Brucea javanica* plants significantly restored pollen fertility; while silencing the BcBGLU20 gene in fertile *Brucea javanica* plants significantly reduced pollen fertility.

[0060] VI. Genetic transformation of Arabidopsis mutants using the BcBGLU20 gene

[0061] 1. The obtained GV3101-pCRISPR-BcBGLU20 engineered bacteria was used to infect the Arabidopsis mutant bglu20 using the inflorescence infection method to obtain T0 generation transgenic seeds.

[0062] 2. The obtained T0 generation transgenic seeds were screened for hygromycin resistance to identify resistant plants, and positive plants were identified by PCR.

[0063] 3. Pollen fertility of wild-type Arabidopsis plants Col-1, the mutant bglu20, and BcBGLU20 overexpression plants was analyzed, and the results are as follows: Figure 5 As shown, overexpression of the BcBGLU20 gene in the mutant bglu20 can restore pollen fertility to the state of wild-type plants.

[0064] VII. Genetic transformation of Arabidopsis thaliana using the BcBGLU20 gene

[0065] 1. The engineered bacteria GV3101-p1305-BcBGLU20 obtained was used to infect Arabidopsis thaliana Col-1 using the inflorescence infection method to obtain T0 generation transgenic seeds.

[0066] 2. The obtained T0 generation transgenic seeds were screened for hygromycin resistance to identify resistant plants, and positive plants were obtained by PCR.

[0067] 3. After obtaining T1 seeds from positive plants, use the same method as above until T3 generation stable transgenic plants are obtained.

[0068] 4. The salt tolerance of T3 generation transgenic plants to 100mM NaCl and cold tolerance to 4℃ were analyzed, and the results are as follows: Figure 6 As shown, overexpression of the BcBGLU20 gene can significantly improve the salt and cold tolerance of transgenic plants. Among them, key salt tolerance genes such as AtNHX1 and AtSOS1, and key cold tolerance genes such as AtCBF3, AtZAT10, and AtCOR15 are all significantly upregulated.

[0069] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. The application of overexpression of the β-glucosidase BcBGLU20 gene from *Brucea javanica* in restoring pollen fertility and improving cold and salt tolerance, characterized in that... The base sequence of the BcBGLU20 gene is shown in SEQ ID NO.

1.

2. The application of the overexpression of the *Brucea javanica* β-glucosidase BcBGLU20 gene as described in claim 1 in restoring pollen fertility and improving cold and salt tolerance in male-sterile *Brucea javanica* plants, characterized in that... The amino acid sequence of the expressed protein of the BcBGLU20 gene is shown in SEQ ID NO.

2.

3. The application of the overexpression of the *Brucea javanica* β-glucosidase BcBGLU20 gene as described in claim 1 in restoring pollen fertility and improving cold and salt tolerance in male-sterile *Brucea javanica* plants, characterized in that... The overexpression vector for the BcBGLU20 gene is pCAMBIA1305-BcBGLU20.

4. An application of the *Brucea javanica* β-glucosidase BcBGLU20 gene overexpression in *Arabidopsis thaliana* to enhance the cold and salt tolerance of *Arabidopsis thaliana*, characterized in that... The base sequence of the BcBGLU20 gene is shown in SEQ ID NO.1.

Images