Application of Anti-disease Gene NtTBWRG1 in Tobacco Bacterial Wilt Prevention

Abstract

The application provides application of a disease-resistant gene NtTBWRG1 in tobacco bacterial wilt prevention, and belongs to the technical field of genetic engineering.The application provides application of the disease-resistant gene NtTBWRG1 in tobacco bacterial wilt caused by Ralstonia solanacearum prevention, and the coding sequence of the gene is shown as SEQ ID NO:1.The disease-resistant gene can be effectively used in cultivation of tobacco bacterial wilt resistant varieties, the purpose of significantly enhancing the bacterial wilt resistance of tobacco is achieved, the bacterial wilt disease index of the transgenic plant is 20-30, reaches the disease-resistant level, and has important application value and good development prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of a disease-resistant gene NtTBWRG1 in the prevention and control of tobacco bacterial wilt. Background Technology

[0002] Tobacco bacterial wilt is a bacterial disease caused by Ralstonia solanacearum. It is a typical vascular disease that can affect the roots, stems, and leaves. Tobacco bacterial wilt is widely distributed in my country, and in recent years its reach has gradually expanded from south to north, sometimes causing the entire field of tobacco plants to die, resulting in significant economic losses to tobacco production. Currently, there is no highly effective control method for tobacco bacterial wilt; discovering disease-resistant genes is the fundamental way to solve the problem.

[0003] Currently, genes related to bacterial wilt resistance have been identified in several Solanaceae crops, including tomatoes, eggplants, potatoes, and peppers, as well as the model plant Arabidopsis thaliana. However, the discovery and research of bacterial wilt resistance genes in tobacco, one of my country's most important economic crops, has lagged behind. In recent years, transcriptome analysis of tobacco before and after bacterial wilt infection has revealed some genes induced by Ralstonia solanacearum infection. Overexpression of these genes in tobacco can enhance the bacterial wilt resistance of transgenic tobacco to some extent. For example, overexpression of transcription factors NtWRKY50 and NtPR-Q can induce upregulation of genes related to the synthesis of plant hormones SA and JA, enhancing plant resistance to the disease; overexpression of NtPR1a can activate the expression of related defense genes, enhancing the bacterial wilt resistance of transgenic plants; and overexpression of NtRNF217 can reduce the proliferation of Ralstonia solanacearum in transgenic tobacco. However, most of these genes are transcription factors, and their induced bacterial wilt resistance effects are limited. Therefore, it is necessary to discover more and more potent disease-resistant genes from tobacco to provide new genetic resources and strategies for breeding tobacco varieties resistant to bacterial wilt, which has important application prospects. Summary of the Invention

[0004] This invention provides an application of the disease resistance gene NtTBWRG1 in the control of bacterial wilt in tobacco. This disease resistance gene can be effectively used in the breeding of bacterial wilt-resistant tobacco varieties, achieving the goal of significantly enhancing the resistance of tobacco to bacterial wilt. The bacterial wilt disease index of the transgenic plants is 20-30, reaching the disease resistance level, which has important application value and good development prospects.

[0005] To achieve the above objectives, the present invention provides an application of the disease resistance gene NtTBWRG1 in the control of tobacco bacterial wilt caused by Ralstonia solanacearum, the coding sequence of which is shown in SEQ ID NO: 1.

[0006] This invention provides an application of overexpression of the NtTBWRG1 gene in significantly enhancing the resistance of tobacco to bacterial wilt, the coding sequence of which is shown in SEQ ID NO: 1.

[0007] This invention provides a method for constructing transgenic tobacco plants resistant to bacterial wilt, comprising the following steps:

[0008] Construct the expression vector 35S:NtTBWRG1 for the disease resistance gene NtTBWRG1;

[0009] The 35S:NtTBWRG1 expression vector was transformed into the susceptible tobacco variety Cuibi No. 1 CB-1 using Agrobacterium strain LBA4404-mediated leaf disc transformation. Transgenic tobacco plants with resistance to bacterial wilt were obtained by screening with hygromycin selection markers.

[0010] As a preferred option, the expression level of NtTBWRG1 in transgenic tobacco plants was 1.25 to 7.22 times higher than that in the non-transgenic control CB-1.

[0011] As a preferred option, the bacterial wilt disease index of transgenic tobacco plants is 20–30.

[0012] This invention provides the application of the disease resistance gene NtTBWRG1 in the preparation of a growth-promoting agent for tobacco plants, the coding sequence of which is shown in SEQ ID NO: 1.

[0013] Preferably, the agent that promotes tobacco plant growth is a microbial inoculant or a microbial fertilizer.

[0014] Compared with the prior art, the advantages and positive effects of the present invention are as follows:

[0015] Given the current lack of highly efficient and specific resistance genes in tobacco bacterial wilt breeding, this invention provides an effective resistance gene for the functional study of tobacco bacterial wilt resistance genes and for bio-breeding. This gene can be used to cultivate tobacco varieties resistant to bacterial wilt, achieving a significant enhancement of tobacco's resistance to the disease. The transgenic plants exhibit a bacterial wilt disease index of 20-30, reaching a resistance level. Therefore, this resistance gene has significant application value and promising development prospects in tobacco bio-breeding. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the bands of the obtained PCR product provided in an embodiment of the present invention;

[0017] Figure 2 This is a schematic diagram illustrating the construction process of the carrier pCAMBIA1300 provided in an embodiment of the present invention;

[0018] Figure 3The method for obtaining transgenic plants provided in the embodiments of the present invention;

[0019] Figure 4 Detection of NtTBWRG1 gene expression level in transgenic plants provided in embodiments of the present invention;

[0020] Figure 5 This is a schematic diagram of seedling disease resistance provided in an embodiment of the present invention;

[0021] Figure 6 This is a schematic diagram of seedling disease index provided in an embodiment of the present invention;

[0022] Figure 7 This is a schematic diagram illustrating the disease resistance of mature plants according to an embodiment of the present invention;

[0023] Figure 8 This is a schematic diagram of the disease index of adult plants provided in an embodiment of the present invention. Detailed Implementation

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Obtaining the PCR product of the disease resistance gene NtTBWRG1

[0026] RNA was extracted from the roots of tobacco variety CB-1 and analyzed using a reverse transcription kit. The One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcribes RNA into cDNA. The reverse transcription reaction system consists of: 1 μg total RNA, 1 μL anchored Oligo(dT)18 primer, and 10 μL 2×TS reaction mix. 1 μL of RT / RI Enzyme mix, 1 μL of gDNA remover, and RNase-free H2O were added to a total volume of 20 μL. The reaction program was: 42℃ for 30 min; 85℃ for 5 s.

[0027] Using cDNA as a template, gene amplification primers were used, and the high-fidelity enzyme TransStart FastPfu Fly DNA was employed to amplify the gene coding sequence. The PCR reaction mixture consisted of: 2 μL cDNA, 1 μL forward primer, 1 μL reverse primer, 10 μL 5×Fly buffer, 10 μL dNTP mix, 2 μL Pfu Fly, and 24 μL ddH2O, for a total volume of 50 μL. The gene amplification primers were:

[0028] NtTBWRG1-F:GGTACCaATGGCTGAAGCAGCAGTTTCC

[0029] NtTBWRG1-R:GGTACCTCAATCAGTATTGACATTCGT

[0030] The amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 3 min, 35 PCR cycles, 72℃ for 10 min.

[0031] The amplification products were subjected to agarose gel electrophoresis. After electrophoresis, the DNA fragments were recovered using a DNA fragment recovery kit manufactured by TransGen Biotech. PCR Purification Kit (PCR Purification Kit) recovers the target band, such as Figure 1 As shown, its size is 2856 bp, and the coding sequence of this gene is shown in SEQ ID NO: 1. For specific gel recovery procedures, please refer to the product manual.

[0032] Example 2: Construction of vector pCAMBIA1300

[0033] The recovered target band was ligated to the binary vector pCAMBIA1300 using an enzyme digestion and ligation method. First, the purified product and vector were digested with KpnI restriction endonuclease. The digestion reaction mixture was: DNA 20 μL, 5× buffer 10 μL, KpnI 5 μL, ddH2O 15 μL, total volume 50 μL. The digestion conditions were: 37℃ for 30 min, 85℃ for 5 s. After digestion, the DNA fragments were recovered using a DNA fragment recovery kit manufactured by TransGen Biotech. The PCR Purification Kit recovers DNA fragments and linearized vector fragments. For specific gel recovery procedures, please refer to its instruction manual.

[0034] The obtained enzyme-digested gene DNA fragment was ligated with the linearized vector fragment (using Thermo Fisher Scientific's T4 DNA ligase; ligation system according to the manufacturer's instructions). The ligation reaction mixture was gently mixed and incubated overnight at 16°C. Subsequently, a heat shock transformation was performed, adding 5 μL of the constructed vector to 50 μL of competent cells. Transformation conditions were: ice incubation for 30 min, heat shock at 42°C for 30 s, ice incubation for 5 min, then addition of 500 μL of liquid LB medium and activation of the cells at 37°C for 1 h. Finally, the cells were evenly spread on solid LB medium containing 50 mg / L kanamycin and incubated at 37°C for 8-10 h. After single colonies emerged, positive clones were identified by PCR and sequencing to confirm the presence of the correctly constructed 35S:NtTBWRG1 expression vector in *E. coli*. The construction process is as follows: Figure 2 As shown.

[0035] Example 3: Obtaining Transgenic Plants

[0036] Agrobacterium LBA4404 possesses the ability to infect plants and transfer genes; therefore, the constructed 35S:NtTBWRG1 expression vector needs to be transformed into Agrobacterium. The correctly sequenced vector was transformed into competent Agrobacterium LBA4404 cells using a freeze-thaw method. 5 μL of the vector was added to 50 μL of competent cells, mixed well, and incubated on ice for 5 min. After treatment with liquid nitrogen for 5 min, followed by incubation on ice for another 5 min, 500 μL of liquid LB medium was added. The cells were incubated at 28°C for 2 h, then evenly spread onto solid LB medium containing 50 mg / L kanamycin and rifampin, and incubated at 28°C for 2-3 days. After single colonies grew, positive clones were identified using PCR and sequencing to confirm that the 35S:NtTBWRG1 expression vector had been successfully transformed into Agrobacterium LBA4404.

[0037] The 35S:NtTBWRG1 expression vector was transformed into the susceptible tobacco variety CB-1 using Agrobacterium tumefaciens strain LBA4404-mediated leaf disc transformation. Transgenic positive plants were obtained by screening with hygromycin selection markers. DNA was further extracted from the transgenic plants and used as a template for PCR amplification using primers with a 35S-specific promoter. Fourteen positive plants were identified. The PCR reaction system consisted of: 1 μL DNA, 1 μL forward primer, 1 μL reverse primer, 10 μL 5× buffer, 10 μL dNTP mix, and a total gold nanoparticle (TNT) solution. DNA Polymerase 2 μL, ddH2O 25 μL, total volume 50 μL. 35S specific promoter primer sequence:

[0038] 35S-F: GAATTTCGACCTGCAGGT;

[0039] 35S-R: GATAGTGGGATTGTGCGT.

[0040] The amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 PCR cycles, 72℃ for 10 min. The amplification products were subjected to agarose gel electrophoresis. After EB staining, the electrophoretic bands were detected using ultraviolet light. Figure 3 As shown, a 582bp DNA band was amplified in the transgenic positive plants, while no amplified band was observed in the non-transgenic empty control (CB-1).

[0041] Example 4: Detection of NtTBWRG1 gene expression level in transgenic plants

[0042] Total RNA was extracted from the roots of transgenic plants and analyzed using a reverse transcription kit. One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcribes RNA into cDNA. The reverse transcription reaction system consists of: 1 μg total RNA, 1 μL anchored Oligo(dT)18 primer, and 10 μL 2×TS reaction mix. 1 μL of RT / RI Enzyme mix, 1 μL of gDNA remover, and RNase-free H2O were added to a total volume of 20 μL. The reaction program was: 42℃ for 15 min; 85℃ for 5 s.

[0043] The expression level of the NtTBWRG1 gene was detected using cDNA as a template and real-time quantitative PCR (qPCR) technology, with three biological replicates. Full-scale gold nanoparticles were used to detect the expression level of the NtTBWRG1 gene. qPCR reactions were performed using Green qPCR SuperMix. The reaction mixture consisted of 1 μL DNA, 0.4 μL forward primer, and 0.4 μL reverse primer. Green qPCRSuperMix 10 μL, ddH2O 8.2 μL, total volume 20 μL. PCR reactions were performed using an ABI 7500 PCR instrument under the following conditions: 94℃ for 30 s; 94℃ for 5 s, 60℃ for 34 s, for 40 PCR cycles. The expression level of NtTBWRG1 in the non-transgenic control variety CB-1 was set to 1.

[0044] like Figure 4 The qPCR results shown indicate that the expression level of NtTBWRG1 in transgenic plants #1-#14 was 1.25 to 7.22 times higher than that in the non-transgenic control.

[0045] Example 5 Seedling disease resistance

[0046] Using the susceptible variety CB-1 as a control, transgenic plants #3 and #9, which showed relatively high expression levels of NtTBWRG1, were selected for seedling inoculation to identify resistance to bacterial wilt. The experiment was conducted in triplicate, with 25 plants per replicate. Tobacco seedlings were cultured to the four-leaf stage in an artificial climate chamber at 25°C, and then inoculated with bacterial wilt pathogens via root drenching.

[0047] Inoculation conditions were as follows: Strain GMI1000 (NCBI accession number AF295251) was streaked onto TTC solid medium for activation and incubated at 30°C for 2–3 days. Colonies were then picked and cultured in LB liquid medium for expansion, incubating at 30°C and 200 rpm until OD reached [the desired growth rate]. 600 =1.0, dilute the bacterial culture to OD200. 600 =1.0 for later use. Inoculate 10 mL of diluted bacterial solution around the base of each tobacco plant and incubate for 2 weeks after inoculation. Incubation conditions are 35℃ and 80% relative humidity.

[0048] like Figure 5 The results showed that 14 days after inoculation, most of the non-transgenic control CB-1 plants had become infected and died, while most of the transgenic plants #3 and #9 continued to grow and develop normally, showing high resistance to bacterial wilt.

[0049] Example 6 Seedling Disease Index

[0050] Disease incidence was statistically analyzed in plants 14 days after inoculation, and the results are shown in Table 1. The statistical criteria were as follows:

[0051] Grade 0: The tobacco seedlings show no symptoms of disease;

[0052] Grade 1: 1-2 leaves are half-wilted, or the chlorotic streaks at the base of the stem account for less than 1 / 3 of the plant height;

[0053] Grade 3: 2-3 leaves are wilted, or chlorotic streaks at the base of the stem cover 1 / 3 to 1 / 2 of the plant height;

[0054] Grade 5: 1-2 healthy leaves, or chlorotic streaks at the base of the stem covering 1 / 2 to 2 / 3 of the plant height;

[0055] Level 7: All leaves are wilted, or the chlorotic streaks at the base of the stem cover more than 2 / 3 of the plant height;

[0056] Level 9: The entire plant has died.

[0057] Table 1 Disease incidence in seedlings

[0058] CB-1 0 0 5 11 24 35 #3 16 22 19 18 0 0 #9 35 25 12 3 0 0

[0059] The formula for calculating the disease index is:

[0060]

[0061] The results are as follows Figure 6 As shown, for the seedling disease index, the control variety CB-1 had an index of 83, while the transgenic plants #3 had an index of 25 and #9 had an index of 11. This also indicates that the higher the expression level of the NtTBWRG1 gene, the stronger the resistance of the transgenic plants to bacterial wilt.

[0062] Example 7 Disease resistance in mature plants

[0063] Using the susceptible variety CB-1 as a control, transgenic plants #3 and #9, which showed relatively high expression levels of NtTBWRG1, were selected for identification of bacterial wilt resistance at the mature stage. The experiment was conducted in triplicate, with 25 plants per replicate. In the experimental field, tobacco seedlings were allowed to grow naturally until July, when temperatures and humidity were high. On July 1st, the seedlings were inoculated with bacterial wilt pathogens via root drenching.

[0064] Inoculation conditions were as follows: Strain GMI1000 (NCBI accession number AF295251) was streaked onto TTC solid medium for activation and incubated at 30°C for 2–3 days. Colonies were then picked and cultured in LB liquid medium for expansion, incubating at 30°C and 200 rpm until OD reached [missing value]. 600 =1.0, dilute the bacterial culture to OD200. 600 =1.0 for backup. Inoculate 100mL of diluted bacterial solution around the base of each tobacco plant. Observe and count the disease incidence of the plants 60 days after inoculation.

[0065] Combination Figure 7 The results show that 60 days after field planting, most of the non-transgenic control variety CB-1 plants had withered and died, while most of the transgenic plants #3 and #9 continued to grow and develop normally, with green leaves, showing good resistance to bacterial wilt.

[0066] Example 8: Disease Index of Adult Plants

[0067] Disease incidence in plants 60 days after inoculation was statistically analyzed, and the results are shown in Table 2. The statistical criteria were as follows:

[0068] Grade 0: No disease symptoms on the entire plant;

[0069] Grade 1: Occasionally, there are chlorotic spots at the base of the stem;

[0070] Grade 3: The base of the stem has chlorotic spots or streaks, and a few leaves on one side are wilted;

[0071] Grade 5: Black streaks appear on the stem, but do not reach the top of the plant, or more than half of the leaves are wilted.

[0072] Level 7: Black streaks on the stem reach the top of the plant, or more than 2 / 3 of the leaves wither.

[0073] Level 9: The entire plant is basically dead.

[0074] Table 2 Disease incidence in mature plants

[0075]

[0076]

[0077] The formula for calculating the disease index is:

[0078]

[0079] Combination Figure 8 The results show that, for the disease index at the mature stage, the control variety was 90, while the transgenic plants #3 were 32 and #9 were 19. This also indicates that overexpression of the NtTBWRG1 gene significantly enhances the resistance of tobacco to bacterial wilt.

Claims

1. Disease-resistant genes NtTBWRG1 Its application in the control of tobacco bacterial wilt caused by Ralstonia solanacearum is characterized by... The coding sequence of the gene is shown in SEQ ID NO:

1.

2. Overexpression NtTBWRG1 The application of genes in enhancing resistance to bacterial wilt in tobacco is characterized by, The coding sequence of the gene is shown in SEQ ID NO:

1.

3. A method for constructing a transgenic tobacco plant resistant to bacterial wilt, characterized in that, Includes the following steps: Constructing disease-resistant genes NtTBWRG1 expression carrier 35S:NtTBWRG1, The coding sequence of the gene is shown in SEQ ID NO: 1; Leaf disc transformation mediated by Agrobacterium strain LBA4404 35S:NtTBWRG1 The expression vector was transferred into the susceptible tobacco variety Cuibi No. 1 CB-1, and transgenic tobacco plants with resistance to bacterial wilt were obtained by screening with hygromycin selection markers.

4. The construction method according to claim 3, characterized in that, In genetically modified tobacco plants NtTBWRG1 The expression level was 1.25 to 7.22 times higher than that of the non-transgenic control CB-1.

Images