Linear polyethyleneimine formulations having activity against porcine pseudorabies virus and uses thereof

Abstract

This invention discloses a polyethyleneimine preparation with anti-porcine pseudorabies virus activity and its application. This preparation can be used to prevent infection by PRV XJ5 and Ra strains of porcine pseudorabies virus. This invention belongs to the field of preventive veterinary technology. Experiments have demonstrated that the 25kDa linear polyethyleneimine preparation is highly effective in preventing porcine pseudorabies virus infection. The 25kDa linear polyethyleneimine, as the active ingredient, significantly reduces the adsorption of porcine pseudorabies virus to PK-15B6 cells, inhibiting the cytopathic effects caused by the virus. This invention provides a safe and effective biological agent for the prevention and control of pseudorabies virus.

Description

Technical Field

[0001] This invention belongs to the field of preventive veterinary technology, specifically relating to a linear polyethyleneimine preparation with anti-porcine pseudorabies virus activity and its application. Background Technology

[0002] Pseudorabies (PR) is an acute infectious disease caused by the pseudorabies virus (PRV). Pigs of all ages can be infected, and the clinical symptoms vary. Newborn piglets infected with PRV exhibit neurological symptoms such as respiratory distress and ataxia, and the disease can cause 100% mortality. Fattening pigs often show slowed growth or stunted growth. Pregnant sows may experience abortion, stillbirth, mummified fetuses, and fever. Infected boars may develop testicular atrophy or swelling, leading to infertility.

[0003] Varicellavirus (PRV) is a linear double-stranded DNA molecule belonging to the Herpesviridae family and the Varicellavirus genus. The viral particles are enveloped, providing strong resistance to the external environment. PRV infects a wide range of hosts, naturally infecting various animals including cattle, sheep, cats, dogs, and rodents. Pigs are considered natural hosts and reservoirs of PRV. Infected animals can transmit the virus through multiple routes, including the respiratory tract, digestive tract, milk, and reproductive tract, exhibiting rapid spread, multiple routes, wide distribution, and high mortality. Currently, there is no specific drug to treat this disease; vaccination is the most common prevention and control method. While vaccines such as the Bartha-K61 attenuated vaccine have effectively controlled PRV transmission, newly emerging PRV variants differ from classic PRV strains and exhibit significantly enhanced virulence. This means existing vaccines may not be sufficient to control current circulating PRV strains, posing a significant challenge to the global pig industry once again. Therefore, the prevention and control of PRV infection is particularly urgent and important, necessitating the development of effective, mild drugs with few adverse reactions and no toxic side effects to control PRV variants.

[0004] Cationic polymers are commonly used as DNA transfection agents by facilitating DNA entry into target cells. Studies have shown that many cationic polymers possess highly efficient antibacterial and antiviral activities, with polyethyleneimine (PEI) belonging to this category. However, the effects of PEI on PRV infection have not been reported. Summary of the Invention

[0005] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0007] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a linear polyethyleneimine formulation with anti-porcine pseudorabies virus activity.

[0008] As a preferred embodiment of the formulation of the present invention, the concentration of linear polyethyleneimine in the formulation is 1–8 μg / mL.

[0009] As a preferred embodiment of the formulation described in this invention, the formulation is a biological preparation made using 25kDa linear polyethyleneimine as the active pharmaceutical ingredient.

[0010] Another objective of this invention is to overcome the shortcomings of the prior art and provide a method for preparing a linear polyethyleneimine preparation with anti-porcine pseudorabies virus activity, comprising,

[0011] Linear polyethyleneimine was dissolved in ultrapure water, heated and stirred, filtered, and then dispensed and stored.

[0012] In a preferred embodiment of the preparation method described in this invention, the linear polyethyleneimine is dissolved in ultrapure water, wherein the linear polyethyleneimine is a 25 kDa linear polyethyleneimine; the ratio of linear polyethyleneimine to ultrapure water is 1 mg / mL.

[0013] In a preferred embodiment of the preparation method described in this invention, the heating and stirring are carried out at a temperature of 60–80°C.

[0014] In a preferred embodiment of the preparation method described in this invention, the dispensing and storage are carried out at a storage temperature of -20°C.

[0015] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of a linear polyethyleneimine preparation with anti-porcine pseudorabies virus activity in the prevention of herpesvirus infection.

[0016] As a preferred application of the present invention: wherein the prevention of herpesvirus infection is a porcine pseudorabies virus.

[0017] As a preferred application of the present invention, the strain of the porcine pseudorabies virus is PRVXJ5 and Ra strain.

[0018] As a preferred application of the present invention: wherein, in the prevention of herpesvirus infection, 25kDa linear polyethyleneimine prevents pseudorabies virus infection by inhibiting the adsorption of porcine pseudorabies virus to cells.

[0019] Beneficial effects of this invention:

[0020] The 25kDa linear polyethyleneimine used in this invention is widely available and inexpensive; the 25kDa linear polyethyleneimine has a significant effect against PRVXJ5 and Ra infection by significantly inhibiting the adsorption of the virus to PK-15B6 cells, thus preventing infection; the effective concentration of 25kDa linear polyethyleneimine against PRVXJ5 and Ra infection is low; the 25kDa linear polyethyleneimine is easy to synthesize and has low cytotoxicity. Attached Figure Description

[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0022] Figure 1 The graph shows the cytotoxicity assay results of 25kDa linear polyethyleneimine on PK-15B6 cells in Example 2 of this invention.

[0023] Figure 2 This is a graph showing the results of the assay of the effect of 25kDa linear polyethyleneimine on PRV and PCV2 infection in PK-15B6 cells in Example 3 of this invention; where A and B are Western blot and TCID, respectively. 50 The effect of linear polyethyleneimine on PCV2 infection in PK-15B6 cells was determined. C and D were Western blot and TCID assays, respectively. 50 The effect of linear polyethyleneimine on PRV Ra infection in PK-15B6 cells was determined. E, F, and G were Western blot, IFA, and TCID, respectively. 50 The effect of linear polyethyleneimine on PRV XJ5 infection in PK-15B6 cells was determined.

[0024] Figure 3 The image shows the Western blot results of the effect of 25kDa linear polyethyleneimine on PRV infection with different infection complexities in Example 4 of this invention; where A and B are the effects of linear polyethyleneimine on different MOIPRVXJ5 and Ra infections on PK-15B6 cells as determined by Western blot.

[0025] Figure 4 The figure shows the results of measuring the effect of 25kDa linear polyethyleneimine on PRV XJ5 adsorption and cell entry in PK-15B6 cells in Example 5 of this invention; where A, B, C and D are the results of Western blot, IFA, TCID50 and qPCR, respectively.

[0026] Figure 5 The figure shows the results of measuring the effect of 25kDa linear polyethyleneimine on PRV XJ5 cell entry in PK-15B6 cells in Example 6 of this invention; where A, B, C and D are the results of Western blot, IFA, TCID50 and qPCR, respectively.

[0027] Figure 6 The figure shows the results of measuring the effect of 25kDa linear polyethyleneimine on PRV XJ5 adsorption on PK-15B6 cells in Example 7 of this invention; where A, B, C and D are the results of Western blot, IFA, TCID50 and qPCR, respectively.

[0028] Figure 7 This is a graph showing the effect of 25kDa linear polyethyleneimine pretreatment on PRVXJ5 infection in Example 8 of the present invention; where A, B, C and D are the results of Western blot, TCID50, qRT-PCR and laser confocal microscopy, respectively. In Figure D, a, b, c, d, e and f are the Mock control group, 0 μg / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL and 8 μg / mL linear polyethyleneimine preparation treatment groups, respectively.

[0029] Figure 8 The figure shows the results of measuring the direct effect of 25kDa linear polyethyleneimine on PRV virus and its effect on PRV XJ5 replication in PK-15B6 cells in Example 9 of this invention; where A and B are the Western blot and TCID50 results of the direct effect of linear polyethyleneimine on PRV XJ5 activity, and C and D are the qPCR results of the effect of linear polyethyleneimine on PRVXJ5 replication 4h and 6h after infection, respectively. Detailed Implementation

[0030] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0031] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0032] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0033] The raw materials used in the embodiments of this invention were sourced from: PK-15B6 cells, which were preserved in the laboratory. PRV XJ5 (GenBank accession number: OP512542) and PCV2b strains were isolated and preserved in the laboratory, and the classic PRV Ra strain was purchased from the China Institute of Veterinary Drug Control and preserved in our laboratory.

[0034] 25kDa linear polyethyleneimine (PEI) was purchased from Polysciences (catalog number: 23966); fetal bovine serum was purchased from Lonsera (catalog number: S711-001S); Dulbecco's Modified Eagle's Medium-high glucose (DMEM) and FITC-labeled goat anti-pig IgG were purchased from Sigma (catalog numbers: D5648; F1638); AceQ qPCR ProbeMaster Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. (catalog number: Q112-02); phalloidin-Alexa Fluor 568 was purchased from Invitrogen (catalog number: A12380); 4% cell tissue fixative was purchased from Solarbio Science & Technology Co., Ltd. (catalog number: P1110); gB and Cap monoclonal antibodies and PRV porcine positive serum were provided by our laboratory; β-actine mouse monoclonal antibody and horseradish peroxidase (HRP)-labeled goat anti-mouse IgG were purchased from TransGen Biotech Ltd. (catalog numbers: HC201-01; HS201-01); CCK-8 kit and DAPI staining solution were purchased from Beyotime Biotechnology Co., Ltd. (catalog numbers: C0041; C1005).

[0035] The testing methods used in the embodiments of this invention are as follows:

[0036] CCK-8 Test Evaluation:

[0037] PK-15B6 cells were loaded at a rate of 4 × 10⁻⁶. 4Cells were seeded per well in 96-well cell culture plates and incubated at 37°C with 5% CO2 for approximately 12 hours. When cells reached approximately 70% confluence, the culture medium was discarded, and the cells were washed three times with PBS. The linear polyethyleneimine preparation was diluted with medium containing 2% serum to different concentrations (2 μg / mL, 4 μg / mL, 8 μg / mL, 10 μg / mL, 12 μg / mL) and treated with the solution. After 24 hours of culture, 10 μL of CCK-8 solution was added to each well, and after incubation for 1 hour, the OD value was measured using a microplate reader. 450 The absorbance value at nm was set in 6 duplicate wells for each group.

[0038] Western blot experiment:

[0039] Cell lysis buffer was added to a cell plate, cell samples were collected, and 2× protein loading buffer was added. The plate was heated at 96°C for 15 min. Equal volumes of whole-cell proteins were separated by 10% separating gel electrophoresis. Electrophoresis conditions were: 80V for the stacking gel and 120V for the separating gel. After electrophoresis, proteins were transferred to an NC membrane using a wet transfer method. Transfer conditions were: constant current of 200mA at 4°C for 100 min. The NC membrane was then blocked with 5% skim milk at room temperature for 2 h. Subsequently, the NC membrane was incubated with primary and secondary antibodies. The primary antibody incubation was overnight at 4°C, and the secondary antibody incubation was 2 h at room temperature. Finally, an exposure solution was prepared, and the NC membrane was immersed in the exposure solution for approximately 1 min before development using a protein gel imaging system.

[0040] TCID 50 test:

[0041] Vero cells were divided into 4×10 4 Cells were seeded at a density of approximately 10 / well in 96-well plates and incubated at 37°C with 5% CO2 for about 12 hours. Once the cells reached approximately 70% confluence, the virus solution was serially diluted 10-fold, with each subsequent dilution bringing the final result to 10⁻⁶. -8 After dilution, cells were seeded into 96-well plates, with each dilution repeated 8 times. After incubation at 37°C for 1.5 h, the cell supernatant was discarded, and the cells were washed three times with PBS. DMEM medium containing 2% fetal bovine serum was then added. 72 h post-infection, the cytopathic effect (CPE) was observed under a microscope, and the TCID of the samples was calculated using the Reed-Muench method. 50 .

[0042] IFA Trial:

[0043] Discard the supernatant from the cell culture plate, add 4% cell tissue fixative, and incubate at 37°C for 15 min. After fixation, discard the fixative, permeabilize with 0.1% Triton X-100 at 37°C for 10 min, then block with 5% BSA overnight at 4°C. After blocking, add 1:200 diluted PRV porcine positive serum and incubate at 37°C for 2 h. After primary antibody incubation, incubate with 1:200 diluted FITC-labeled goat anti-porcine secondary antibody at 37°C in the dark for 1 h. After incubation, incubate the cell culture plate with DAPI staining solution at room temperature in the dark for 5-7 min. Finally, observe the fluorescence under an inverted fluorescence microscope and take photos under 100x magnification. Wash with PBS three times between each step, and aspirate the liquid completely after the last wash.

[0044] qPCR detection:

[0045] First, viral genomic DNA was extracted using the phenol-chloroform extraction method. After centrifuging the viral sample, 500 μL of the supernatant was transferred to a 1.5 mL centrifuge tube. 92 μL of 10% SDS and 8 μL of proteinase K were added, and the mixture was vortexed and incubated at 58°C for 2 hours. After incubation, an equal volume of phenol-chloroform was added, the mixture was vigorously vortexed for 30 seconds, allowed to stand for 2-5 minutes, and then centrifuged at 12000 rpm for 15 minutes. After centrifugation, 400 μL of the aqueous layer was transferred to a new centrifuge tube, and twice the volume of pre-chilled anhydrous ethanol was added. The mixture was repeatedly inverted and incubated at -20°C for 30 minutes. The settled sample was centrifuged at 12000 rpm for 10 minutes at 4°C, the liquid in the tube was discarded, and the sample was washed with 700 μL of anhydrous ethanol and centrifuged at 12000 rpm for 5 minutes. After centrifugation, the liquid in the tube was discarded, the sample was air-dried at room temperature for 5 minutes, and then 100 μL of sterile water was added. The sample was then incubated at 37°C for 30 minutes to dissolve. The extracted viral genomic DNA was analyzed by qPCR. The reaction system was prepared according to the AceQ qPCR ProbeMasterMix kit, and the reaction conditions were: 95℃ pre-denaturation for 60 s, 95℃ denaturation for 10 s, and 62℃ annealing for 20 s, for a total of 45 cycles. The primer sequences were: gB94-F: ACAAGTTCAAGGCCCACATCTAC, gB94-R: GTCCGTGAAGCGGTTCGTGAT.

[0046] Example 1

[0047] A method for preparing a polyethyleneimine preparation with anti-porcine pseudorabies virus activity includes the following steps:

[0048] Linear polyethyleneimine was dissolved in sterile ultrapure water with continuous stirring and heating (60-80℃) during dissolution. After dissolution, it was filtered through a 0.22μm filter membrane for sterilization to prepare a linear polyethyleneimine preparation with a storage concentration of 1mg / mL. After dispensing, it was stored at -20℃.

[0049] Example 2

[0050] The determination of the cytotoxicity of polyethyleneimine formulations against PK-15B6 cells includes the following steps:

[0051] PK-15B6 cells were loaded at a rate of 4 × 10⁻⁶. 4 Cells were seeded in 96-well cell culture plates and incubated at 37°C with 5% CO2 for approximately 12 hours. When cells reached approximately 70% confluence, the culture medium was discarded, and the cells were washed three times with PBS. The linear polyethyleneimine preparation was diluted with culture medium containing 2% serum to different concentrations (2 μg / mL, 4 μg / mL, 8 μg / mL, 10 μg / mL, 12 μg / mL) to treat the cells. After 24 hours of culture, 10 μL of CCK-8 solution was added to each well, and after incubation for 1 hour, the absorbance at OD450 nm was measured using a microplate reader. Six replicates were set up for each group.

[0052] The activity of linear polyethyleneimine against PK-15B6 cells was evaluated using the CCK-8 assay at concentrations of 2 μg / mL, 4 μg / mL, 8 μg / mL, 10 μg / mL, and 12 μg / mL. The results are as follows: Figure 1 As shown, linear polyethyleneimine exhibits significant cytotoxic effects on PK-15B6 cells at concentrations as high as 12 μg / mL.

[0053] Example 3

[0054] To investigate the effects of linear polyethyleneimine on PRV strains and PCV2 infection, cells were pretreated with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) for 1 h. Then, PK-15B6 cells were infected for 24 h in the presence of different concentrations of linear polyethyleneimine. Cell samples were collected for analysis, including the following steps:

[0055] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS. Cells were then pretreated for 1 hour with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) diluted in DMEM. After incubation, 0.1 MOI IPRV XJ5, Ra, and PCV2 cells were seeded in the presence of linear polyethyleneimine. One hour after infection, the cells were washed three times with PBS, replaced with DMEM containing 2% fetal bovine serum for growth maintenance, and the appropriate concentration of linear polyethyleneimine was added. Twenty-four hours after infection, cell protein samples and cell supernatants were collected for Western blot analysis and TCID assay. 50 The same cells were then fixed for use in IFA experiments.

[0056] Western blot, TCID 50 The results of the experiment and the IFA experiment are as follows Figure 2 As shown, Western blot results indicated that linear polyethyleneimine significantly inhibited the expression of gB protein in PRVXJ5 and Ra-infected cells but did not affect PCV2 Cap expression; IFA results confirmed that linear polyethyleneimine inhibited PRVXJ5 infection in a dose-dependent manner; TCID 50 The viral titers in the supernatants of PRV and PCV2-infected cells were measured. Treatment with linear polyethyleneimine significantly reduced the viral titer in the supernatant but did not affect the PCV2 viral titer. These results indicate that linear polyethyleneimine specifically inhibits PRV infection but not PCV2 infection.

[0057] Example 4

[0058] To further investigate whether the inhibitory effect of linear polyethyleneimine on PRVXJ5 and Ra infection is affected by the MOI of infection, PK-15B6 cells were infected with different MOIs of PRVXJ5 and Ra in the presence of different concentrations of linear polyethyleneimine (4 μg / mL, 8 μg / mL) for 24 h. Cell protein samples were collected for Western blot analysis, including the following steps:

[0059] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5Cells were seeded in 12-well plates. When the cell density reached 70%–80%, the cells were washed three times with PBS. Cells were then pretreated for 1 hour with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) diluted in DMEM. After incubation, cells were seeded with 0.1 MOI, 0.5 MOI, 1 MOI, and 2 MOI of IPRV XJ5 and Ra, with the linear polyethyleneimine present. One hour after infection, the cells were washed three times with PBS, replaced with DMEM containing 2% fetal bovine serum for growth maintenance, and the corresponding concentration of linear polyethyleneimine was added. Twenty-four hours after infection, cellular protein samples were collected for Western blot analysis.

[0060] Western blot results are as follows Figure 3 As shown, the results indicate that linear polyethyleneimine significantly inhibits the expression of gB protein in cells infected with different MOIPRV XJ5 and Ra strains. In conclusion, the low cytotoxicity and significant inhibitory effect of linear polyethyleneimine formulations on PRV XJ5 infection suggest that it could be a viable option for PRV infection prevention.

[0061] Example 5

[0062] To investigate the mechanism by which linear polyethyleneimine exerts its antiviral effect during PRV XJ5 infection, the effects of linear polyethyleneimine on PRV XJ5 adsorption and entry into PK-15B6 cells were first explored, including the following steps:

[0063] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5 Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS. 1 mL of pre-chilled DMEM diluted with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) was added, and 0.1 MOIPRV XJ5 cells were seeded. After 1 h of infection at 4°C, the cells were washed three times with PBS, and 1 mL of DMEM containing 2% fetal bovine serum was added, along with the corresponding concentration of linear polyethyleneimine. After incubation at 37°C for 1 h, the cells were washed three times with citric acid solution, then three times with PBS, and finally replaced with DMEM containing 2% fetal bovine serum to maintain growth. 24 h after infection, cell protein samples and cell supernatant were collected for Western blot and TCID50 assays. Cells treated in the same way were fixed for IFA assays.

[0064] PK-15B6 cells were treated using the above method. Two hours after infection, the cells were washed three times with PBS, and viral DNA was extracted by repeatedly freezing and thawing three times with 1 mL of LDMMEM. The viral DNA copy number was then detected by qPCR.

[0065] The test results are as follows Figure 4 As shown, Western blot results indicate that linear polyethyleneimine significantly inhibits the expression of gB protein in PRVXJ5-infected cells, especially with treatments of 4 μg / mL and 8 μg / mL linear polyethyleneimine, which resulted in a highly significant decrease in gB protein expression levels. The results of IFA, TCID50, and qPCR experiments were consistent with those of the Western blot experiments, indicating that linear polyethyleneimine significantly inhibits PRVXJ5 adsorption and cell entry in a dose-dependent manner.

[0066] Example 6

[0067] To investigate the regulatory role of linear polyethyleneimine in the adsorption and entry of PRV XJ5 into cells, the effect of linear polyethyleneimine on PRV XJ5 entry into PK-15B6 cells was studied, including the following steps:

[0068] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5 Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS, and 1 mL of pre-chilled DMEM was added, followed by seeding with 0.1 MOI of PRVXJ5 cells. After 1 h of infection at 4°C, the cells were washed three times with PBS, and 1 mL of DMEM containing 2% fetal bovine serum was added, along with the appropriate concentration of linear polyethyleneimine. After incubation for 1 h, the cells were washed three times with citric acid solution, then three times with PBS, and finally replaced with DMEM containing 2% fetal bovine serum to maintain growth. 24 h after infection, cell protein samples and cell supernatant were collected for Western blot and TCID50 assays. Cells treated in the same way were fixed for IFA assays.

[0069] PK-15B6 cells were treated using the above method. Two hours after infection, the cells were washed three times with citric acid solution, then three times with PBS, and 1 mL of LDMMEM was added to extract viral DNA through repeated freeze-thaw cycles. The viral DNA copy number was then detected by qPCR.

[0070] The test results are as follows Figure 5 As shown, Western blot results indicated that linear polyethyleneimine only inhibited viral gB protein expression at a concentration of 8 μg / mL; the results of TCID50 assay for viral titer in cell supernatant were consistent with those of Western blot; while IFA and qPCR results showed that linear polyethyleneimine had no significant effect on PRVXJ5 cell entry.

[0071] Example 7

[0072] To investigate the effect of linear polyethyleneimine on the adsorption of PRV XJ5, PK-15B6 cells were seeded with 0.1 MOI PRV XJ5 at 4℃ and treated with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) for 1 h. Cells were collected 24 h after infection for analysis, including the following steps:

[0073] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5 Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS. Different concentrations of linear polyethyleneimine preparations (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) diluted in pre-chilled DMEM were added, and the cells were seeded into 0.1 MOI PRVXJ5 cells. After 1 h of infection at 4°C, the cells were washed three times with PBS and then replaced with DMEM containing 2% fetal bovine serum to maintain growth. 24 h after infection, cell protein samples and cell supernatant were collected for Western blot and TCID50 assays. Cells treated in the same way were then fixed for IFA assays.

[0074] PK-15B6 cells were treated using the above method. One hour after infection, the cells were washed three times with PBS, and viral DNA was extracted by repeatedly freezing and thawing three times with 1 mL of DMEM. The viral DNA copy number was then detected by qPCR.

[0075] The test results are as follows Figure 6 As shown, Western blot results indicated that different concentrations of linear polyethyleneimine significantly inhibited the expression of gB protein in PRV XJ5-infected cells; IFA results confirmed that linear polyethyleneimine significantly inhibited PRV XJ5 infection in a dose-dependent manner; TCID50 results of the supernatant showed that linear polyethyleneimine significantly reduced the viral titer in the supernatant; and qPCR results showed that linear polyethyleneimine significantly reduced the copy number of adsorbed virus. These results indicate that linear polyethyleneimine significantly inhibited PRV XJ5 adsorption onto PK-15B6 cells.

[0076] Example 8

[0077] To investigate the effect of linear polyethyleneimine pretreatment on PRV XJ5 infection, PK-15B6 cells were pretreated with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) for 2 h, then seeded with 0.1 MOI PRV XJ5 cells. Cells were collected for analysis 24 h after infection, including the following steps:

[0078] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS. Cells were then pretreated for 2 hours with different concentrations of linear polyethyleneimine (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) diluted in DMEM. After incubation, 0.1 mL of MOIPRV XJ5 cells were seeded and incubated for 1 hour. Cells were then washed three times with PBS and replaced with DMEM containing 2% fetal bovine serum to maintain growth. 24 hours after infection, cell protein samples were collected for Western blot and TCID50 assays. PK-15B6 cells were treated using the same method. After 1 hour of infection, cells were washed three times with PBS, and viral DNA was extracted by repeatedly freezing and thawing three times with 1 mL of DMEM for qPCR detection of viral DNA copy number.

[0079] Similarly, pretreated PK-15B6 cells were seeded with 10 MOI of PRVXJ5 and infected at 4°C for 1 h. After washing 5 times with pre-cooled PBS, 4% cell fixative was added and fixed at room temperature for 20 min. After fixation, the cells were washed 5 times with PBS and treated with 0.5% Triton-X-100 permeabilization buffer, incubated at 37°C for 15 min, washed 5 times with PBS, and blocked overnight at 4°C with 5% BSA. After blocking, 400-fold diluted positive serum from PRV pigs (prepared in the laboratory) was added, and the cells were incubated at 37°C for 1 h. After incubation, the cells were washed 5 times with PBS, and 200-fold diluted FITC-labeled goat anti-pig secondary antibody was added. The cells were incubated at 37°C in the dark for 1 h. After secondary antibody incubation, the cells were washed 5 times with PBS, and diluted phalloidin-Alexa Fluor was added. 568, stain at room temperature in the dark for 60 min; after staining the cell membrane, wash 5 times with PBS, add an appropriate amount of DAPI staining solution, and let stand at room temperature for 3-5 min; after staining, wash 5 times with PBS, carefully pick out the cell smears, mount them, dry them, and observe them under a fluorescence laser confocal microscope.

[0080] The test results are as follows Figure 7 As shown, Western blot results indicated that linear polyethyleneimine significantly inhibited the expression of gB protein in PRV XJ5-infected cells. Figure 7 A; The TCID50 results of the supernatant showed that linear polyethyleneimine significantly reduced the viral titer in the supernatant. Figure 7 B.

[0081] To further investigate whether linear polyethyleneimine pretreatment of cells inhibits PRV XJ5 infection by affecting its adsorption to cells, we conducted qPCR experiments. The results showed that linear polyethyleneimine significantly reduced the number of DNA copies adsorbed by PRV XJ5. (See attached data). Figure 7C. Meanwhile, laser confocal microscopy results showed that pretreatment with different concentrations of linear polyethyleneimine significantly reduced the number of virus particles adsorbed onto cells. Figure 7 D. The above results indicate that pretreatment of cells with linear polyethyleneimine inhibits infection by suppressing the adsorption of PRVXJ5.

[0082] Example 9

[0083] To elucidate the effect of linear polyethyleneimine on PRVXJ5 replication, PK-15B6 cells were infected with PRV XJ5 for 1 h, then treated with linear polyethyleneimine for 3 h and 5 h. Cell samples were collected at 4 h and 6 h post-infection to detect viral copy number. To investigate whether linear polyethyleneimine directly affects the infectivity of PRVXJ5, PRVXJ5 was first incubated with different concentrations of linear polyethyleneimine at 37°C for 1 h, then PK-15B6 cells were infected. Cells were collected 24 h after infection for analysis, including the following steps:

[0084] PK-15B6 cells were loaded at a rate of 2 × 10⁻⁶. 5 Cells were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were washed three times with PBS and then seeded with 0.1 MOI RVXJ5 cells. One hour after infection, the cells were washed three times with PBS and then replaced with DMEM containing 2% fetal bovine serum to maintain growth. Appropriate concentrations of linear polyethyleneimine were added (1 μg / mL, 2 μg / mL, 4 μg / mL, and 8 μg / mL). Four and six hours after infection, the cells were washed three times with PBS and then subjected to three freeze-thaw cycles with 1 mL of DMEM to extract viral DNA. Viral DNA copy number was detected by qPCR. The qPCR results are shown below. Figure 8 As shown in C and 8D, it can be seen that linear polyethyleneimine treatment of PK-15B6 cells does not affect the replication of PRVXJ5.

[0085] Different concentrations of linear polyethyleneimine preparations diluted in DMEM (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL) were mixed with 0.1 MOIPRV XJ5 and incubated for 1 h. After incubation, PK-15B6 cells were inoculated and infected in an incubator for 1 h. Cells were then washed three times with PBS and replaced with DMEM containing 2% fetal bovine serum to maintain growth. 24 h after infection, cell protein samples and supernatants were collected for Western blot and TCID50 assays. The results of the Western blot and TCID50 assays are shown below. Figure 8 As shown in A and 8B, it can be seen that linear polyethyleneimine cannot directly inhibit the infection activity of PRVXJ5.

[0086] This invention uses 25 kDa linear polyethyleneimine to investigate its effect on PRV infection. Studies show that linear polyethyleneimine exhibits significant cytotoxicity only at concentrations above 10 μg / mL, and treatment with 1 μg / mL of linear polyethyleneimine significantly inhibits PRVXJ5 infection. Further studies indicate that linear polyethyleneimine significantly inhibits PRVXJ5 infection by suppressing its adsorption to cells. In summary, this invention provides a novel use of 25 kDa linear polyethyleneimine as a drug for the prevention of PRV infection.

[0087] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. Use of 25 kDa linear polyethyleneimine in the manufacture of a preparation against or preventing porcine pseudorabies virus infection, characterized in that: The concentration of linear polyethyleneimine in the formulation is 1~8 μg / mL; The strain of the porcine pseudorabies virus is PRV XJ5 or Ra strain. The method for preventing porcine pseudorabies virus infection involves using 25 kDa linear polyethyleneimine to inhibit the adsorption of porcine pseudorabies virus to cells.

2. Use according to claim 1, characterized in that: The preparation method of the linear polyethyleneimine formulation is as follows: Linear polyethyleneimine was dissolved in ultrapure water, heated and stirred, filtered, and then dispensed and stored.

3. Use according to claim 2, characterized in that: The linear polyethyleneimine is dissolved in ultrapure water, wherein the linear polyethyleneimine is 25 kDa linear polyethyleneimine; the ratio of linear polyethyleneimine to ultrapure water is 1 mg / mL.

4. The use according to claim 2, characterized in that: The heating and stirring process involves heating at a temperature of 60-80°C.

5. The use according to claim 2, characterized in that: The product is packaged and stored at a temperature of -20°C.

Images