Parthenogenic haploid induction gene NtDMP and application thereof
Patent Information
- Application Number
- CN202311215614.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-12-03
- Filing Date
- 2021-12-02
- Publication Date
- 2026-09-11
- Estimated Expiration
- 2041-12-02
AI Technical Summary
但该基因仅在单子叶作物中具有较高保守性,由此在双子叶作物上的应用存在一定限制
Smart Images

Figure BDA0004458851640000071 
Figure HDA0004458851740000011 
Figure HDA0004458851740000012
Abstract
Description
[0001] This application is a divisional application of application number 202111462060.1, application date 2021.12.02, entitled "Parthenogenesis Haploid Induced Gene and Its Application". Technical Field
[0002] This invention relates to the fields of agricultural biotechnology and crop genetics and breeding, primarily based on genome editing technology. Specifically, it relates to a method for preparing a plant maternal haploid inducing line and its application, particularly to the application of a NtDMP mutant of the parthenogenetic haploid inducing gene obtained using gene editing technology as a plant haploid inducing plant to produce maternal haploids. Background Technology
[0003] Field crop production is a vital material foundation for human survival. Botanically, it can be divided into two main categories: monocotyledonous crops and dicotyledonous crops. Monocotyledonous crops mainly include rice, wheat, and corn, while dicotyledonous crops mainly include soybeans, rapeseed, cotton, tomatoes, and cucumbers. For both monocotyledonous and dicotyledonous crops, pure-line creation is a crucial step in the breeding process. Haploid breeding technology can accelerate the pure-line selection process, and when combined with gene editing technology, it can achieve rapid and targeted improvement of inbred lines, greatly improving breeding efficiency and representing a common key technology in crop breeding. Currently, haploid breeding technology has been widely applied in corn breeding, and the key gene controlling haploid induction in corn has been cloned, providing a reference path for constructing a haploid breeding technology system based on hybridization induction in other crops. Currently, the phospholipase gene ZmPLA1 has been successfully haploidized in rice and wheat. However, this gene is highly conserved only in monocotyledonous crops, thus limiting its application in dicotyledonous crops.
[0004] Currently, the generation of haploids in dicotyledonous crops mainly relies on anther culture, which is inefficient and highly dependent on the genotype of the material, making large-scale application difficult. Although introducing genetically modified centromere-specific histone CENH3 into Arabidopsis thaliana cenh3 mutants can induce haploid generation, this method produces a large number of euploids during the induction process, which limits its application in breeding to some extent. Summary of the Invention
[0005] This invention first provides new uses for the proteins shown in B1), B2), B3), or B4);
[0006] B1) The amino acid sequence is the protein shown in sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18;
[0007] B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 2, 4, 6, 8, 10, 12, 14, 16, or 18.
[0008] B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in sequence 2, 4, 6, 8, 10, 12, 14, 16, or 18.
[0009] B4) Proteins that share 75% or more homology with the amino acid sequences shown in sequence 2, 4, 6, 8, 10, 12, 14, 16, or 18 and have the same function.
[0010] This invention provides the application of proteins shown in B1), B2), B3), or B4) in regulating the haploid induction ability or fruit number in plants.
[0011] The regulation of plant haploid induction ability is manifested as follows: when the activity of the aforementioned proteins in the plant is inhibited, the plant becomes a haploid induction line; when the aforementioned proteins are expressed or their activity is increased, the plant's haploid induction ability decreases or is absent. Inhibition of protein activity means that the protein is not expressed or is inactive. Specifically, the decrease or absence of plant haploid induction ability is manifested as an increase in the number of fruits (such as siliques) of the plant.
[0012] The regulation of plant fruit number is manifested as follows: when the activity of the aforementioned proteins in the plant is inhibited, the number of plant fruits (e.g., siliques) decreases; when the aforementioned proteins are expressed or their activity is increased, the number of plant fruits (e.g., siliques) increases. Inhibition of protein activity means that the protein is not expressed or that the protein is inactive.
[0013] In B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0014] In B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0015] In B4 above, the 75% or more homology can be 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology.
[0016] This invention also provides new uses for biomaterials related to the aforementioned proteins;
[0017] The biomaterial is any one of the following A1) to A12):
[0018] A1) Nucleic acid molecules that encode the above proteins;
[0019] A2) An expression cassette containing the nucleic acid molecules described in A1);
[0020] A3) A recombinant vector containing the nucleic acid molecules described in A1);
[0021] A4) A recombinant vector containing the expression cassette described in A2);
[0022] A5) Recombinant microorganisms containing the nucleic acid molecules described in A1);
[0023] A6) Recombinant microorganisms containing the expression cassette described in A2);
[0024] A7) Recombinant microorganisms containing the recombinant vector described in A3);
[0025] A8) Recombinant microorganisms containing the recombinant vector described in A4);
[0026] A9) Transgenic plant cell lines containing the nucleic acid molecules described in A1);
[0027] A10) A transgenic plant cell line containing the expression cassette described in A2);
[0028] A11) Transgenic plant cell lines containing the recombinant vector described in A3);
[0029] A12) Transgenic plant cell lines containing the recombinant vector described in A4).
[0030] This invention provides the application of biomaterials related to the aforementioned proteins in regulating the haploid induction ability or fruit number in plants.
[0031] In A1) above, the nucleic acid molecule is a gene as shown in C1) or C2) or C3) or C4) below:
[0032] C1) cDNA or genomic DNA molecules shown in sequence 1, 3, 5, 7, 9, 11, 13, positions 33-767 of sequence 15, or positions 32-434 of sequence 17;
[0033] cDNA or genomic DNA molecules that have 70% or more identity with the nucleotide sequences defined by C2 and C1;
[0034] C3) is a cDNA or genomic DNA molecule derived from dicotyledonous plants and having 70% or more identity with the nucleotide sequence defined by C1;
[0035] C4) cDNA or genomic DNA molecules that hybridize under strict conditions with nucleotide sequences defined by C1, C2, or C3.
[0036] The aforementioned genes have the following functions: when these genes are suppressed or knocked out in a plant, the plant becomes a haploid inducible line; when these genes are expressed in a plant, the haploid induction ability of the plant decreases, and the number of fruits increases. The suppression is complete suppression.
[0037] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequences shown in the coding sequences 2, 4, 6, 8, 10, 12, 14, 16, or 18 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0038] This invention also provides new uses for the substances shown in m1 or m2:
[0039] m1, substances that inhibit the activity of the aforementioned proteins in plants;
[0040] m2. Substances that inhibit the expression of genes encoding the above-mentioned proteins in plants or substances that knock out genes encoding the above-mentioned proteins in plants.
[0041] This invention provides the application of the substance shown in m1 or m2 in cultivating plant haploid induction lines, cultivating plant haploids, or improving the haploid induction ability of plants.
[0042] In the above applications, the substance that inhibits the activity of the above-mentioned proteins in plants can be any substance that can cause the loss of the activity of the above-mentioned proteins in plants, such as proteins, peptides or small molecule compounds (e.g., protein activity inhibitors) that inhibit the synthesis of the above-mentioned proteins, promote the degradation of the above-mentioned proteins or inhibit the function of the above-mentioned proteins.
[0043] The substance that inhibits the expression of the gene encoding the above-mentioned protein in the plant can be any substance that can prevent the gene encoding the above-mentioned protein in the plant from being expressed, such as substances that silence the gene encoding the above-mentioned protein in the plant (e.g., miRNA, siRNA, dsRNA, shRNA, etc.).
[0044] The knockout means that the host cell carrying the knockout substance does not produce the functional protein product of the gene. The knockout substance can be any substance that prevents the host cell from producing the functional protein product of the gene, such as removing all or part of the coding gene sequence, introducing frameshift mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent the coding gene sequence from being transcribed, or blocking translation by binding to mRNA. Typically, knockout is performed at the genomic DNA level, so that the cell's offspring also permanently carry the knockout. Furthermore, the substance that knocks out the gene encoding the aforementioned protein in the plant can be any substance capable of causing mutations in the gene encoding the aforementioned protein in the plant (the mutations can be deletion mutations and / or insertion mutations and / or base substitutions) thereby rendering it inactive, such as the zinc finger protein (ZFN) gene editing system, the TALENs gene editing system, or the CRISPR / Cas9 gene editing system. Even further, the substance that knocks out the gene encoding the aforementioned protein in the plant is the CRISPR / Cas9 gene editing system.
[0045] The present invention also provides a method for preparing a plant haploid induction line.
[0046] The method for preparing the plant haploid induction line provided by this invention is as follows (D1) or (D2):
[0047] D1) Inhibit the activity of the above proteins in the recipient plant to obtain a plant haploid inducible line;
[0048] D2) Inhibit the expression of the gene encoding the above protein in the recipient plant or knock out the gene encoding the above protein in the recipient plant to obtain a plant haploid inducible line.
[0049] The present invention also provides a method for preparing a plant haploid induction line.
[0050] The method for preparing plant haploid inducing lines provided by the present invention includes the step of self-pollinating the plant haploid inducing lines prepared according to the above-described method.
[0051] The present invention also provides a method for improving the haploid induction ability of plants.
[0052] The method for improving the haploid induction ability of plants provided by the present invention includes the following steps: inhibiting the activity of the above-mentioned protein in the recipient plant, or inhibiting the expression of the gene encoding the above-mentioned protein in the recipient plant, or knocking out the gene encoding the above-mentioned protein in the recipient plant, to obtain a plant haploid induction line; the haploid induction ability of the plant haploid induction line is higher than that of the recipient plant.
[0053] In the above method for preparing plant haploid inducible lines, the number of self-crossings is at least once, specifically once.
[0054] The method for preparing the above-mentioned plant haploid induction lines also includes a step of screening homozygous mutants. The homozygous mutant is a plant individual in which the two homologous chromosomes encoding the above-mentioned protein have undergone the same mutation.
[0055] Furthermore, when the recipient plant is rapeseed, the gene is the BnDMP1A gene and / or the BnDMP2A gene and / or the BnDMP1C gene and / or the BnDMP2C gene; the method is to inhibit the expression of the BnDMP1A gene and / or the BnDMP2A gene and / or the BnDMP1C gene and / or the BnDMP2C gene in rapeseed or to knock out the BnDMP1A gene and / or the BnDMP2A gene and / or the BnDMP1C gene and / or the BnDMP2C gene in rapeseed to obtain transgenic rapeseed, which is the rapeseed boloid inducible line;
[0056] When the recipient plant is tobacco, the gene is the NtDMP1 gene and / or the NtDMP2 gene and / or the NtDMP3 gene; the method is to inhibit the expression of the NtDMP1 gene and / or the NtDMP2 gene and / or the NtDMP3 gene in tobacco or to knock out the NtDMP1 gene and / or the NtDMP2 gene and / or the NtDMP3 gene in tobacco to obtain transgenic tobacco, which is the tobacco haploid inducible line;
[0057] When the recipient plant is cotton, the gene is the GhDMP1 gene and / or the GhDMP2 gene; the method is to inhibit the expression of the GhDMP1 gene and / or the GhDMP2 gene in cotton or knock out the GhDMP1 gene and / or the GhDMP2 gene in cotton to obtain transgenic cotton, which is the cotton haploid inducible line.
[0058] When the recipient plant is soybean, the gene is the GmDMP1 gene and / or the GmDMP2 gene; the method is to inhibit the expression of the GmDMP1 gene and / or the GmDMP2 gene in soybean or knock out the GmDMP1 gene and / or the GmDMP2 gene in soybean to obtain transgenic soybean, which is a soybean haploid inducible line.
[0059] Furthermore, the knockout of the genes encoding the aforementioned proteins in the recipient plants is all performed using CRISPR / Cas9.
[0060] The method for knocking out the gene encoding the aforementioned protein in the recipient plant includes the following steps: introducing a CRISPR / Cas9 vector containing the target sequence into the recipient plant to obtain a transgenic plant. The target sequence targets the target gene in the recipient plant.
[0061] The gene encoding the above-mentioned protein is a DNA molecule as shown in sequence 1, sequence 3, sequence 5, sequence 7, sequence 9, sequence 11, sequence 13, or positions 33-767 of sequence 15, or positions 32-434 of sequence 17.
[0062] In one specific embodiment of the present invention, when the recipient plant is tobacco, the target sequence of the CRISPR / Cas9 is positions 111-130 of sequence 7, positions 278-297 of sequence 7, positions 88-107 of sequence 5, and positions 383-402 of sequence 5. The CRISPR / Cas9 vector containing the target sequence is specifically a vector obtained by inserting the DNA molecule shown in sequence 19 into the pDIRECT-22C vector. The plant haploid induction line can specifically be the NtDMP gene mutation homozygous line ntdmp-1 or the NtDMP gene mutation homozygous line ntdmp-2. The only difference between the homozygous mutant NtDMP line ntdmp-1 and wild-type tobacco K326 in their genomic DNA is the deletion of base G and a fragment deletion on both homologous chromosomes encoding the NtDMP1 gene. The deleted base G is located at position 91 of sequence 5, and the deleted fragment is located at positions 115-399 of sequence 5. Furthermore, a fragment deletion occurs on both homologous chromosomes encoding the NtDMP2 gene, located at positions 116-281 of sequence 7. Additionally, a deletion of base G and a fragment deletion occurs on both homologous chromosomes encoding the NtDMP3 gene, located at position 91 of sequence 9, and the deleted fragment is located at positions 115-399 of sequence 9. The only difference between the homozygous mutant NtDMP line ntdmp-2 and wild-type tobacco K326 in their genomic DNA is the deletion of base G and base A on both homologous chromosomes encoding the NtDMP1 gene. The deleted base G is located at position 91 of sequence 5, and the deleted base A is located at position 114 of sequence 5. Base substitutions have also occurred on both homologous chromosomes encoding the NtDMP2 gene, replacing the DNA molecule shown in positions 111-280 of sequence 7 with base T. Furthermore, base A insertions have occurred on both homologous chromosomes encoding the NtDMP3 gene, with the inserted base A located between positions 400-401 of sequence 9.
[0063] This invention also provides a method for preparing plant haploids.
[0064] The method for preparing plant haploids provided by the present invention includes the following steps: self-pollinating the plant haploid induction line or its offspring prepared according to the above-mentioned method for preparing plant haploid induction lines, or using it as a male parent to hybridize with other plant materials to obtain self-pollinated offspring or hybrid offspring, which are the plant haploids.
[0065] Furthermore, the above-mentioned method for preparing plant haploids also includes the following steps: performing fluorescent labeling and / or haploid trait identification and / or leaf ploidy identification and / or molecular marker identification on the self-pollinated offspring or the hybrid offspring, and selecting offspring plants that are identified as haploid by at least one method as plant haploids.
[0066] Furthermore, the fluorescent labeling identification method can be performed as follows: The aforementioned haploid inducible line carrying a fluorescent protein expression element is used as the male parent and crossed with the female parent to obtain hybrid offspring. The presence of fluorescent signals in the offspring seeds is used to determine whether the seed to be tested is haploid or tetraploid (diploid): if the seed to be tested has no fluorescence or weak fluorescence, it is haploid or a candidate for haploid; if the seed to be tested exhibits strong fluorescence, it is tetraploid or a candidate for tetraploid (diploid). Further, fluorescence is detected using a fluorescent lamp. Furthermore, the male parent carries a TagRFP fluorescent protein expression element driven by the AtOLEO1 promoter, and the presence of red fluorescence in the hybrid offspring seeds can be used to determine whether they are haploid or tetraploid (diploid).
[0067] The method for identifying haploid traits can be carried out as follows: if the plant to be tested has characteristics such as short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, then the plant is or is a candidate for haploid; if the plant to be tested has characteristics such as tall stature, wide and spreading leaves, and normal fertility, then the plant is or is a candidate for tetraploid (diploid).
[0068] The leaf ploidy identification method can be performed as follows: Extract the nuclei from the young leaves of the plant to be tested, using tetraploid (diploid) plant leaves as a control; then use flow cytometry to detect the signal. First, detect the signal of the tetraploid (diploid) cell nucleus, setting the peak position of the tetraploid (diploid) cell nucleus signal to 100 (since the genetic material in tetraploid (diploid) cells is twice that in haploid cells, the peak position of the haploid cell nucleus signal appears around 50). If the signal peak of the plant to be tested appears around 50, then the plant is or is a candidate for haploid; if the signal peak of the plant to be tested appears around 100, and its intensity enrichment position is the same as that of the tetraploid (diploid) cell nucleus signal, then the plant is or is a candidate for tetraploid (diploid).
[0069] The molecular marker identification can be performed as follows: PCR amplification is performed using polymorphic primers between the paternal parent (maternal haploid inducible line) and the maternal parent. The PCR amplification products are used to determine whether the plant to be tested is haploid or tetraploid (diploid): if the amplification product of the plant to be tested only has the banding pattern of the maternal parent and does not have the banding pattern of the paternal parent, then the plant is or is a candidate for haploid; if the amplification product of the plant to be tested has heterozygous banding patterns of both the paternal and maternal parents, then the plant is or is a candidate for tetraploid (diploid).
[0070] In any of the above applications or methods, the plant is a dicotyledonous plant; further, the dicotyledonous plant may be carrot, sunflower, papaya, beet, melon, alfalfa, walnut, sesame, rubber tree, cassava, lotus, sweet cherry, rose, potato, grape, soybean, tomato, cucumber, pepper, cotton, tobacco, or rapeseed; even further, the rapeseed may specifically be wild-type rapeseed Westar or hau-A; the tobacco may specifically be wild-type tobacco K326; the cotton may specifically be wild-type cotton Huamian 1; the soybean may specifically be wild-type Williams 82.
[0071] Finally, this invention provides a method for preparing transgenic plants with reduced haploid induction ability or increased fruit number.
[0072] The method for preparing transgenic plants with reduced haploid induction capacity or increased fruit number provided by the present invention includes the following steps: increasing the expression level and / or activity of the above-mentioned protein in the plant haploid induction line to obtain transgenic plants; wherein the haploid induction capacity of the transgenic plants is lower than that of the plant haploid induction line, and the number of fruits of the transgenic plants is higher than that of the plant haploid induction line.
[0073] Furthermore, the method for increasing the expression level and / or activity of the above-mentioned protein in the plant haploid induction line is to overexpress the above-mentioned protein in the plant haploid induction line.
[0074] The overexpression method involves introducing the gene encoding the aforementioned protein into a plant haploid induction line.
[0075] Furthermore, the gene encoding the above-mentioned protein is a DNA molecule as shown in sequence 1, sequence 3, sequence 5, sequence 7, sequence 9, sequence 11, sequence 13, or positions 33-767 of sequence 15 or positions 32-434 of sequence 17.
[0076] The plant haploid inducible lines are Arabidopsis mutants with the AtDMP8 gene knocked out (the AtDMP8 gene sequence is shown as positions 95-826 of sequence 20 in the sequence listing) and the AtDMP9 gene sequence is shown as positions 141-875 of sequence 21 in the sequence listing), such as the Arabidopsis DMP gene mutant dmp8dmp9 (T2-19-1). Compared with the genomic DNA of wild-type Arabidopsis Col-0, the Arabidopsis DMP gene mutant dmp8dmp9 (T2-19-1) differs only in that there are deletions on both homologous chromosomes of the gene encoding the AtDMP8 protein, located at positions 115-511 of sequence 20, and deletions on both homologous chromosomes of the gene encoding the AtDMP9 protein, located at positions 161-564 of sequence 21.
[0077] This invention, based on the cloning of the key inducible gene DMP for parthenogenesis haploidy, verified the conservation of haploid induction function of DMP homologous genes in different dicotyledonous crops through genetic complementation. The specific method is as follows: DMP homologous genes from different dicotyledonous crops were cloned via gene synthesis or PCR amplification. Expression vectors of these DMP homologous genes from dicotyledonous crops were constructed using the promoter of the AtDMP9 gene from Arabidopsis thaliana, and these expression vectors were transformed into the Arabidopsis thaliana dmp8dmp9 mutant. By observing the number of siliques in plants carrying and not carrying the expression vectors, it was demonstrated that DMP homologous genes in these dicotyledonous crops are all associated with parthenogenesis haploid induction, indicating that the haploid induction function of DMP homologous genes in different dicotyledonous crops is highly conserved. Furthermore, this invention utilized gene editing technology to edit the DMP homologous gene in the important dicotyledonous crop tobacco, obtaining a parthenogenesis haploid inducible line, further demonstrating that the DMP gene in the dicotyledonous crop tobacco has the function of regulating haploid induction in plants. The haploid induction method for dicotyledonous crops established in this invention shows broad prospects for the innovation and application of common core technologies in crop breeding. Attached Figure Description
[0078] Figure 1 A schematic diagram illustrating the process of constructing DMP gene complementation vectors for different crops.
[0079] Figure 2 Figures show a comparison between haploid and tetraploid tobacco plants. Figure a shows the seedling stage of haploid tobacco plants, Figure b shows the flow cytometry results, and Figure c shows the vigorous growth stage of haploid tobacco plants. In Figure c, the left side represents haploid plants, and the right side represents tetraploid plants. Detailed Implementation
[0080] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0081] The carriers pICH41295, pICH41308, pICH41276, pICH47742, pL1-F1-FastR, pICH41744, and pICSL4723 used in the following examples are described in the literature “Engler C, Youles M, Gruetzner R, Ehnert T, Werner S, Jones JDG, Patron NJ, Marillonnet SA Golden Gate Modular Cloning Toolbox for Plants[J].ACS Synthetic Biology, 2014, 3(11): 839-843.”, which are available to the public from the applicant. These experimental materials are only for repeating the relevant experiments of this invention and should not be used for other purposes.
[0082] The vector pDIRECT-22C used in the following embodiments is described in the literature “Cermak, T. and SJ Curtin, et al. (2017). A multi-purpose toolkit to enable advanced genome engineering in plants. The Plant Cell: tpc.00922.2016.”, which is publicly available from the applicant. This experimental material is only for repeating the relevant experiments of the present invention and should not be used for other purposes.
[0083] The Arabidopsis DMP gene mutants dmp8dmp9(T2-19-1) and Col-0 in the following examples are described in the literature “Zhong Y,Chen B,Li M,Wang D,Jiao Y,Qi X,Wang M,Liu Z,Chen C,Wang Y,Chen M,LiJ,Xiao Z,Cheng D,Liu W,Boutilier K,Liu C,Chen SA DMP-triggered in vivomaternal haploid induction systemin the dicotyledonous Arabidopsis[J].NaturePlants,2020,6(5):466-472.”, which are available to the public from the applicant. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.
[0084] The wild-type tobacco K326 in the following examples is described in the literature " The biological material is available to the public from the applicant and is intended solely for the purpose of repeating the relevant experiments of this invention and may not be used for any other purpose. (See: ková M, Vosátka M, Rossi L, et al. Effects of arbuscular mycorrhizal inoculation on cadmium accumulation by different tobacco (Nicotiana tabacum L.) types [J]. Applied soil ecology, 2007, 35(3): 502-510.)
[0085] The genes and proteins involved in this invention and their sequences are shown in Table 1. Except for sequences 15 and 17, the DNA sequences in Table 1 are the CDS sequences of the corresponding genes, encoding the corresponding protein sequences. Positions 33-767 of sequence 15 are the CDS sequence of the protein shown in sequence 16, and positions 32-434 of sequence 17 are the CDS sequence of the protein shown in sequence 18.
[0086] Table 1. Gene sequences and protein sequences involved in this invention.
[0087]
[0088] Example 1: Conservation of haploid-induced function of DMP homologous genes in different dicotyledonous crops
[0089] I. Obtaining the amino acid sequence of DMP homologous genes
[0090] The DMP homologous gene sequences in cotton, tobacco and rapeseed were cloned by PCR amplification.
[0091] The cotton GhDMP1 and GhDMP2 genes are highly homologous and use the same amplification primers. Amplification primers were designed for PCR amplification, and the clones were then cloned into a vector. Single clones were then picked and sequenced, and compared with the GhDMP1 and GhDMP2 gene sequences to obtain the GhDMP1 and GhDMP2 gene sequences. The amplification primers for the GhDMP1 and GhDMP2 genes are as follows:
[0092] GhDMP1 / 2-CDS1F:tttgaagacaaaatgGAGCAAACCCACCATGG;
[0093] GhDMP1 / 2-CDS1R:tttgaagacaaAAGCTCAAGCAGCCATGCAACC.
[0094] The tobacco NtDMP1, NtDMP2, and NtDMP3 genes are highly homologous and use the same amplification primers. Amplification primers were designed for PCR amplification, and the clones were then cloned into a vector. Single clones were selected and sequenced, and their sequences were compared with the NtDMP1, NtDMP2, and NtDMP3 gene sequences to obtain the NtDMP1, NtDMP2, and NtDMP3 gene sequences. The amplification primers for NtDMP1, NtDMP2, and NtDMP3 genes are as follows:
[0095] NtDMP-CDS1F1:tttgaagacaaaatgGAGCAAAGTACTGAGGGAATTG;
[0096] NtDMP1-CDS1R1:tttgaagacaaACCTCTTATCTTTTGGCACATCCA;
[0097] NtDMP2 / 3-CDS1R1:tttgaagacaaACCTCTCATCTTTTGGCACATCCA;
[0098] NtDMP-CDS1F2:tttgaagacaaAGGTACGTCGTGGGATTTAC;
[0099] NtDMP-CDS1R2:tttgaagacaaAAGCTTTAAGCAGACATACATCCAATACCAT.
[0100] The rapeseed genes BnDMP1A, BnDMP1C, BnDMP2A, and BnDMP2C are highly homologous and use the same amplification primers. Amplification primers were designed for PCR amplification, and the clones were then cloned into a vector. Single clones were selected and sequenced, and their sequences were compared with the gene sequences of BnDMP1A, BnDMP1C, BnDMP2A, and BnDMP2C, respectively, to obtain the gene sequences of BnDMP1A, BnDMP1C, BnDMP2A, and BnDMP2C. The amplification primers for the BnDMP1A, BnDMP1C, BnDMP2A, and BnDMP2C genes are as follows:
[0101] BnDMP1A / 1C-CDS1F:tttgaagacaaaatgGAGAAAACAGAGGAAAGT;
[0102] BnDMP1A / 1C-CDS1R:tttgaagacaaAAGCTCAAGCAGACATGCATCCAAC;
[0103] BnDMP2A / C-CDS1F:tttgaagacaaaatgGAGAAAACAGAGGAAAGC;
[0104] BnDMP2A / C-CDS1R:tttgaagacaaAAGCTCAAGCGGACATGCATCCAAC;
[0105] BnDMP2C-CDS1R1:tttgaagacaaCTCTCTTCCTCCTCCTGCGGCG;
[0106] BnDMP2C-CDS1F2:tttgaagacaaAGAGATTCCGGTAAGTGATGATA.
[0107] II. Construction and Transformation of DMP Homologous Gene Complementation Vectors
[0108] 1. The DMP homologous gene fragments obtained from different crops were cloned into the level 0 vector pICH41308 using the Golden Gate method to obtain the vector pL0-DMP-CDS1 carrying different DMP gene sequences. Figure 1 (b)
[0109] 2. Using Arabidopsis thaliana Col-0 genomic DNA as a template, the promoter sequence of the AtDMP9 gene was amplified using primer pair DMP9-proF / R and cloned into the level 0 vector pICH41295 to obtain the vector pL0-AtDMP9-pro( Figure 1 a);
[0110] The sequences of the primers for amplifying the AtDMP9 gene promoter in Arabidopsis thaliana are as follows:
[0111] DMP9-proF:tttgaagacaaGGAGccttccaagactcgga;
[0112] DMP9-proR:tttgaagacaaCATTTTTCGTGTGTTTCTCCTTGTTTT.
[0113] 3. Using the vector plasmid carrying the AtuNos terminator sequence as a template, the AtuNos terminator sequence was amplified using the primer pair TerAtuNosF / R and cloned into the level 0 vector pICH41276 to obtain the vector pL0-terAtuNos( Figure 1 c);
[0114] The sequences of the AtuNos terminator amplification primers are as follows:
[0115] TerAtuNosF:tttgaagacaagcttgtcaagcagatcgttca;
[0116] TerAtuNosR:tttgaagacaaAGCGTCGATCTAGTAACATAG.
[0117] 4. Using enzyme digestion and ligation, fragments between BsaI restriction sites (DMP gene CDS sequence) in the vector pL0-DMP-CDS1 containing DMP homologous genes from different crops, fragments between BsaI restriction sites (AtDMP9 gene promoter) in the vector pL0-AtDMP9-pro, and fragments between BsaI restriction sites (AtuNos terminator sequence) in the vector pL0-terAtuNos were ligated into the Level 1 vector pICH47742 to obtain Level 1 vectors pL1-F2-pDMP9::DMP-TerAtuNos containing DMP homologous genes from different crops. Figure 1 (d).
[0118] 5. Using enzyme digestion and ligation, fragments between BbsI restriction sites in the Level 1 vector pL1-F2-pDMP9::DMP-TerAtuNos (AtDMP9 gene promoter + DMP gene CDS sequence + AtuNos terminator sequence), the fragment between BbsI restriction sites in the vector pL1-F1-FastR (FastR fragment), and the fragment between BbsI restriction sites in the vector pICH41744 (L2E fragment) of different crop DMP homologous genes were ligated into the Level 2 vector pICSL4723 to obtain the final complementary vector pL2-FastR+pDMP9::DMP( Figure 1 (e).
[0119] 6. The DMP homologous gene complementation vectors of different crops were transformed into Agrobacterium GV3101, and then transformed into the Arabidopsis DMP gene mutant dmp8dmp9(T2-19-1) using the flower-dipping method. The transformed seeds were then screened by RFP fluorescence to obtain positive transgenic seeds.
[0120] 7. Plant the positive transgenic seeds and self-pollinate them. Select plants with a ratio of approximately 3:1 of fluorescent to non-fluorescent seeds in the self-pollinated offspring for further analysis.
[0121] III. Analysis of the number of seeds produced by transgenic plants carrying DMP homologous gene complementation vectors
[0122] The number of siliques produced by self-pollination and hybridization of the Arabidopsis haploid inducible gene DMP mutant dmp8dmp9 (T2-19-1) was lower than that of wild-type Arabidopsis Col-0. If DMP homologous genes in other crops have the same haploid induction function, theoretically, the number of siliques produced by transgenic plants carrying DMP homologous gene complementation vectors should be higher than that of the mutant dmp8dmp9 (T2-19-1). Therefore, to verify the function of DMP homologous genes in other crops, the number of siliques produced by self-pollination of the mutant dmp8dmp9 and transgenic plants carrying DMP homologous gene complementation vectors from different crops was statistically analyzed. The specific steps are as follows:
[0123] 1. Fix the siliques to be observed onto a glass slide with double-sided tape attached;
[0124] 2. Under a stereomicroscope, gently cut open the two sides of the silique with the tip of a 1mL syringe, and then peel off the pericarp of the silique with sharp tweezers;
[0125] 3. Count the number of normal seeds in the siliques and calculate the average number of seeds produced per silique.
[0126] The results showed that, compared with the mutant dmp8dmp9, the transgenic plants carrying complementary vectors of DMP homologous genes from different crops had significantly higher self-crossing fruit numbers (Table 2). These results indicate that exogenous DMP homologous genes can complement the phenotype of the mutant dmp8dmp9, suggesting that the DMP homologous genes in these crops all have the function of regulating haploid induction in plants.
[0127] Table 2. Statistical table of the number of self-crossing fruits of mutant dmp8dmp9 and transgenic plants carrying the DMP homologous gene.
[0128] Wild-type Arabidopsis thaliana Col-0 52.8 dmp8dmp9 13.4 dmp8dmp9+GhDMP1 <![CDATA[29.8 a ]]> dmp8dmp9+GhDMP2 <![CDATA[29.0 a ]]> dmp8dmp9+NtDMP1 <![CDATA[44.3 a ]]> dmp8dmp9+NtDMP2 <![CDATA[39.3 a <!-- 9 -->]]> dmp8dmp9+NtDMP3 <![CDATA[42.0 a ]]> dmp8dmp9+BnDMP1A <![CDATA[29.1 a ]]> dmp8dmp9+BnDMP1C <![CDATA[30.6 a ]]> dmp8dmp9+BnDMP2A <![CDATA[31.4 a ]]> dmp8dmp9+BnDMP2C <![CDATA[20.8 a ]]>
[0129] Note: 'a' indicates a significant difference in the number of seeds compared to dmp8dmp9; at least three independent transgenic plants were taken for each genotype.
[0130] Example 2: Preparation and application of NtDMP gene knockout tobacco mutants
[0131] I. Knocking out the NtDMP gene using the CRISPR / Cas9 system
[0132] The NtDMP gene (NtDMP represents the three genes NtDMP1, NtDMP2, and NtDMP3) in tobacco was knocked out using the CRISPR / Cas9 system to obtain NtDMP gene knockout tobacco mutants. The specific steps are as follows:
[0133] 1. Selection of sgRNA sequence
[0134] Target site sequences with a length of 20 bp were designed on the NtDMP1, NtDMP2 and NtDMP3 genes, respectively.
[0135] Target site 1 is located at positions 111-130 of sequence 7, and the sequence of target site 1 is TTGCTGGTTGAGGCAATTCG.
[0136] Target site 2 is located at positions 278-297 of sequence 7, and the sequence of target site 2 is AATCATTAGTGTAGTGACAG.
[0137] Target site 3 is located at positions 88-107 of sequence 5 and position 88-107 of sequence 9. The sequence of target site 3 is ATCGGAACATCGTTATCTGG.
[0138] Target site 4 is located at positions 383-402 of sequence 5, positions 383-402 of sequence 7, and positions 383-402 of sequence 9. The sequence of target site 4 is ATGGATTTGTGACACCAAGA.
[0139] 2. Construction of CRISPR / Cas9 vectors
[0140] The CRISPR / Cas9 vector is obtained by inserting the DNA molecule shown in sequence 19 into the pDIRECT-22C vector.
[0141] 3. Obtaining transgenic plants
[0142] The CRISPR / Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 (Agrobacterium GV3101 competent cells were purchased from Beijing Aosendin Biotechnology Co., Ltd., and are available to the public through purchase) by heat shock to obtain recombinant bacteria GV3101 / CRISPR / Cas9.
[0143] The recombinant bacteria GV3101 / CRISPR / Cas9 were then transformed into wild-type tobacco K326 using the Agrobacterium infection method (the recombinant Agrobacterium was propagated at 28°C, and the propagated bacterial solution was used to infect tobacco K326). After kanamycin resistance screening, T0 generation transgenic tobacco plants were obtained.
[0144] 4. Identification of transgenic plants with mutations in the NtDMP gene
[0145] Leaves of T0 generation transgenic tobacco plants obtained in step 3 were collected, and genomic DNA was extracted as a template. PCR amplification was performed using the following primers to obtain PCR amplification products of different strains.
[0146] The sequences of the primers for detecting NtDMP1 gene mutations are as follows:
[0147] NtDMP1+3F2: ACTGAAAACTTCATTCGTGATCATT;
[0148] NtDMP1R1:TCGCCACAAATATTAATCCACATGA.
[0149] The sequences of the primers for detecting NtDMP2 gene mutations are as follows:
[0150] NtDMP3F:GCAAAGTACTGAGGGAATTGGG;
[0151] NtDMP2R:AGACGATCGGTCTGGTGATA.
[0152] The sequences of the primers for detecting NtDMP3 gene mutations are as follows:
[0153] NtDMP1+3F2: ACTGAAAACTTCATTCGTGATCATT;
[0154] NtDMP3R2:TCAACCCACATGGATGAATTCTG.
[0155] PCR amplification products from different strains were subjected to Sanger sequencing, and the sequencing results were compared with the corresponding NtDMP gene of wild-type tobacco K326. The genotypes of each NtDMP gene were identified according to the following principles.
[0156] If a sequence has a bimodal characteristic starting from the target site sequence, then the genotype of the strain is heterozygous (the NtDMP gene on one of the two homologous chromosomes is mutated, and the NtDMP gene on the other chromosome is not mutated), and the strain is a T0 generation transgenic tobacco heterozygous mutant strain.
[0157] If a sequence with a specific single-peak characteristic starting from the target site sequence is identical to the NtDMP gene sequence of wild-type tobacco K326, then the genotype of this strain is wild-type, meaning that the NtDMP gene sequence has not mutated; if it is different from the NtDMP gene sequence of wild-type tobacco K326, then the genotype of this strain is homozygous (the NtDMP gene on two homologous chromosomes has mutated), and this strain is a T0 generation transgenic tobacco homozygous mutant strain.
[0158] 5. Genotyping of T1 generation transgenic tobacco
[0159] The T0 generation transgenic tobacco NtDMP gene mutant lines obtained in step 4 were self-crossed, and the seeds were harvested and then sown to obtain the T1 generation transgenic tobacco. The genotype of the NtDMP gene in the T1 generation transgenic tobacco was identified using the following method: using the genomic DNA of the T1 generation transgenic tobacco as a template, the genotypes of the NtDMP1, NtDMP2, and NtDMP3 genes were identified using the mutation sequence detection primers of the NtDMP1, NtDMP2, and NtDMP3 genes in the T1 generation transgenic tobacco according to the method described in step 4.
[0160] Ultimately, two homozygous T1 generation transgenic tobacco lines, ntdmp-1 and ntdmp-2, were obtained with NtDMP gene mutations. The specific mutation details are as follows:
[0161] The only difference in genomic DNA between the T1 generation transgenic tobacco line ntdmp-1, a homozygous mutant of the three NtDMP genes, and wild-type tobacco K326 is that both homologous chromosomes encoding the NtDMP1 gene have deletions of the base G and fragments, with the deleted base G located at position 91 of sequence 5 and the deleted fragment located at positions 115-399 of sequence 5. Furthermore, both homologous chromosomes encoding the NtDMP2 gene have deletions of the fragment located at positions 116-281 of sequence 7. Additionally, both homologous chromosomes encoding the NtDMP3 gene have deletions of the base G and fragments, with the deleted base G located at position 91 of sequence 9 and the deleted fragment located at positions 115-399 of sequence 9.
[0162] The only differences in genomic DNA between the T1 generation transgenic tobacco line ntdmp-2 (a homozygous line with three NtDMP gene mutations) and wild-type tobacco K326 are: deletion of base G and deletion of base A on both homologous chromosomes encoding the NtDMP1 gene (G deletion at position 91 in sequence 5 and A deletion at position 114 in sequence 5); substitution of base T on both homologous chromosomes encoding the NtDMP2 gene (replacing DNA molecules at positions 111-280 in sequence 7 with base T); and insertion of base A on both homologous chromosomes encoding the NtDMP3 gene (A insertion at positions 400-401 in sequence 9).
[0163] The above-mentioned T1 generation transgenic tobacco mutant lines were used for the following haploid induction ability analysis experiment.
[0164] II. Application of NtDMP gene knockout tobacco mutants in inducing haploid production
[0165] (I) Identification of haploid self-crossing induction ability of NtDMP gene knockout tobacco mutants
[0166] Since wild tobacco K326 is a homozygous inbred line, the haploid progeny of mutants obtained by knocking out the NtDMP gene cannot be identified by molecular markers. Therefore, seeds obtained by inbreeding several types of mutants obtained from the NtDMP gene were planted, and the haploidity of the inbred progeny was identified using the following method.
[0167] 1. Plant phenotypic identification
[0168] After planting self-pollinated seeds, the phenotype of individual plants was observed. Haploid plants were characterized by short stature, narrow and upright leaves, compact plant type, and male sterility, while tetraploid plants were characterized by tall stature, wide and spreading leaves, and normal fertility. Figure 2 (a)
[0169] 2. Leaf identification by flow cytometry
[0170] The haploid plants obtained in step 1 were subjected to flow cytometry analysis. The specific method is as follows: Nuclei were extracted from young leaves of the plants to be tested, using tetraploid tobacco leaves as a control; the signal was then detected using a flow cytometer. First, the tetraploid cell nuclear signal was detected, and the peak position of the tetraploid cell nuclear signal was set to 100 (since the genetic material in tetraploid cells is twice that in haploid cells, the peak position of the haploid cell nuclear signal appears around 50). If the nuclear signal peak of the plant to be tested appears around 50, the plant is considered haploid. If the signal peak of the plant to be tested appears around 100, it is considered to have the same intensity enrichment position as the tetraploid cell nuclear signal, and the plant to be tested is tetraploid. Figure 2 (b)
[0171] If the offspring of a self-crossed homozygous NtDMP gene mutant line are haploid according to both of the above methods, then the plant is a haploid plant; if the result of either of the above methods is not haploid, then the plant is not a haploid plant.
[0172] The above identification results were statistically analyzed, and the haploid induction rate was calculated using the following formula: Haploid induction rate (%) = (Number of haploid plants / Total number of plants) × 100. Table 3 shows that haploids can be obtained in self-crossed offspring after the NtDMP gene mutation.
[0173] Table 3. Statistics on haploid induction rate in self-crossed offspring of ntdmp mutants
[0174] WT 329 0 0 ntdmp-1 1111 8 0.72 ntdmp-2 291 3 1.03
[0175] Note: WT stands for wild-type tobacco material K326.
[0176] (II) Identification of the haploid hybridization induction ability of NtDMP gene knockout tobacco mutants
[0177] Mutants with different combinations of NtDMP gene were hybridized with wild-type tobacco K326 material to obtain offspring, and haploids in the offspring were identified by the following method.
[0178] 1. Identification by fluorescent labeling
[0179] The CRISPR / Cas9 vector carries the AtOLEO1 promoter, which drives the expression of TagRFP (Entacmaea quadricolor). Since the AtOLEO1 promoter is specifically expressed in mature seed embryos, the fluorescence signal of TagRFP can be observed using a fluorescent lamp. Therefore, when a mutant carrying this expression element is used as the paternal parent and crossed with other maternal materials that do not carry fluorescence, the resulting seeds show red fluorescence in the embryos of tetraploid seeds due to the paternal genome, while the embryos of haploid seeds, derived from the maternal parent, show weak fluorescence.
[0180] 2. Molecular marker identification
[0181] The weakly fluorescent seeds identified in step 1 were further planted, and their genomic DNA was extracted. PCR amplification was performed using primers (NtDMP3F+NtDMP2R) for polymorphism between wild-type tobacco K326 material and transgenic tobacco mutant lines. The amplification products were then analyzed using agarose gel spectroscopy. If the amplification product of the tested plant showed one band, it was considered that the band of the tested plant was of wild-type tobacco K326 material, and there was no band of the paternal material present, so the plant was haploid. If the amplification product of the tested plant showed two bands, it was considered that the band of the tested plant was heterozygous for wild-type tobacco K326 material and transgenic tobacco mutant line, so the plant was a offspring of normal hybridization and was tetraploid.
[0182] 3. Plant phenotypic identification
[0183] Further observation of the phenotypes of the plants identified in step 2 above revealed that haploids exhibited characteristics such as short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, while tetraploids showed tall stature, broad and spreading leaves, and normal fertility. Figure 2 (a, c)
[0184] 4. Leaf identification by flow cytometry
[0185] The haploid plants obtained in step 3 above were subjected to flow cytometry analysis. The specific method is as follows: Nuclei were extracted from young leaves of the plants to be tested, with tetraploid tobacco leaves used as a control. The flow cytometer was then used to detect the signal. First, the signal from the tetraploid cell nuclei was detected, and the peak position of the tetraploid cell nuclei signal was set to 100 (since the genetic material in tetraploid cells is twice that in haploid cells, the peak position of the haploid cell nuclei signal appears around 50). If the signal peak of the tested plant's cell nuclei appeared around 50, the plant was considered haploid. If the signal peak of the tested plant appeared around 100, it was considered to have the same intensity enrichment location as the tetraploid cell nuclei signal, and the plant was considered tetraploid. Figure 2 (b)
[0186] If a single offspring plant from a cross between a homozygous NtDMP gene mutant line and a wild-type tobacco K326 material is identified as haploid using all four of the above methods, then the plant is a haploid plant; if the identification result of any of the above methods is not haploid, then the plant is not a haploid plant.
[0187] The above identification results were statistically analyzed, and the haploid induction rate was calculated using the following formula: Haploid induction rate (%) = (Number of haploid plants / Total number of plants) × 100. Table 4 shows that after the NtDMP gene mutation, hybridization with other materials yields haploid offspring.
[0188] Table 4. Statistics on haploid induction rate in the offspring of ntdmp mutant crosses
[0189] K326×WT 521 0 0.00 K326×ntdmp-1 356 3 0.84 K326×ntdmp-2 675 11 1.63
[0190] Note: WT stands for wild-type tobacco material K326.
[0191] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Applications of substances that knock out protein-coding genes in plants in the cultivation of haploid induction lines, the cultivation of haploid plants, or the enhancement of haploid induction ability in plants: The amino acid sequence of the protein is shown in sequence 6, sequence 8, or sequence 10. The plant in question is tobacco.
2. A method for preparing a plant haploid inducible line, comprising knocking out the gene encoding the protein described in claim 1 in a recipient plant to obtain a plant haploid inducible line; wherein the plant is tobacco.
3. A method for preparing a plant haploid inducing line, comprising the step of self-pollinating the plant haploid inducing line prepared according to the method of claim 2; wherein the plant is tobacco.
4. A method for improving the haploid induction ability of plants, comprising the following steps: knocking out the gene encoding the protein of claim 1 in a recipient plant to obtain a plant haploid induction line; wherein the haploid induction ability of the plant haploid induction line is higher than that of the recipient plant; wherein the plant is tobacco.
5. A method for preparing plant haploids, comprising the following steps: self-pollinating a plant haploid inducing line or its offspring prepared according to the method of claim 2 or 3, or hybridizing it with other plant materials as a male parent to obtain self-pollinated offspring or hybrid offspring, which are the plant haploids; wherein the plant is tobacco.
6. The method according to claim 5, characterized in that: The method further includes the following steps: performing fluorescent marker identification and / or haploid trait identification and / or leaf ploidy identification and / or molecular marker identification on the self-pollinated offspring or the hybrid offspring, and selecting offspring plants that are identified as haploid by at least one method as plant haploids.
Citation Information
Patent Citations
process for the regeneration of rubber
CH41276A
Protein relevant with male fertility of plants as well as coding gene and application of protein
CN105884874A
Maize apogamia haploid inducing gene ZmPLAIE and application thereof
CN109628480A