Osrlk40 gene and application thereof in rice disease resistance

Abstract

This invention discloses OsRLK40 The gene and its application in rice resistance to rice blast are achieved by knocking out rice... OsRLK40 Gene-based; as described OsRLK40 The gene, whose nucleotide sequence is shown in SEQ ID NO.1; the knockout is performed using CRISPR / Cas9 gene editing technology; this invention knocks out the gene using CRISPR / Cas9 technology. OsRLK40 Obtaining knockout mutants OsRLK40 Through rice blast resistance identification, it was found that, compared with wild-type rice, the mutant... OsRLK40 It is more resistant to disease, with smaller lesion areas and less rice blast fungus carried on diseased leaves, indicating that... OsRLK40 Negative regulation of rice resistance to rice blast. Through bacterial blight resistance identification, it was found that, compared with wild-type rice, the mutant... OsRLK40 More resistant to disease, shorter lesions, indicating OsRLK40 This invention negatively regulates rice resistance to bacterial blight. It is beneficial for breeding rice varieties resistant to rice blast and bacterial blight, providing a basis for later screening of highly resistant and broad-spectrum resistant rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to the application of the OsRLK40 gene and its encoded protein in improving disease resistance in rice. Background Technology

[0002] Rice blast is a prevalent and important fungal disease of rice caused by the fungus *Pyricularia oryzae*. It severely impacts rice yield and is one of the major limiting factors for high and stable rice yields in the Northeast rice-growing region. During periods of high rice blast incidence, yields are generally reduced by 10%–20%, and in severely affected areas by 40%–50%, with some areas experiencing complete crop failure.

[0003] Rice bacterial blight is a bacterial disease caused by the Gram-negative bacterium Xanthomonas oryzae pv. oryzae. It occurs throughout China, but is more severe in southern regions. Rice can be affected by bacterial blight throughout its growth cycle, but is most severely damaged during the booting stage. In affected areas, yields are generally reduced by about 10% to 30%, and in severely affected areas, losses can exceed 50%.

[0004] It is projected that by 2030, annual rice production will need to increase by 40% from current levels to meet the needs of the world's population. Therefore, food security issues caused by rice blast and bacterial blight have been a major concern. Current control measures primarily rely on chemical control and disease-resistant breeding, supplemented by biological control. While chemical control is low-cost and fast-acting, the complex and variable physiological races of pathogens often lead to a decline or even loss of efficacy after several years of application. Furthermore, long-term application can cause environmental pollution, making sustainable use difficult. Although biological control is more effective against rice blast and bacterial blight, it suffers from slow effectiveness and the activity of biocontrol bacteria is affected by the environment, making large-scale application challenging.

[0005] Breeding disease-resistant varieties offers advantages in terms of safety, effectiveness, and sustainability. Traditional disease-resistant breeding primarily relies on field hybridization and backcrossing, combined with field resistance identification and comprehensive selection of agronomic traits, requiring many years and generations of screening to cultivate resistant varieties. CRISPR / Cas9 technology, a widely used gene-editing technology in recent years, is characterized by high efficiency, ease of operation, and low cost. The principle behind this technology is that the specific recognition of gRNA with the target sequence guides the Cas9 nuclease to directionally cut DNA at the target site, causing double-strand breaks, thereby stimulating the intracellular DNA repair system and inducing gene mutations, including base insertion, deletion, and substitution. In recent years, this system has been used to genetically improve related traits in plants such as rice. In the breeding process, CRISPR / Cas9 technology can rapidly obtain safe and stable homozygous mutants, which can be applied to improve and breed disease-resistant rice varieties and promote the creation of superior germplasm resources. Summary of the Invention

[0006] The purpose of this invention is to solve the technical problems of traditional disease-resistant breeding, and therefore provides... OsRLK40 Genes and their application in improving rice resistance.

[0007] rice OsRLK40 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] Rice as shown in SEQ ID NO.1 OsRLK40 Application of genes in rice resistance to rice blast.

[0009] A method for breeding rice blast resistance involves knocking out rice strains as shown in SEQ ID NO.1. OsRLK40 Genetically achieved;

[0010] The knockout mentioned above is performed using CRISPR / Cas9 gene editing technology; OsRLK40 The target nucleotide sequence of the gene is: CACCATGGATGACGTGGCGCagg.

[0011] A gene knockout vector, which is used to... OsRLK40 The target nucleotide sequence of the gene, CACCATGGATGACGTGGCGCagg, was inserted into the vector Pylcrispr / Cas9P. 35S -H in.

[0012] This invention provides a method for breeding rice with disease resistance, achieved by knocking out the rice OsRLK40 gene. The nucleotide sequence of the OsRLK40 gene is shown in SEQ ID NO.1. The knockout is performed using CRISPR / Cas9 gene editing technology. The target nucleotide sequence of the OsRLK40 gene is: CACCATGGATGACGTGGCGCagg. This invention knocks out the OsRLK40 gene using CRISPR / Cas9 technology to obtain the knockout mutant osrlk40. Rice blast resistance identification revealed that, compared with wild-type rice, the knockout mutant osrlk40 is more resistant to rice blast, with smaller lesion areas and lower amounts of rice blast fungus carried on diseased leaves, indicating that OsRLK40 negatively regulates rice resistance to rice blast. The knockout mutant osrlk40, lacking the OsRLK40 gene, exhibits enhanced resistance to rice blast. Rice bacterial blight resistance identification revealed that, compared with wild-type rice, the knockout mutant osrlk40 was more resistant to the disease, with significantly smaller lesion lengths, indicating that OsRLK40 negatively regulates rice resistance to bacterial blight. The knockout mutant osrlk40, lacking the OsRLK40 gene, exhibits enhanced resistance to rice bacterial blight and can be widely applied in practice. This invention is beneficial for breeding rice varieties resistant to rice blast and bacterial blight, providing a basis for later screening of highly resistant and broad-spectrum resistant rice varieties. Attached Figure Description

[0013] Figure 1 A schematic diagram of knocking out the OsRLK40 gene in the background of rice Zhonghua 11 (ZH11) using CRISPR / Cas9 gene editing technology;

[0014] Figure 2 Analysis of the resistance of the osrlk40 mutant to rice blast; A represents the phenotype of wild-type Zhonghua 11 (ZH11) and osrlk40 mutant after inoculation with rice blast fungus; B represents the results of the detection of rice blast fungus in the leaves of wild-type Zhonghua 11 (ZH11) and osrlk40 mutant after inoculation with rice blast fungus.

[0015] Figure 3 Resistance analysis of osrlk40 mutant to bacterial blight; A represents the phenotype of wild-type Zhonghua 11 (ZH11) and osrlk40 mutant after inoculation with bacterial blight pathogen; B represents the statistical results of leaf lesion length after inoculation of wild-type Zhonghua 11 (ZH11) and osrlk40 mutant with bacterial blight pathogen. Detailed Implementation

[0016] The specific embodiments of the invention will be further described below with reference to the accompanying drawings, but the invention is not limited to the following embodiments. Any changes, combinations, or substitutions made to the invention within its scope or without departing from its content, spirit, and scope will be obvious to those skilled in the art and are included within the scope of the invention.

[0017] Example 1: Construction of the OsRLK40 gene mutant

[0018] I. Construction of OsRLK40 gene mutant using CRISPR / Cas9 gene editing technology

[0019] Using the website http: / / skl.scau.edu.cn / , editing target sites were designed for the target gene OsRLK40 (base sequence shown in SEQ ID NO.1 of the sequence listing). The target site locations are as follows: Figure 1 As shown, the target nucleotide sequence is: CACCATGGATGACGTGGCGCagg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and then the OsU6a-target-sgRNA fragment was inserted into the final vector BGK03 using the BsaI restriction site via Golden Gate cloning (for specific construction steps, refer to: Lu Yuming, YeXiao, Guo Renming, Huang Jing, Wang Wei, Tang Jiuyou, Tan Longtao et al. (2017) Genome-wide targeted mutagenesis in rice using the CRISPR / Cas9 system. Molecular Plant, 10, 1242–1245.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced by wild-type Zhonghua 11 embryos using Agrobacterium-mediated transformation, and positive transgenic plants were obtained by hygromycin screening. The rice variety Zhonghua 11 was developed by the Rice Anther Culture Group of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, through hybridization of the offspring of Jingfeng 2 Tetepu and Fujin, followed by selection from the F2 generation anthers via anther culture and inoculation into test-tube seedlings. It was approved and named by the Tianjin Municipal Crop Variety Approval Committee in March 1988. It is preserved at the Jilin Provincial Key Laboratory of Green Control of Crop Diseases and Pests, Jilin Agricultural University.

[0020] II. Molecular Identification of Editing Forms in Positive Transgenic Plants

[0021] Using genomic DNA from rice leaves as a template, PCR amplification was performed using the following identification primers. The amplified products were then subjected to Sanger sequencing to determine the mutant editing patterns.

[0022] The primers for identifying OsRLK40 gene mutants are:

[0023] GP13932-10194-F:GGGGTGCTGCTAATGGAG;

[0024] GP13932-10194-R: CGATTTACAGTAGCCGTGT.

[0025] The PCR amplification system was prepared according to the instructions for 2×EsTaq MasterMix (Dye), specifically: 10 μL of 2×EsTaq MasterMix (Dye), 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 1 μg of DNA template, and ddH2O to a final volume of 20 μL.

[0026] The PCR reaction system was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; 72℃ extension for 2 min.

[0027] The results are as follows Figure 1 As shown, a homozygous knockout mutant line, osrlk40, was obtained. In osrlk40, an A base was inserted 2896 bp downstream of the start codon ATG in the OsRLK40 gene, resulting in a frameshift mutation that led to the premature formation of a stop codon at 2953-2955 bp.

[0028] Example 2: Identification of rice blast resistance using spray inoculation method

[0029] Wild-type Zhonghua 11 (ZH11) and homozygous knockout mutant line osrlk40 were planted in seedling trays and inoculated with rice blast fungus when they reached the four-leaf stage.

[0030] The *Blastoma RB22* strain, preserved on filter paper, was inoculated onto tomato-oat agar plates for activation. Mycelia were scraped and transferred to fresh tomato-oat agar plates for further culture. The mycelia were broken up and placed in a 26°C black light incubator to induce sporulation. The plates were washed with 0.1% Tween solution, filtered, and the resulting spore eluent was adjusted to a concentration of 5.0 × 10⁻⁶. 5 Quantity / mL, ready for use.

[0031] During inoculation, rice leaves were evenly sprayed with 0.1% Tween solution, followed by even spraying of the rice blast fungus spore eluate onto the leaves. After inoculation, the leaves were incubated in the dark under moist conditions for 24 hours. The shading cloth was removed, and the leaves were then incubated under normal light. Seven days after inoculation, photographs were taken to record the disease incidence. Simultaneously, real-time quantitative PCR was used to detect the bacterial load on diseased leaves. Equal amounts of leaves from wild-type Zhonghua 11 (ZH11) and the homozygous knockout mutant osrlk40 were taken, and genomic DNA was extracted. Real-time quantitative PCR was performed using the following primers to compare the amount of rice blast fungus carried by wild-type ZH11 and homozygous knockout mutant osrlk40 leaves, thus completing the evaluation of the knockout mutant's resistance to rice blast.

[0032] The primers for real-time quantitative PCR are:

[0033] MoPot2-F: ACGACCCGTCTTTACTTATTTGG;

[0034] MoPot2-R:AAGTAGCGTTGGTTTTGTTGGAT;

[0035] OsUbi-F:GCCCAAGAAGAAGATCAAGAAC;

[0036] OsUbi-R: AGATAACAACGGAAGCATAAAAGTC.

[0037] The real-time PCR amplification system was prepared according to the instructions for the 2×SYBR qPCR Mixture, specifically: 5 μL 2×SYBR qPCR Mixture, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 0.6 μL DNA template, and ddH2O to a final volume of 10 μL. Each sample was repeated in triplicate.

[0038] The quantitative PCR reaction system was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 60℃ annealing for 1 min, 40 cycles; 72℃ extension for 2 min.

[0039] The results are as follows Figure 2 As shown, compared with the wild type, the homozygous knockout mutant line osrlk40 showed significantly enhanced resistance to rice blast, as evidenced by the significantly lower amount of rice blast fungus in the leaves of the homozygous knockout mutant line osrlk40 compared with the wild type.

[0040] Example 3: Identification of resistance to bacterial blight using the leaf-cutting inoculation method

[0041] Wild-type Zhonghua 11 (ZH11) and homozygous knockout mutant line osrlk40 were planted in a greenhouse and rice plants that had been growing for 6 weeks were inoculated with bacterial blight pathogen.

[0042] First, the *Bacillus thuringiensis* strain PXO99A, frozen at -80℃, was streaked onto beef extract peptone agar plates containing cephalexin and incubated at 28℃ for one day. Single colonies were picked and transferred to beef extract peptone liquid agar containing cephalexin, and incubated at 28℃ with shaking for 48 h. The cells were then collected by centrifugation at 9000 rpm for 3 min. The cells were resuspended in 0.1 M MgCl2 solution, centrifuged at 9000 rpm for 3 min, and the supernatant was discarded. This process was repeated once. Finally, the cells were resuspended in 0.1 M MgCl2 solution, and the OD value of the suspension was adjusted to 0.8 using a spectrophotometer for later use.

[0043] At inoculation, rice plants that have grown for 6 weeks are moved to a location with suitable sunlight and no rain. Using sterilized scissors, the bacterial suspension is applied to the leaves, approximately 10 cm below the tip of the second-to-last leaf of each plant. The leaves are left to stand for 2 weeks, during which time they are periodically sprayed with distilled water to keep them moist. Two weeks later, the length of lesions is measured, and the length of lesions on the leaves of the wild-type ZH11 and the homozygous knockout mutant line osrlk40 is compared to evaluate the knockout mutant's resistance to bacterial blight.

[0044] The results are as follows Figure 3 As shown, compared with the wild type, the homozygous knockout mutant line osrlk40 showed significantly improved resistance to bacterial blight, as evidenced by the significantly shorter lesion length on the leaves of the homozygous knockout mutant line osrlk40 compared with the wild type.

Claims

1. A method for breeding rice blast resistance, which is achieved by knocking out the rice OsRLK40 gene as shown in SEQ ID NO.

1.

2. The method for breeding rice blast resistance according to claim 1, characterized in that: The knockout is performed using CRISPR / Cas9 gene editing technology; the target nucleotide sequence of the OsRLK40 gene is: CACCATGGATGACGTGGCGCagg.

Images