A vector for synthesizing stable poly a tail and a preparation method thereof

CN117286163BActive Publication Date: 2026-09-08GENERAL BIOL (ANHUI) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311261906.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-27
Publication Date
2026-09-08
Estimated Expiration
2043-09-27

AI Technical Summary

Technical Problem

常规模板质粒上构建的A尾一般是连续的120个A,但在质粒发酵生产中质粒序列上的PolyA尾巴经常会发生碱基丢失,造成尾巴缩短,无法实现生产的质粒PolyA尾巴的均一性

Benefits of technology

[0037] This invention starts with optimizing vector elements and constructing dedicated vectors. By designing long annealing primers to obtain fragments containing PolyA, PolyA vectors of different lengths are constructed in segments: 30A+10bp+10A vector/first 60A vector, last 60A vector. Then, through enzyme digestion and ligation, recombinant vectors are obtained—discontinuous 110A tails/continuous 120A tails vectors. Finally, an identical hairpin structure is added to both ends of the polyA tails to obtain optimized 30A-L-70A vectors/optimized 120A vectors. On the one hand, the optimized 30A-L-70A vectors/optimized 120A vectors... By introducing the BsaI restriction site, the target gene can be directly constructed into the optimized 30A-L-70A vector/optimized 120A vector through restriction enzyme digestion and ligation during gene synthesis. This eliminates the tedious de novo synthesis steps and quickly obtains vectors with PolyA tails, greatly saving production time and costs. On the other hand, the PolyA tails in the vector exhibit good stability during fermentation and passage, and the number of A tails does not show significant loss after 15 passages. At the same time, the hairpin structure makes the optimized recombinant vector more stable in subsequent use, with a correct cloning rate of A tails reaching over 85%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117286163B_ABST
    Figure CN117286163B_ABST
Patent Text Reader

Abstract

The application discloses a kind of carrier for synthesizing stable PolyA tail and preparation method thereof, belong to biotechnology field, the carrier is any one of the following optimization 30A-L-70A carrier, optimization 120A carrier;Including the following preparation steps: segmented construction carrier;Cutting obtains recombination vector;Prokaryotic expression selects correct optimization before recombination vector;Add hairpin structure and select correct optimization after recombination vector.The preparation method of the application obtains the carrier with PolyA tail quickly, greatly saves production time and cost;PolyA tail in the carrier is better in the stability in fermentation, passage process, after 15 times of shake bacteria passage, A tail number does not appear a large number of loss phenomenon;Meanwhile, hairpin structure makes optimization after recombination vector more stable in subsequent use process, and A tail correct cloning rate can reach more than 85%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a carrier for synthesizing a stable PolyA tail and its preparation method. Background Technology

[0002] Plasmid template preparation is the most upstream part of mRNA synthesis technology. A good plasmid template is crucial for the yield and purity of mRNA synthesized in vitro and for its expression in vivo.

[0003] In in vitro mRNA transcription synthesis, polyA tails are commonly added via plasmid-template co-transcription. The polyA tail stabilizes mRNA, preventing degradation and playing a crucial role in mRNA preparation. There are two methods for adding polyA tails: one is enzymatic synthesis, where polyA polymerase derived from *E. coli* is used after mRNA transcription; the other is co-transcription, where the polyA tail already present in the template plasmid DNA or PCR product is directly transcribed. Conventional template plasmids typically construct polyA tails with 120 consecutive A's. However, during plasmid fermentation production, polyA tails on the plasmid sequence often experience base loss, resulting in tail shortening and compromising the uniformity of the produced polyA tails. Summary of the Invention

[0004] The purpose of this invention is to provide a vector for synthesizing stable PolyA tails and a method for preparing the same, in order to solve the following technical problems: preventing base loss in PolyA tails constructed on template plasmids and improving the stability of PolyA tails in plasmids during fermentation and passage.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] A vector for synthesizing a stable PolyA tail, wherein the vector is either a 30A-L-70A vector or a 120A vector, the nucleotide sequence of the 30A-L-70A vector is shown in SEQ ID NO.1; and the nucleotide sequence of the 120A vector is shown in SEQ ID NO.2.

[0007] As a further aspect of the present invention, the method for preparing the vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0008] Step 1: Segmented construction of the carrier: Construct the front carrier and the rear 60A carrier separately;

[0009] The preceding vector is any one of the 30A+10bp+10A vector and the preceding 60A vector;

[0010] The nucleotide sequence of the 30A+10bp+10A vector is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of the first 60A vector is shown in SEQ ID NO.4;

[0012] The nucleotide sequence of the latter 60A vector is shown in SEQ ID NO.5;

[0013] Step 2: Obtaining the recombinant vector by ligation: The pre-vector and the post-60A vector are digested with BsaI enzyme and the digested fragments of the pre-vector and the post-60A vector are recovered. The digested fragments of the pre-vector and the post-60A vector are then ligated with T4 enzyme to obtain the recombinant vector.

[0014] Step 3: Prokaryotic expression to screen for the correct pre-optimized recombinant vector: After transforming the recombinant vector into competent E. coli cells, plate them and culture for 16-20 hours. Pick single clones from the plates for colony PCR. Send positive clones for sequencing to screen for the correct pre-optimized recombinant vector.

[0015] Step 4: Add hairpin structure: After PCR of the PKBF vector, the PCR product of the PKBF vector is obtained; the unoptimized recombinant vector is digested with HindIII and AatII and then recombined with the PCR product of the PKBF vector. After transformation into competent E. coli cells, the cells are thawed for 1 hour, plated and cultured for 16-20 hours. Single clones on the plate are picked for colony PCR, and positive clones are sent for sequencing to screen out the correct optimized recombinant vector.

[0016] The linearization site of the unoptimized 30A-L-70A and unoptimized 120A vectors in this invention is BsmBI. The linearization site can also be changed to BspQI. The remaining construction steps are the same, and the same function can be achieved.

[0017] As a further aspect of the present invention, the 30A+10bp+10A vector is constructed using the following steps:

[0018] Step A1: Design and synthesize long annealing primers;

[0019] Step A2: PCR amplification of the PKBF vector and gel recovery of the amplification product to obtain the PCR product of the PKBF vector;

[0020] Step A3: Perform a recombination reaction between the long annealing primer and the PCR product of the PKBF vector to obtain recombinant product one;

[0021] Step A4: After transforming the recombinant product into competent E. coli cells, plate the cells and culture them for 16-20 hours. Then, pick single clones from the plates for colony PCR. Send positive clones for sequencing to screen out the correct 30A+10bp+10A vector.

[0022] As a further aspect of the present invention, the sequence of the long annealing primer includes a continuous base sequence in the following order: 30 consecutive A bases, 10 bp of discontinuous bases, and 10 consecutive A bases; the long annealing primer includes an IIS-type restriction endonuclease cleavage site; the IIS-type restriction endonuclease cleavage site is the same as the BsaI cleavage site.

[0023] As a further aspect of the present invention, the construction steps of the first 60A carrier and the second 60A carrier are the same, and the first 60A carrier is constructed by the following steps:

[0024] Step B1: Design and synthesize overlap PCR primers;

[0025] Step B2: PCR amplification of the PBBF vector and gel recovery of the amplification product to obtain the PCR product of the PBBF vector;

[0026] Step B3: Perform a recombination reaction between the overlap PCR primers and the PCR product of the PBBF vector to obtain recombinant product two;

[0027] Step B4: After transforming the recombinant product II into competent E. coli cells, plate the cells and culture them for 16-20 hours. Then, pick single clones from the plates for colony PCR. Send positive clones for sequencing to screen out the correct first 60A vectors.

[0028] As a further embodiment of the present invention, the overlap PCR primer includes a 60-base sequence of consecutive A bases; the overlap PCR primer includes an IIS restriction endonuclease cleavage site; the IIS restriction endonuclease cleavage site is the same as the BsaI cleavage site.

[0029] As a further embodiment of the present invention, the nucleotide sequence of the PBBF vector is shown in SEQ ID NO.6.

[0030] As a further embodiment of the present invention, the correct pre-optimization recombinant vector in step three includes the pre-optimization 30A-L-70A vector and the pre-optimization 120A vector; the nucleotide sequence of the pre-optimization 30A-L-70A vector is shown in SEQ ID NO.7; the nucleotide sequence of the pre-optimization 120A vector is shown in SEQ ID NO.8.

[0031] As a further embodiment of the present invention, the nucleotide sequence of the PKBF vector in step four is shown in SEQ ID NO.9.

[0032] As a further aspect of the present invention, the PCR primers for the PKBF vector in step four include PKBF-F primers and PKBF-R primers;

[0033] The nucleotide sequence of the PKBF-F primer is shown in SEQ ID NO.10, and the specific sequence is as follows: TGTCATGATAATAATGGTTTCTTAGACGTCGCCTGGGGTGCCTAATGAGTGAGCTAACTC;

[0034] The nucleotide sequence of the PKBF-R primer is shown in SEQ ID NO.11, and the specific sequence is as follows:

[0035] CGTCGACTGCAGAGGCCTGCATGCAAGCTTTCAGTACAATCTGCTCTGATGCCGCATAGT.

[0036] The beneficial effects of this invention are:

[0037] This invention starts with optimizing vector elements and constructing dedicated vectors. By designing long annealing primers to obtain fragments containing PolyA, PolyA vectors of different lengths are constructed in segments: 30A+10bp+10A vector / first 60A vector, last 60A vector. Then, through enzyme digestion and ligation, recombinant vectors are obtained—discontinuous 110A tails / continuous 120A tails vectors. Finally, an identical hairpin structure is added to both ends of the polyA tails to obtain optimized 30A-L-70A vectors / optimized 120A vectors. On the one hand, the optimized 30A-L-70A vectors / optimized 120A vectors... By introducing the BsaI restriction site, the target gene can be directly constructed into the optimized 30A-L-70A vector / optimized 120A vector through restriction enzyme digestion and ligation during gene synthesis. This eliminates the tedious de novo synthesis steps and quickly obtains vectors with PolyA tails, greatly saving production time and costs. On the other hand, the PolyA tails in the vector exhibit good stability during fermentation and passage, and the number of A tails does not show significant loss after 15 passages. At the same time, the hairpin structure makes the optimized recombinant vector more stable in subsequent use, with a correct cloning rate of A tails reaching over 85%. Attached Figure Description

[0038] The invention will now be further described with reference to the accompanying drawings.

[0039] Figure 1 This is the pKBF carrier spectrum of Embodiment 1 of the present invention;

[0040] Figure 2 This is the vector spectrum of embodiment 130A+10bp+10A of the present invention;

[0041] Figure 3 This is the first 60A carrier spectrum of Embodiment 2 of the present invention;

[0042] Figure 4 This is the PBBF carrier spectrum of Embodiment 3 of the present invention;

[0043] Figure 5 This is the 60A carrier spectrum of Embodiment 3 of the present invention;

[0044] Figure 6 This is the spectrum of the 30A-L-70A vector before optimization in Example 4 of the present invention;

[0045] Figure 7 This is the optimized 30A-L-70A vector spectrum from Example 4 of the present invention;

[0046] Figure 8 This is the 120A vector spectrum before optimization in Embodiment 5 of the present invention;

[0047] Figure 9 This is the optimized 120A carrier spectrum of Embodiment 5 of the present invention. Detailed Implementation

[0048] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0049] Example 1

[0050] The 30A+10bp+10A vector was constructed using the following steps:

[0051] Step A1: Design and synthesize long annealing primers, including 50BP THF and 50BP THR;

[0052] The nucleotide sequence of the 50bp THF is shown in SEQ ID NO.12, SEQ ID NO.12: CAGAGAATTCGAGCTCGGTACCTCGCGAATACATCTAGATGTCAGGCCATCGTAG GGTCTC GGGCCAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAG GAGACCATCGGATCCCGGGCCCGTCGACTGCAGAGGCCTGCATGCA;

[0053] The underlined portions, from bases 56 to 61 and from bases 122 to 127, are BsaI restriction sites.

[0054] The nucleotide sequence of the 50BP THR is shown in SEQ ID NO.13, SEQ ID NO.13: TGCATGCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGAT GGTCTC CTTTTTTTTTTTTTTAGTCATATGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCC GAGACCC TACGATGGCCTGACATCTAGATGTATTCGCGAGGTACCGAGCTCGAATTCTCTG;

[0055] The underlined portions, from bases 41 to 46 and from bases 107 to 112, are BsaI restriction sites.

[0056] Step A2: PCR amplification of the PKBF vector and gel recovery of the amplification product to obtain the PCR product of the PKBF vector;

[0057] The nucleotide sequence of the PKBF vector is shown in SEQ ID NO.9, and the vector map can be found in [link to vector map]. Figure 1 As shown;

[0058] Step A3: Perform a recombination reaction between the long annealing primer and the PCR product of the PKBF vector to obtain recombinant product one;

[0059] Step A4: After transforming the recombinant product into competent E. coli cells, plate the cells and culture for 16-20 hours. Pick single clones from the plates for colony PCR. Sequencing is performed on positive clones to screen for the correct 30A+10bp+10A vector. The nucleotide sequence of the correct 30A+10bp+10A vector is shown in SEQ ID NO.3. Refer to the vector map. Figure 2 As shown.

[0060] Example 2

[0061] The first 60A vectors were constructed using the following steps:

[0062] Step A1: Design and synthesize overlap PCR primers, including A1CZF_1, A1CZF_2, A1CZR_1, and A1CZR_2;

[0063] The nucleotide sequence of A1CZF_1 is shown in SEQ ID NO.14, specifically as follows: SEQ ID NO.14:

[0064] GCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGATTGGAAGACAAGGCCCGATTAATA GAGACC ATTCAGGTCTCA;

[0065] The underlined portion, from base 59 to 64 bp, is the BsaI restriction site.

[0066] The nucleotide sequence of A1CZF_2 is shown in SEQ ID NO.15, specifically as follows: SEQ ID NO.15:

[0067] GGGTCTTCTCATCTAGATGTATTCGCGAGGTACCGAGCTC;

[0068] The nucleotide sequence of A1CZR_1 is shown in SEQ ID NO.16, specifically as follows: SEQ ID NO.16:

[0069] ACATCTAGATGAGAAGACCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT GAGACC TGAATGGTCTCTA;

[0070] The underlined portion, from base 86 to 91 bp, is the BsaI restriction site.

[0071] The nucleotide sequence of A1CZR_2 is shown in SEQ ID NO.17, specifically as follows: SEQ ID NO.17:

[0072] GGCCAGAGAATTCGAGCTCGGTACCTCGCGAAT;

[0073] Step A2: PCR amplification of the PKBF vector and gel recovery of the amplification product to obtain the PCR product of the PKBF vector;

[0074] The nucleotide sequence of the PKBF vector is shown in SEQ ID NO.9;

[0075] Step A3: The PCR products of the overlap PCR primers and the PKBF vector were digested separately and the digested fragments of the overlap PCR primers and the PKBF vector were recovered. The digested fragments of the long annealing primers and the PKBF vector were ligated with T4 enzyme to obtain the first 60A vector.

[0076] Step A4: After transforming the first 60A vector into competent E. coli cells, the cells were plated and cultured for 16 hours. Single clones were picked from the plates for colony PCR. Positive clones were sent for sequencing to screen for the correct first 60A vector. The nucleotide sequence of the correct first 60A vector is shown in SEQ ID NO.4. The vector map is shown in the attached image. Figure 3 As shown.

[0077] Example 3

[0078] The 60A vector was constructed using the following steps:

[0079] Step B1: Design and synthesize overlap PCR primers; the overlap PCR primers include HOU 60A_F1, HOU 60A_F2, HOU 60A_R1, and HOU 60A_R2;

[0080] The nucleotide sequence of HOU 60A_F1 is shown in SEQ ID NO.18, specifically as follows: SEQ ID NO.18:

[0081] GCATGCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGATGGCCC GAGACC CCGGTCTCT;

[0082] The underlined portion, from the 45th to the 50th bp base, is the BsaI restriction site.

[0083] The nucleotide sequence of HOU 60A_F2 is shown in SEQ ID NO.19, specifically as follows: SEQ ID NO.19:

[0084] ATCTAGATGCATTCGCGAGGTACCGAGCTCGAATTCACTG;

[0085] The nucleotide sequence of HOU 60A_R1 is shown in SEQ ID NO.20, specifically as follows:

[0086] CCTCGCGAATGCATCTAGATTCGTCTCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTA GAGACC GGGGTCTCGGGCC;

[0087] The underlined portion, from base 87 to 95 bp, represents the BsaI restriction site.

[0088] The nucleotide sequence of HOU 60A_R2 is shown in SEQ ID NO.21, and the specific sequence is as follows, SEQ ID NO.21:

[0089] TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGT.

[0090] Step B2: PCR amplification of the PBBF vector and gel recovery of the amplification product to obtain the PCR product of the PBBF vector;

[0091] The nucleotide sequence of the PBBF vector is shown in SEQ ID NO.6. The vector map is shown in [reference needed]. Figure 4 As shown;

[0092] Step B3: Perform a recombination reaction between the overlap PCR primers and the PCR product of the PBBF vector to obtain recombinant product two;

[0093] Step B4: After transforming recombinant product II into competent E. coli cells, plate the cells and incubate for 16-20 hours. Pick single clones from the plates for colony PCR. Sequencing of positive clones will screen for the correct posterior 60A vector. The nucleotide sequence of the correct posterior 60A vector is shown in SEQ ID NO. 5. Refer to the vector map. Figure 5 As shown.

[0094] Example 4

[0095] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0096] Step 1: Obtaining the 30A-L-70A vector by ligation: The 30A+10bp+10A vector constructed in Example 1 and the 60A vector constructed in Example 3 were digested with BsaI enzyme and the digested fragments of the 30A+10bp+10A vector and the 60A vector were recovered. The digested fragments of the 30A+10bp+10A vector and the 60A vector were then ligated with T4 enzyme to obtain the 30A-L-70A vector.

[0097] Step 2: Prokaryotic expression screening to identify the correct pre-optimized 30A-L-70A vector: After transforming the 30A-L-70A vector into E. coli competent cells D10, the cells were plated and cultured for 16 hours. Single clones on the plates were picked for colony PCR, and positive clones were sent for sequencing to screen out the correct pre-optimized 30A-L-70A vector.

[0098] The correct nucleotide sequence of the pre-optimized 30A-L-70A vector is shown in SEQ ID NO.7. The vector map is shown in [reference needed]. Figure 6 As shown.

[0099] Step 3: Add hairpin structure: After performing PCR on the PKBF vector, the PCR product of the PKBF vector is obtained;

[0100] The nucleotide sequence of the PKBF-F primer is shown in SEQ ID NO.10, and the specific sequence is as follows: TGTCATGATAATAATGGTTTCTTAGACGTCGCCTGGGGTGCCTAATGAGTGAGCTAACTC;

[0101] The nucleotide sequence of the PKBF-R primer is shown in SEQ ID NO.11, and the specific sequence is as follows:

[0102] CGTCGACTGCAGAGGCCTGCATGCAAGCTTTCAGTACAATCTGCTCTGATGCCGCATAGT.

[0103] The unoptimized 30A-L-70A vector was digested with HindIII and AatII and recombined with the PCR product of the PKBF vector. After being transformed into competent E. coli cells, the cells were thawed for 1 hour, plated and cultured for 16-20 hours. Single clones on the plates were picked for colony PCR, and positive clones were sent for sequencing to screen out the correct optimized 30A-L-70A vector.

[0104] The correct optimized nucleotide sequence of the 30A-L-70A vector is shown in SEQ ID NO.1. The vector map is shown in [reference needed]. Figure 7 As shown.

[0105] Example 5

[0106] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0107] Step 1: Obtaining the 120A vector by ligation: The first 60A vector constructed in Example 2 and the second 60A vector constructed in Example 3 were digested with BsaI enzyme and the digested fragments of the first 60A vector and the second 60A vector were recovered. The digested fragments of the first 60A vector and the second 60A vector were then ligated with T4 enzyme to obtain the 120A vector.

[0108] Step 2: Prokaryotic expression screening to identify the correct pre-optimized 120A vector: After transforming the 120A vector into E. coli competent cells D10, the cells were plated and cultured for 20 hours. Single clones on the plates were picked for colony PCR, and positive clones were sent for sequencing to screen out the correct pre-optimized 120A vector.

[0109] The correct nucleotide sequence of the pre-optimized 120A vector is shown in SEQ ID NO.8. The vector map is shown in [reference needed]. Figure 8 As shown;

[0110] Step 3: Add hairpin structure: After performing PCR on the PKBF vector, the PCR product of the PKBF vector is obtained;

[0111] The nucleotide sequence of the PKBF-F primer is shown in SEQ ID NO.10, and the specific sequence is as follows: TGTCATGATAATAATGGTTTCTTAGACGTCGCCTGGGGTGCCTAATGAGTGAGCTAACTC;

[0112] The nucleotide sequence of the PKBF-R primer is shown in SEQ ID NO.11, and the specific sequence is as follows:

[0113] CGTCGACTGCAGAGGCCTGCATGCAAGCTTTCAGTACAATCTGCTCTGATGCCGCATAGT.

[0114] The unoptimized 120A vector was digested with HindIII and AatII and recombined with the PCR product of the PKBF vector. After being transformed into competent E. coli cells, the cells were thawed for 1 hour, plated and cultured for 16-20 hours. Single clones on the plates were picked for colony PCR, and positive clones were sent for sequencing to screen out the correct optimized 120A vector.

[0115] The correct optimized nucleotide sequence of the 120A vector is shown in SEQ ID NO.2. The vector map is shown in [reference needed]. Figure 9 As shown.

[0116] Example 6

[0117] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0118] Example 6 is a parallel repeat of Example 4, with all steps and parameters being identical.

[0119] Example 7

[0120] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0121] Compared with Example 4, this embodiment only replaces "E. coli competent cells D10" with "E. coli competent cells Stable", and the other steps and parameters are the same.

[0122] Examples 8-10

[0123] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0124] Examples 8-10 are three parallel replicates of Example 7, with all steps and parameters being identical.

[0125] Comparative Example 1

[0126] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0127] Compared with Example 5, this comparative example omits step three, "adding a hair clip structure," while the remaining steps and parameters are the same.

[0128] Comparative Example 2

[0129] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0130] Comparative Example 2 is a parallel replication of Comparative Example 1, with all steps and parameters being identical.

[0131] Comparative Example 3

[0132] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0133] Compared with Comparative Example 1, this comparative example only replaced "E. coli competent cells D10" with "E. coli competent cells Stable", and all other steps and parameters were the same.

[0134] Comparative Example 4

[0135] A method for preparing a vector for rapid synthesis of the PolyA gene includes the following preparation steps:

[0136] Comparative Example 4 is a parallel replication of Comparative Example 3, with all steps and parameters being identical.

[0137] Performance testing

[0138] (1) Passage stability test: The stability of the A tail in the vector was tested by shaking passage: The optimized 30A-L-70A vectors constructed and screened in step two of Examples 4 and 6-10 were subjected to passage stability test, and the results are shown in Table 1.

[0139] Table 1

[0140] 1st generation 110A 110A 110A 110A 110A 110A 2nd generation 110A 110A 110A 110A 110A 110A 3rd generation 110A 110A 110A 110A 110A 110A 4th generation 110A 110A 110A 110A 110A 110A 5th generation 110A 110A 110A 110A 110A 110A 6th generation 110A 110A 110A 110A 110A 110A 7th generation 110A 110A 110A 110A 110A 110A 8th generation 110A 110A 110A 110A 110A 110A 9th generation 110A 110A 110A 110A 110A 110A 10th generation 110A 110A 110A 110A 110A 110A 11th generation 110A 110A 110A 110A 110A 110A 12th generation 110A 110A 110A 110A 110A 110A 13th generation 110A 110A 110A 110A 110A 110A 14th generation 110A 110A 110A 110A 110A 110A 15th generation 110A 110A 110A 110A 110A 110A

[0141] The 120A vectors constructed in Comparative Examples 1-4 were subjected to passage stability tests, and the results are shown in Table 2.

[0142] Table 2

[0143] 1st generation 120A 120A 120A 120A 2nd generation 120A 120A 120A 120A 3rd generation 120A 120A 120A 120A 4th generation 120A 120A 120A 120A 5th generation 120A 119A 119A 119A 6th generation 119A 119A 117A 118A 7th generation 94A 94A 102A 89A 8th generation 90A 94A 95A 89A

[0144] As can be seen from Tables 1-2, the optimized 30A-L-70A vector constructed and screened in step two of Examples 4 and 6-10 of the present invention has good stability during the passage process, and the number of A tails does not show a large loss after 15 passages by shaking. The 120A vector constructed in Comparative Examples 1-4 of the present invention has poor stability during the passage process, and the number of A tails begins to gradually disappear after 5 passages by shaking.

[0145] (2) Target gene ligation test of the 30A-L-70A vector before optimization, the experimental steps are as follows:

[0146] Step 1: Design primers with BsaI restriction sites, amplify the target fragment, digest and recover the PCR product using BsaI restriction, and recover the digested product.

[0147] Step 2: The optimized 30A-L-70A vector constructed and screened in Step 2 of Example 4 was digested with BsaI. The digested vector was recovered, and gel electrophoresis was used to detect whether the digestion was successful.

[0148] Step 3: The recovered products obtained in Steps 1 and 2 were ligated with T4 enzyme and transformed into E. coli competent cells D10. After plating and culturing for 16 hours, single clones on the plate were picked for colony PCR. Positive clones were sent for sequencing to screen out the positive clones that were successfully ligated.

[0149] Step 4: Calculate the positive rate of colony PCR and the accuracy rate of submitted clones; the test results are shown in Table 3; select two positive clones that were successfully ligated in Step 3 for passage stability testing: test the stability of the A tail in the optimized 30A-L-70A vector ligated with the target gene in Step 2 of Example 4 by shaking passage, the test results are shown in Table 4:

[0150] Table 3

[0151] 96 60 62.50% 30 23 75%

[0152] Table 4

[0153]

[0154]

[0155] As can be seen from Tables 3-4, the A-tail stability of the optimized 30A-L-70A vector constructed and screened in step 2 of Example 4 of the present invention is good after the target gene is cut and ligated. The cloning accuracy of the A-tail has reached 75%. After 15 passages of culture, no large loss of A-tails was observed.

[0156] Referring to (2), the vectors finally prepared in Examples 4, 5 and Comparative Example 1 were subjected to gene ligation and testing, and the results of the correct A-tail clone count and correct cloning rate are shown in Table 5.

[0157] Table 5

[0158] Example 4 (Optimized 30A-L-70A vector) 16 15 93.75% Example 5 (Optimized 120A vector) 16 14 87.5% Comparative Example 1 (120A vector before optimization) 16 9 56.25%

[0159] As shown in Table 5, the optimized 30A-L-70A vector / optimized 120A vector prepared in Examples 4-5 of this invention exhibits good A-tail stability after cutting and linking the target gene. Furthermore, a comparison of Tables 3 and 5 shows that the optimized 30A-L-70A vector has higher stability after cutting and linking the target gene compared to the unoptimized 30A-L-70A vector. Table 5 also shows that the optimized 120A vector prepared in Example 5 has significantly improved A-tail stability after cutting and linking the target gene compared to the unoptimized 120A vector without the hairpin structure in Comparative Example 1.

[0160] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0161] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A vector for synthesizing a stable PolyA tail, characterized in that, The vector is either the optimized 30A-L-70A vector or the optimized 120A vector. The nucleotide sequence of the optimized 30A-L-70A vector is shown in SEQ ID NO.1; the nucleotide sequence of the optimized 120A vector is shown in SEQ ID NO.

2.

2. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 1, characterized in that, The preparation steps include the following: Step 1: Segmented construction of the carrier: Construct the front carrier and the rear 60A carrier separately; The preceding vector is any one of the 30A+10bp+10A vector and the preceding 60A vector; The nucleotide sequence of the 30A+10bp+10A vector is shown in SEQ ID NO.3; The nucleotide sequence of the first 60A vector is shown in SEQ ID NO.4; The nucleotide sequence of the latter 60A vector is shown in SEQ ID NO.5; Step 2: Obtaining the recombinant vector by ligation: The pre-vector and the post-60A vector are digested with BsaI enzyme and the digested fragments of the pre-vector and the post-60A vector are recovered. The digested fragments of the pre-vector and the post-60A vector are then ligated with T4 enzyme to obtain the recombinant vector. Step 3: Prokaryotic expression to screen for the correct pre-optimized recombinant vector: After transforming the recombinant vector into competent E. coli cells, plate them and culture for 16-20 hours. Pick single clones from the plates for colony PCR. Send positive clones for sequencing to screen for the correct pre-optimized recombinant vector. Step 4: Add hairpin structure: After PCR of the PKBF vector, the PCR product of the PKBF vector is obtained; the unoptimized recombinant vector is digested with HindIII and AatII and then recombined with the PCR product of the PKBF vector. After transformation into competent E. coli cells, the cells are thawed for 1 hour, plated and cultured for 16-20 hours. Single clones on the plate are picked for colony PCR. Positive clones are sent for sequencing to screen out the correct optimized recombinant vector. The nucleotide sequence of the PKBF vector described in step four is shown in SEQ ID NO.

9.

3. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 2, characterized in that, The 30A+10bp+10A vector is constructed using the following steps: Step A1: Design and synthesize long annealing primers; Step A2: PCR amplification of the PKBF vector and gel recovery of the amplification product to obtain the PCR product of the PKBF vector; Step A3: Perform a recombination reaction between the long annealing primer and the PCR product of the PKBF vector to obtain recombinant product one; Step A4: After transforming the recombinant product into competent E. coli cells, plate the cells and culture them for 16-20 hours. Then, pick single clones from the plates for colony PCR. Send positive clones for sequencing to screen out the correct 30A+10bp+10A vector.

4. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 3, characterized in that, The sequence of the long annealing primer includes the following consecutive base sequence: 30 consecutive A bases, 10 bp of discontinuous bases, and 10 consecutive A bases; the long annealing primer includes an IIS restriction endonuclease cleavage site; the IIS restriction endonuclease cleavage site is the same as the BsaI cleavage site.

5. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 2, characterized in that, The construction steps of the first 60A vector and the second 60A vector are the same, and the construction of the first 60A vector includes the following steps: Step B1: Design and synthesize overlap PCR primers; Step B2: PCR amplification of the PBBF vector and gel recovery of the amplification product to obtain the PCR product of the PBBF vector; Step B3: Perform a recombination reaction between the overlap PCR primers and the PCR product of the PBBF vector to obtain recombinant product two; Step B4: After transforming the recombinant product II into competent E. coli cells, plate them and culture for 16-20 hours. Then, pick single clones from the plate for colony PCR. Send positive clones for sequencing to screen out the correct first 60A vectors. The nucleotide sequence of the PBBF vector is shown in SEQ ID NO.

6.

6. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 5, characterized in that, The overlap PCR primers comprise 60 consecutive A base sequences; the overlap PCR primers comprise IIS class restriction endonuclease cleavage sites; the IIS class restriction endonuclease cleavage sites are identical to the BsaI cleavage sites.

7. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 2, characterized in that, The correct pre-optimization recombinant vectors mentioned in step three include the pre-optimization 30A-L-70A vector and the pre-optimization 120A vector; the nucleotide sequence of the pre-optimization 30A-L-70A vector is shown in SEQ ID NO.7; the nucleotide sequence of the pre-optimization 120A vector is shown in SEQ ID NO.

8.

8. The method for preparing a carrier for synthesizing a stable PolyA tail according to claim 2, characterized in that, The PCR primers for the PKBF vector described in step four include PKBF-F primers and PKBF-R primers; The nucleotide sequence of the PKBF-F primer is shown in SEQ ID NO.10, and the specific sequence is as follows: TGTCATGATAATAATGGTTTCTTTAGACGTCGCCTGGGGTGCCTAATGAGTGAGCTAACTC; The nucleotide sequence of the PKBF-R primer is shown in SEQ ID NO.11, and the specific sequence is as follows: CGTCGACTGCAGAGGCCTGCATGCAAGCTTTCAGTACAATCTGCTCTGATGCCGCATAGT.

Citation Information

Patent Citations

  • Method for preparing recombination plasmid carrying short hairpin RNA and use

    CN101363027A

  • Construction and application of vector used for developing high-expression cell strain

    CN103525867A